Printer Friendly

Latex protein extracts from Calotropis procera with immunomodulatory properties protect against experimental infections with Listeria monocytogenes.

ABSTRACT

Background: The latex from the medicinal plant Calotropis procera is often used in folk medicine against infectious and inflammatory diseases.

Purpose: In this study, we investigate a protein fraction with immunomodulatory properties, named [LP.sub.PI] against experimental infections, in vitro and in vivo, with a virulent strain of Listeria monocytogenes.

Study design: [LP.sub.PI] was exposed to cultured macrophages or Swiss mice and then challenged with L monocytogenes.

Methods: Peritoneal macrophages were obtained from Swiss mice, and cultured in 96-well microplates. Soluble latex proteins (LP) were subjected to fractionation by ion-exchange chromatography. The major peak ([LP.sub.PI]) was added into wells at 10 or 100 [micro]g/ml. Albumin (100 [micro]g/ml) was used for comparison between protein treatments. After incubation for 1 h at 5% C[O.sub.2]/ 37[degrees]C, the supernatant was discarded and 0.2 ml of L. monocytogenes overnight culture was added in the wells. Following 4h and 24 h infection, the cytokine mRNA expression was evaluated as well as the number of intracellular colony forming units. Swiss mice (n = 16) were injected intraperitoneally (i.p.) with [LP.sub.PI] (5 and 10mg/kg) while the control mice received albumin (10mg/kg) or LP (10 mg/kg). After 24 h, all animal groups were challenged with L monocytogenes ([10.sup.6] CFU/ ml), also by i.p. route.

Results: [LP.sub.PI] was not toxic to uninfected macrophages (pMO) and significantly increased mRNA expression of TNF-[alpha], IL-[beta], IL-1[beta] and iNOS. Following infection, cell viability was reduced by 50% in albumin- treated pMO (control): but only 17% in pMO treated with [LP.sub.PI] at 100 [micro]g/ml. In this case, [LP.sub.PI] increased expression of TNF-[alpha] and IL-[beta] whereas the number of bacterial colony-forming units was reduced 100-fold in comparison to control groups. Swiss mice pretreated with [LP.sub.PI] showed dose-dependent survival rates that reached 80%, while mice that received albumin died 1-3 days after infection. After 24 h infection, leukocyte migration to the infectious foci was high in [LP.sub.PI]-treated mice whereas the number of viable bacteria in the peritoneal fluid, liver and bloodstream were significantly reduced.

Conclusion: We conclude that [LP.sub.PI] present immunomodulatory properties that are beneficial for prevention of systemic bacterial infections caused by the intracellular bacteria L. monocytogenes.

Keywords:

Laticifer fluid

Experimental infections

Cytokines

Intracellular infection

Introduction

About 10% of Angiosperm species release laticifer fluids when their tissues are damaged (Farrel et al., 1991). Although these lattices apparently do not play a role in primary metabolism, at least part of the success of flowering plants in various environments is related to their protective functions against insects and microorganisms as well as their role in wound healing (Konno, 2011). Plants' lattices are sources of bioactive compounds, including analgesic alkaloids like morphine (Papaver spp.), glycosides with effects on cardiac function (Asclepias spp.), sesquiterpene lactones (Lactuca spp.) and digestive proteases (Carica papaya and Ficus spp.) (Agrawal and Konno, 2009). Calotropis procera (Aiton) Dryand. (Apocynaceae) is a laticifer plant broadly distributed in arid and semi-arid regions of Africa, Asia and South America (Kakkar et al., 2012). Its biological activities include antitumor, antipyretic, analgesic, anti-inflammatory and inflammatory actions (Dewan et al., 2000a and 2000b; Arya and Kumar, 2005; Choedon et al., 2006; Alencar et al., 2006).

In a previous work, C. procera latex protein fractions with immunomodulatory properties were obtained by ion exchange chromatography from the whole set of soluble proteins (LP) (Alencar et al., 2004; Alencar et al., 2006). The major peak, named [LP.sub.PI], showed to be devoid of protease activity and rich in proteins with chitinolytic activity (Oliveira et al., 2007; Freitas et al. (2007). Accordingly, proteomic analysis based in two-dimensional electrophoresis and mass spectrometry analyses, n-terminal amino acid sequence and specific enzymatic assays performed in our laboratory have shown that [LP.sub.PI] harbor isoforms of chitinase-like proteins (unpublished data). LPP1 harbor inflammatory plus anti-inflammatory properties depending on administration route in a model of peritonitis induced by carrageenan (Oliveira et al., 2012). We have shown that i.p. injection of LP or LPPI into the peritoneal cavity of Swiss mice prevent septic shock in a model of Salmonella-mediated inflammation (Lima-Filho et al., 2010; Oliveira et al., 2012). [LP.sub.PI] treatments reduced the bacterial load in bloodstreams, liver and spleen enhancing 100% survival in comparison to control animals that died 1-3 days after infection (Oliveira et al., 2012).

Listeria monocytogenes is the etiological agent of human listeriosis, a serious food-borne bacterial illness with clinical manifestations ranging from gastroenteritis to severe invasive forms. This bacterium has tropism for the nervous system and can cross the blood-brain barrier, causing meningitis and encephalitis (Hof et al., 1997). The success in resolving listeriosis requires participation of innate and acquired cell immunity mechanisms, involving neutrophils, macrophages, NK cells, T lymphocytes and an array of cytokines (Harty et al., 1996). Considering the promising effect of [LP.sub.PI] on prevention of experimental systemic infections caused by S. enterica serovar typhimurium, the goal of this study was to investigate its role in the immune response during experimental infections with a virulent strain of L. monocytogenes.

Material and methods

All procedures were performed in accordance with internationally accepted principles for the use of laboratory animals, and were approved by the experimental ethics committee of Federal Rural University of Pernambuco (License 024/2014).

Microorganisms

L. monocytogenes (strain LM619) was isolated from a human clinical case and kindly provided by Dr. Nilma Cintra Leal, who maintained the bacterium as part of the culture collection of Fiocruz-Recife, PE. The bacteria were incubated overnight in brain-heart infusion broth (BHI), and culture inocula were adjusted after spectrophotometer reading at 630 nm (O.D. 0.5, [10.sup.8] cells per ml).

Latex proteins from C. procera

A plant specimen of C. procera (Voucher No. 32663) was deposited in the Prisco Bezerra Herbarium, Federal University of Ceara, Brazil. Latex proteins were obtained as described by Alencar et al. (2004). Briefly, the latex was collected in plastic tubes through incisions in the shoot apex of healthy plants, using a sharp blade. Then, sterilized distilled water was added to complete a ratio of 1:1 (v: v). This solution was subjected to centrifugation at 5000 g (10[degrees]C for 10 min) and the precipitate, mainly consisting of rubber, was discarded. The supernatant was dialyzed against distilled water (1:10, v: v) at 8[degrees]C for 60 h. After being centrifuged at 5000 g (10[degrees]C for 10 min), a clear supernatant rich in proteins and devoid of rubber was obtained. These soluble proteins (LP) were lyophilized and then subjected to fractionation by ion exchange chromatography with a CM Sepharose fast-flow column previously equilibrated with 50 mM of acetate buffer (pH 5.0) (Ramos et al., 2009). Three protein fractions, named [LP.sub.PI], and [LP.sub.PI], [LP.sub.PIII], were obtained, lyophilized and then stored at room temperature until use. The major peak ([LP.sub.PI]), which is devoid of protease activity (Oliveira et al., 2007), was used in the present study (Fig. 1, supplementary file).

Animals

Swiss mice (Mus musculus) were obtained from the Biotery of Keizo Asami Immunopathology Laboratory (LIKA) at Federal University of Pernambuco. The animals weighed 30-35 g and were maintained in cages with controlled lighting (12 h light/dark cycles), temperature of 25[degrees]C, with free access to water and standard feed (Purina, Pauline, SP, Brazil).

Peritoneal macrophages

Peritoneal macrophages (pMO) were obtained by washing the mice's peritoneal cavities with Roswell Park Memorial Institute (RPMI) medium plus 20% fetal calf serum (FCS), penicillin (100U/ml) and streptomycin (100 [micro]g/ml), preheated to 37[degrees]C. The cell cultures were quantified in a Neubauer chamber by the Trypan blue exclusion method, and adjusted to contain 1 x [10.sup.7] cells/ml. Then, 0.2 ml was added per well in 96-well plates (2 x [10.sup.5] cells/well). The experiments were conducted after overnight incubation at 5% C[O.sub.2]/37[degrees]C.

In vitro toxicity test

The pMO values were obtained according to item 2.4. After 12-16 h of incubation, the supernatant was removed and the wells were washed three times with phosphate buffered saline (PBS, pH 7.4). Sterile stock solutions of [LP.sub.PI] were prepared in RPMI medium without antibiotics and twofold diluted into wells to produce final concentrations ranging from 3.12 to 400 [micro]g/ml. Doxorubicin (10 [micro]g/ml) was used as positive control. After 24 h, 20 [micro]l of resazurin (0.15mg/ml in sterile PBS) was added to each well. After another incubation period at 5% C[O.sub.2]/37[degrees]C for 4h, spectrophotometer readings were made at 630 nm. Cell viability was expressed as percentage relative to untreated pMO. Toxicity was classified as inactive (1-20%), weakly active (20-50%), moderately active (50-70%) or very active (70-100%) (Fouche et al., 2008). All experiments were performed in triplicate.

In vitro experimental infections with L. monocytogenes

Initially, 96-well plates were cultured with pMO, as described above. Then, 0.2 ml of [LP.sub.PI] (10 or 100 [micro]g/ml in RPMI) or albumin (100 [micro]g/ml) was added in the wells. After incubation for 1 h at 5% C[O.sub.2]/ 37[degrees]C, the supernatant was discarded and 0.2 ml of L. monocytogenes overnight culture was added in the wells at multiplicity of infection 10 (m.o.i.) (2 x [10.sup.6] CFU per well in RPMI). After a new incubation period (5% C[O.sub.2]/37[degrees]C for 1 h), the supernatant was discarded and the cells were washed with PBS. Then, 0.2 ml of gentamycin (100 [micro]g/ml in RPMI) was added to the wells and the plates were incubated for another hour (5% C[O.sub.2]/37[degrees]C). Afterwards, the supernatant was discarded and the cells were washed twice with RPMI medium preheated to 37[degrees]C. Finally, gentamycin (10 [micro]g/ml in RPMI) was added in the wells and 4h and 24 h after infection, 20 [micro]l of resazurin was added to measure cell viability as previously detailed. Cell viability was expressed as percentage relative to untreated plus uninfected pMO. All experiments were performed in triplicate.

Quantification of L. monocytogenes in pMO

After 4 h and 24 h of infection (m.o.i. 10), 40 [micro]l of 0.2% Triton X-100 was added to wells and the plates were left on ice for 20 min. Then, tenfold serial dilutions were carried out in PBS using 96-well microplates. Quantification of colony-forming units was performed through the "drop plate" method on selective Listeria agar (OXOID, Basingstoke, UK) after overnight incubation at 37[degrees]C.

Gene expression of pro-inflammatory cytokines in pMO treated with [LP.sub.PI]

The mRNA expression of pro-inflammatory cytokines was analyzed in pMO cultures treated with [LP.sub.PI] (10 to 100 [micro]g/ml) or albumin (100 [micro]g/ml) for 1 h, and then infected or not by LM619 for 4h and 24 h. In this case, the assay was conducted in 48-well plates (1 ml final volume per well). Bacterial lipopolysaccharide (2 [micro]g/ml, Sigma) was used as positive control. After incubation at 5% C[O.sub.2]/37[degrees]C, the supernatant was stored at -20[degrees]C in a freezer and pMO cultures were submitted to chemical cell lysis with Trizol (Sigma). Total RNA extraction was carried out as described everywhere. Construction of cDNA was performed with a commercial kit (Sigma M-MLV Reverse Transcriptase). Quantitative real-time PCR reactions were conducted following the manufacturer's instructions (Sigma SYBR-Green/Quantitative RT-PCR Kit). The following primers were used: Mouse [beta]-actin (Internal Control)--5' ATATCGCTGCGCTGGTCGTC 3', 5'AGGATGGCGTGAGGGAGAGC 3'; Tumor Necrosis Factor-[alpha] (TNF-[alpha])--5'GATCTCAAAGACAACCAACTAGTG 3', 5' CTCCAGCTGGAAGACTCCTCCCAG 3'; Interleukin-6 (IL-6)--5' TAATTCATATCTTCAACCAAGAGG 3', 5' TTGTCTAATGG GAACGTCACAC 3'); Interleukin-1[beta] (IL-1[beta])--5' AATCTCACAGCAGCACATCAA 3', 5' AGCCCATACTTTAGGAAGACA 3', and inducible nitric oxide synthase enzyme (iNOS)--5' TGTGGCTACCACATTGAAGAA 3', 5' TCATGATAACGTT TCTGGCTCTT 3'. The PCR reaction (20 [micro]l) was performed as follows: 40 cycles at 95[degrees]C for 35s plus 60[degrees]C for 60s (Q series Rotor Gene--Qiagen). The data were analyzed according to Dussault and Pouliot (2006). The following formula was used for comparison of the expression levels of genes of interest (G.I.) between control and experimental groups:

[DELTA][DELTA]Ct = [([CtG.I..sub.control] - Ct[Actin.sub.control]) - ([CtG.I..sub.Experimental] - Ct [Actin.sub.Experimental]]

The results were expressed in terms of fold variation using the following formula: [2.sup.[DELTA][DELTA]CT]

In vivo experimental infections with L. monocytogenes

Since naive macrophages represent more than 50% of leukocytes into the peritoneal cavity (Ray and Dittel, 2010), Swiss mice (n = 16) were injected intraperitoneally (i.p.) with 0.2 ml of [LP.sub.PI] (5 and 10mg/kg), diluted in sterile PBS, pH 7.2, while the control mice received 0.2ml of albumin (10mg/kg) or LP (10mg/kg). After 24 h, all animal groups were challenged with LM619 (0.2 ml; [10.sup.6] CFU/ml), also by i.p. route. The clinical symptoms and survival after infection were monitored daily for seven days. After infection for 4h and 24 h, four mice from each group were euthanized by use of inhalatory isoflurane for collection of biological material. The surviving animals were euthanized at the end of the experiment.

Quantification of L. monocytogenes in vivo

The brain, spleen and the liver of animals from all groups were aseptically removed, and homogenized in PBS pH 7.2. These organ suspensions and samples of blood and peritoneal fluid were subjected to tenfold serial dilutions, and 0.1 ml aliquots were plated onto selective Listeria agar (OXOID). After overnight incubation at 37[degrees]C, the number of colony forming units (CFU) were expressed as Log CFU per g of organ or ml of blood or peritoneal fluid.

Leukocyte cell counts

For total white blood cell counting, 20 [micro]l of blood or peritoneal fluid was homogenized with 380 [micro]l of Turk's reagent. An aliquot of this solution was used for leukocyte counting in a Neubauer chamber using an optical microscope. The differential count was made from smears stained with eosin methylene blue-Giemsa (Horobin et al., 2011).

Statistical analysis

Statistical differences between groups were obtained by analysis of variance (ANOVA) followed by the Bonferroni multiple comparison test with confidence interval set as P < 0.05. These analyses were performed and the corresponding graphs were obtained using the PRISM program version 5.0.

Results

Toxicity assays with peritoneal macrophages (pMO) have shown that [LP.sub.PI] is not toxic, with cell viability higher than 98% at doses ranging from 3.1 to 200 [micro]g/ml, and higher than 95% at the dose of 400 [micro]g/ml, 24 h after exposure (data not shown). Conversely, viability of macrophages treated with doxorubicin (10 [micro]g/ml) was reduced and reached only 83% (data not shown). Thus, experimental infections with L monocytogenes 619 (LM619) were conducted in pMO pre-treated for 1 h with [LP.sub.PI] at 10 or 100 [micro]g/ml or albumin 100 [micro]g/ml. In this case, cell viability was reduced by 50% in pMO infected with LM619; but only 17% in pMO treated with [LP.sub.PI] at 100 [micro]g/ml 24 h after infection (Fig. 1A). Accordingly, the number of colony-forming units in [LP.sub.PI]-treated pMO was 100-fold reduced in comparison to albumin control cells, which correlated with higher cell viability (Fig. 1B) (P<0.05). In vitro antimicrobial activity assays confirmed that LP and [LP.sub.PI] were not inhibitory against LM619 at concentrations ranging from 0.0019 to 1000 [micro]g/ml. The gene expression of pro-inflammatory cytokines and iNOS was investigated in cell cultures of pMO treated with LPPI. The results indicated that TNF-[alpha], IL-6 and IL-1[beta] as iNOS mRNA transcripts were upregulated by [LP.sub.PI] in a dose-dependent manner in uninfected pMO, after exposure for 4 h and 24 h (P < 0.05) (Fig. 2). However, although [LP.sub.PI] treatment increases expression of TNF-a as early as 4 h after infection with LM619 (P<0.05), the cytokine was down-regulated 24 h post-infection (Fig. 3). In addition, IL-1[beta] mRNA transcripts were produced at similar levels between control and experimental groups whereas IL-6 was upregulated after infection for 24 h (P<0.05) (Fig. 3). None transcripts for iNOS were recorded after infection with LM619 for all groups.

Due to the lack of toxicity and the protection afforded by [LP.sub.PI] against infection with virulent L monocytogenes in vitro, this protein fraction was used for in vivo experiments. Swiss mice pretreated with a single inoculum of [LP.sub.PI], 24 h before i.p. challenge with LM619 showed dose-dependent survival rates that reached 80%, while mice that received albumin died 1-3 days after infection (Fig. 4) (P<0.05). Conversely, similar pretreatment with the entire set of C. procera latex proteins (LP) did not increase survival following infection (Fig. 4). The i.p. inocula with [LP.sub.PI] induced accumulation of leukocytes in the peritoneal cavity, and increased the number of circulating leukocytes in the bloodstream as early as 4 h after infection (P < 0.05) (Fig. 5). After infection for 24 h, leukocyte migration into the peritoneal cavity was significantly higher in [LP.sub.PI]-treated mice in comparison to control groups (P<0.05). This was accompanied by a reduction in the number of circulating leukocytes in all animal groups but less intense in mice that received [LP.sub.PI] (P<0.05) (Fig. 5). The infection caused by LM619 resulted in neutrophilia and lymphopenia 4h after infection, which was at least partially reversed by treatment with both LP and [LP.sub.PI] (Table 1). No changes were observed in the blood levels of eosinophils, monocytes and basophils of all animal groups (Table 1). After 24 h infection, the number of viable bacteria in the peritoneal fluid, liver and bloodstream were significantly reduced in [LP.sub.PI]-treated mice (P<0.05) (Fig. 6). Indeed, LM619 was not detected in the brain of mice pretreated with [LP.sub.PI], after 4 h and 24 h, whereas the bacterial load reached [10.sup.3] per g/organ in the brain of the control animals (Fig. 6C). No differences in the bacterial load were observed in spleens of all animal groups after infection (P0.05).

Discussion

Early activation of innate immune responses is essential for host survival after infection with L. monocytogenes. Following infection, circulating and resident macrophages release TNF-[alpha] and IL-12, evoking IFN-[gamma] production by NK cells, an important primary defense response (Tripp et al., 1993). Granulocytes and macrophages impair the proliferation of L monocytogenes in the liver and spleen, and therefore the oxidative burst and the production of nitric oxide (NO) in activated phagocytic cells contributes to bacterial clearance (Conlan and North, 1994). We have shown that treatments with [LP.sub.PI] up-regulates pro-inflammatory cytokines, which are important in leukocyte activation and recruitment. Previously, although [LP.sub.PI] was cytotoxic to different neoplastic cells lines, none toxic effect was recorded against healthy human leukocytes (Oliveira et al., 2007). Accordingly, here we corroborate these findings since toxicity was not noticeable against peritoneal macrophages from Swiss mice.

Although TNF-[alpha] was down-regulated 24 h post-infection of pMO with L monocytogenes strain LM619, we confirmed that [LP.sub.PI] prompted TNF-[alpha] at early time points and IL-6 mRNA transcripts 24 h after infection. This enhanced intracellular bacterial killing and reduced the bacterial load by at least 100-fold. However, although the [LP.sub.PI] treatments to uninfected pMO up-regulated iNOs gene expression, no transcripts were recorded after infection with LM619. It is well known that L. monocytogenes can overcome early immune responses, although the mechanisms are not clear. Gouin et al. (2010), showed that InlC (internalin family) impairs phosphorylation and delays I[kappa]B degradation often induced by TNF-[alpha], abrogating activation of NF-[kappa]B. The bacteria are also resistant to serum complement, impairing formation of the membrane attachment complex (Brown, 1985). Nevertheless, we assumed that a reduction in the bacterial load in [LP.sub.PI]-treated pMO was probably due to reactive oxygen species derived from the oxidative burst.

Experimental infections carried out in Swiss mice have shown that a single administration with [LP.sub.PI] significantly increased survival after challenge with L. monocytogens LM619. On the other hand, similar treatments with albumin or LP did not protect the animals. This finding indicates that proteolytic peptidases from C. procera latex are not involved with protection against L. monocytogenes. Furthermore, control animals showed piloerection and prostration whereas these clinical symptoms were mild and only observed in some mice of the [LP.sub.PI]-group. The pretreatment with [LP.sub.PI] induced significant accumulation of leukocyte in the bloodstreams as early as 4 h after challenge, and increased migration of leukocytes into the peritoneal cavity, producing a tenfold reduction in the local bacterial load and limiting the spread of L. monocytogenes to several organs. The bacterial load was also reduced in the brain and the liver 24 h after infection; but not in the spleen.

Severe bacterial infections usually cause failure of migration of leukocytes to the infectious foci, among other inflammatory disorders, leading to septic shock and death (Benjamim et al., 2002; Alves-Filho et al., 2005). Following intravenous inoculation, L. monocytogenes is captured from the bloodstream by resident macrophages in the spleen and liver Aichele (2003). Immunosuppression after L. monocytogenes infection usually results in increased apoptosis of resident and circulating lymphocytes (Jiang et al., 2003; Henkis et al., 2009). We confirmed that experimental infections with LM619 caused lymphopenia, which was markedly reduced in mice treated with [LP.sub.PI], 24 h post-infection. Likewise, [LP.sub.PI] induced proliferation of neutrophils in the bloodstream whereas untreated mice showed neutropenia.

Recently, Chaudhary et al. (2015) have shown intravenous injection with [LP.sub.PI] is antiedematogenic and normalized the levels of oxidative stress markers with preservation of tissue architecture in comparison to diclofenac. Although the role of mammalian chitinases on inflammation is not clear, chitinase 3-like-1 (CHI3L1) expressed by macrophages increases internalization of intracellular bacteria such as Salmonella (Kawada et al., 2007). Here we have shown that [LP.sub.PI] rich in plant chitinases can positively influence the immune response and potentially mimic mammalian chitinases against intracellular bacterial infections. Since medicinal plants have been used worldwide to treat infections and inflammatory diseases, we conclude that selected bioactive proteins with immunomodulatory properties from the latex of C. procera are interesting tools for prevention of intracellular bacterial infections.

ARTICLE INFO

Article history:

Received 14 October 2015

Revised 22 March 2016

Accepted 30 March 2016

Conflict of interest

The authors declare no conflict of interest.

Acknowledgments

This study was funded by the Brazilian National Research Council (CNPq). The Coordination for the Improvement of Higher Education Personnel (CAPES) granted a doctoral scholarship for the first author Danielle CO Nascimento. This study is part of the consortium Molecular Biotechnology of Plant Latex supported by the RENORBIO, Brazil. We also thank Dr. Maria Helena Ribeiro (LIKA/UFPE) for the supply of animals used in this study.

Supplementary materials

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.phymed.2016.03.012.

References

Agrawal, A.a., Konno, K., 2009. Latex: a model for understanding mechanisms, ecology, and evolution of plant defense against herbivory. Annu. Rev. Ecol. Evol. Syst. 40, 311-331.

Aichele, P., Zinke, J., Grade. L., Schwendener, R.a., Kaufmann, S.H.E., Seiler, P., 2003. Macrophages of the splenic marginal zone are essential for trapping of blood-borne particulate antigen but dispensable for induction of specific T cell responses. J. Immunol. 171, 1148-1155.

Alencar, N.M.N., Figueiredo, I.S.T., Vale, M.R., Bitencurt, F.S., Oliveira, J.S., Ribeiro, R.A., Ramos, M.V., 2004. Anti-inflammatory effect of the latex from Calotropis procera in three different experimental models: Peritonitis, paw edema and hemorrhagic cystitis. Planta Med. 70, 1144-1149.

Alencar, N.M.N., Oliveira, J.S., Mesquita, R.O., Lima, M.W., Vale, M.R., Etchells, J.P., Freitas, C.D.T., Ramos, M.V., 2006. Pro- and anti-inflammatory activities of the latex from Calotropis procera (Ait.) R.Br. are triggered by compounds fractionated by dialysis. Inflamm. Res. 55, 559-564.

Alves-Filho, J.C., Benjamim, C.F., Tavares-Murta, B.M., Cunha, F.Q,, 2005. Failure of neutrophil migration toward infectious focus in severe sepsis: a critical event for the outcome of this syndrome. Mem. Inst. Oswaldo Cruz 100 Suppl 223-226. Arya, S., Kumar, V.L, 2005. Antiinflammatory efficacy of extracts of latex of Calotropis procera against different mediators of inflammation. Mediators Inflamm 2005, 228-232.

Benjamim, C.F., Silva, J., Farias Benjamim, C., Santana Silva, J., Bruno Fortes, Z., Aparecida Oliveira, M., Henrique Ferreira, S., Queiroz Cunha, F., 2002. Inhibition of leukocyte rolling by nitric oxide during sepsis leads to reduced migration of active microbicidal neutrophils. Infect. Immun. 70, 3602-3610.

Brown, E.J., 1985. Interaction of gram-positive microorganisms with complement. Curr. Top. Microbiol. Immunol. 121, 159-187.

Chaudhary, P., de Aradjo, V.C., Ramos, M.V., Kumar, V.L, 2015. Antiedematogenic and antioxidant properties of high molecular weight protein sub-fraction of Calotropis procera latex in rat. J. Basic Clin. Pharm. 6, 69-73.

Choedon, T., Mathan, G., Arya, S., Kumar, V.L., Kumar, V., 2006. Anticancer and cytotoxic properties of the latex of Calotropis procera in a transgenic mouse model of hepatocellular carcinoma. World J. Gastroenterol. 12, 2517-2522.

Conlan, J.W., North, R.J., 1994. Neutrophils are essential for early anti-Listeria defense in the liver, but not in the spleen or peritoneal cavity, as revealed by a granulocyte-depleting monoclonal antibody. J Exp Med 179, 259-268.

Dewan, S., Kumar, S., Kumar, V.L., 2000a. Antipyretic effect of latex of Calotropis procera. Indian J. Pharmacol. 32, 247-252.

Dewan, S., Sangraula, H., Kumar, V.L., 2000b. Preliminary studies on the analgesic activity of latex of Calotropris procera. J. Ethnopharmacol. 73, 307-311.

Dussault, A.-A., Pouliot, M., 2006. Rapid and simple comparison of messenger RNA levels using real-time PCR. Biol. Proced. Online 8, 1-10.

Farrel, B.D., Dussourd, D.E., Mitter, C., 1991. Escalation of plant defense: do latex/resin canals spur plant diversification. Amer. Nat. 138, 881-900.

Fouche, G., Cragg, G.M., Pillay, P., Kolesnikova, N., Maharaj, V.J., Senabe, J., 2008. In vitro anticancer screening of South African plants. J. Ethnopharmacol. 119, 455-461.

Freitas, C.D.T., Oliveira, J.S., Miranda, M.R.a, Macedo, N.M.R., Sales, M.P., Villas-Boas, La., Ramos, M.V., 2007. Enzymatic activities and protein profile of latex from Calotropis procera. Plant Physiol. Biochem. 45, 781-789.

Gouin, E., Adib-Conquy, M., Balestrino, D., Nahori, M.-A., Villiers, V., Colland, F., Dramsi, S., Dussurget, O., Cossart, P., 2010. The Listeria monocytogenes InlC protein interferes with innate immune responses by targeting the I[kappa]B kinase subunit IKK[alpha]. P. Natl. Acad. Sci. USA 107, 17333-17338.

Harty, J.T., Lenz, L.L., Bevan, M.J., 1996. Primary and secondary immune responses to Listeria monocytogenes. Curr. Opin. Immunol. 8, 526-530.

Henkin, C.S., Coelho, J.S., Paganella, M.C., Siqueira, R.M., Dias, F.S., 2009. Sepsis: a current view. Sci. Med. 19, 135-145.

Hof, H., Nichterlein, T., Kretschmar, M., 1997. Management of listeriosis. Clin. Microbiol. Rev. 10, 345-357.

Horobin, R.W., 2011. How Romanowsky stains work and why they remain valuable including a proposed universal Romanowsky staining mechanism and a rational troubleshooting scheme. Biotech. Histochem. 86, 36-51.

Jiang, J., Lau, L.L., Shen, H., 2003. Selective depletion of nonspecific T cells during the early stage of immune responses to infection. J. Immunol. 171, 4352-4358.

Kakkar, A., Verma, D.R., Suryavanshi, S., Dubey, P., 2012. Characterization of chemical constituents of Calotropis procera. Chem. Nat. Compd. 48, 155-157.

Kawada, M., Hachiya, Y., Arihiro, A., Mizoguchi, E., 2007. Role of mammalian chitinases in inflammatory conditions. Keio J. Med. 56, 21-27.

Konno, K., 2011. Plant latex and other exudates as plant defense systems: roles of various defense chemicals and proteins contained therein. Phytochemistry 72, 1510-1530.

Lima-Filho, J.V., Patriota, J.M., Silva, A.F.B., Filho, N.T., Oliveira, R.S.B., Alencar, N.M.N., Ramos, M.V., 2010. Proteins from latex of Calotropis procera prevent septic shock due to lethal infection by Salmonella enterica serovar typhimurium. J. Ethnopharmacol. 129, 327-334.

Oliveira, J.S., Pereira Bezerra, D., Teixeira de Freitas, C.D., Delano Barreto Marinho Filho, J., Odorico de Moraes, M., Pessoa, C, Costa-Lotufo, LV., Ramos, M.V., 2007. In vitro cytotoxicity against different human cancer cell lines of laticifer proteins of Calotropis procera (Ait.). R. Br. Toxicol, in Vitro 21, 1563-1573.

Oliveira, R.S.B., Figueiredo, I.S.T., Freitas, L.B.N., Pinheiro, R.S.P., Brito, GAG, Alencar, N.M.N., Ramos, M.V., Ralph, M.T., Lima-Filho, J.V., 2012. inflammation induced by phytomodulatory proteins from the latex of Calotropis procera (Asclepiadaceae) protects against Salmonella infection in a murine model of typhoid fever. Inflamm. Res. 61, 689-698.

Ray, A., Dittel, B.N., 2010. Isolation of mouse peritoneal cavity cells. J. Vis. Exp. 28, 1488.

Ramos, M.V, Oliveira, J.S., Figueiredo, J.G., Figueiredo, I.S.T., Kumar, V.L., Bitencourt, F.S., Cunha, F.Q., Oliveira, R.S.B., Bomfim, L.R., Vitor Lima-Filho, J., Alencar, N.M.N., 2009. Involvement of NO in the inhibitory effect of Calotropis procera latex protein fractions on leukocyte rolling, adhesion and infiltration in rat peritonitis model. J. Ethnopharmacol. 125, 387-392.

Tripp, C.S., Wolf, S.F., Unanue, E.R., 1993. Interleukin 12 and tumor necrosis factor alpha are costimulators of interferon gamma production by natural killer cells in severe combined immunodeficiency mice with listeriosis, and interleukin 10 is a physiologic antagonist. P. Natl. Acad. Sci. USA 90, 3725-3729.

Danielle Cristina de Oliveira Nascimento (a), Maria Taciana Ralph (a), Jacqueline Ellen Camelo Batista (a), Diogo Manoel Farias Silva (b), Manoel Adriao Gomes-Filho (b), Nylane Maria Alencar (c), Nilma Cintra Leal (d), Marcio Viana Ramos (e), Jose Vitor Lima-Filho (a), *

(a) Departamento de Biologia, Universidade Federal Rural de Pernambuco, Recife-PE, Brazil

(b) DepartamenCo de Morfologia e Fisiologia Animal, Universidade Federal Rural de Pernambuco, Recife-PE, Brazil

(c) Departamento de Fisiologia e Farmacologia, Universidade Federal do Ceard, Fortaleza-CE, Brazil

(d) Departamento de Microbiologia, Centro de Pesquisa Aggeu Magalhaes, Fiocruz, Recife, PE

(e) Departamento de Bioquimica e Biologia Molecular, Universidade Federal do Ceard, Fortaleza-CE, Brazil

Abbreviations: LP, entire set of latex soluble proteins from C. Procera; [LP.sub.PI], protein fraction (peak 1) obtained from LP through ion-exchange chromatography; [LP.sub.PII], protein fraction (peak 2) obtained from LP through ion-exchange chromatography; [LP.sub.PIII], protein fraction (peak 3) obtained from LP through ion-exchange chromatography; pMo, mice peritoneal macrophages; mRNA, messenger RNA; cDNA, complementary DNA; TNF-[alpha], Tumor Necrosis Factor alpha; IL-6, interleukin 6; IL-1[beta], Interleukin-1 beta; inos, inducible Nitric Oxide Synthase; i.p., intraperitoneal; NK, Natural Killer lymphocytes.

* Corresponding author. Rua Dom Manoel de Medeiros, s/n, Departamento de Biologia, Lab. de Microbiologia e imunologia (LAMIM), Universidade Federal Rural de Pernambuco, Campus Dois Irmaos, Recife, Pernambuco CEP 52171-900, Brazil. Tel.:+55 31 81 33206312.

E-mail address: jvitor@db.ufrpe.br, jvitormlf@yahoo.com.br (J.V. Lima-Filho).

http://dx.doi.org/10.1016/j.phymed.2016.03.012

Table 1
Leukocyte cell counts in the bloodstream of Swiss mice pretreated
with LP or LPpi following infection with L. monocytogenes
(strain LM619).

                                                 Differential
                          Total Leukocytes       leukocytes count
                          ([10.sup.3] cells/     ([10.sup.3]
       Treatment          [mm.sup.3])            cells/[mm.sup.3])

                                                 Eosinophils

4 h    Healthy animal     2.98 [+ or -] 0.25     0.39 [+ or -] 0.39
       Albumin 10 mg/kg   4.30 [+ or -] 1.54     0.40 [+ or -] 0.13
       LP 10 mg/kg        2.73 [+ or -] 4.35 *   0.19 [+ or -] 0.19
       [LP.sub.PI], 10
         mg/kg            5.90 [+ or -] 3.65 *   0.42 [+ or -] 0.42
24 h   Healthy animal     3.01 [+ or -] 0.87     0.41 [+ or -] 0.4
       Albumin 10 mg/kg   1.66 [+ or -] 0.87     0.30 [+ or -] 0.18
       LP 10 mg/kg        1.19 [+ or -] 0.53     0.10 [+ or -] 0.10
       [LP.sub.PI] 10
         mg/kg            2.40 [+ or -] 1.14 *   0.50 [+ or -] 0.20

                          Differential leukocytes count ([10.sup.3]
       Treatment          cells/[mm.sup.3])

                          Lymphocytes             Neutrphils

4 h    Healthy animal     72.46 [+ or -] 2.23     19.60 [+ or -] 3.01
       Albumin 10 mg/kg   50.01 [+ or -] 1.30     40.81 [+ or -] 1.48
       LP 10 mg/kg        76.06 [+ or -] 1.44 *   15.10 [+ or -] 1.45 *
       [LP.sub.PI], 10
         mg/kg            87.01 [+ or -] 0.15 *   17.62 [+ or -] 0.12 *
24 h   Healthy animal     68.16 [+ or -] 2.02     17.90 [+ or -] 2.93
       Albumin 10 mg/kg   15.93 [+ or -] 0.96      9.70 [+ or -] 1.14
       LP 10 mg/kg        23.96 [+ or -] 0.85 *   38.68 [+ or -] 0.81 *
       [LP.sub.PI] 10
         mg/kg            36.09 [+ or -] 0.70 *   41.16 [+ or -] 0.59 *

                          Differential leukocytes count ([10.sup.3]
       Treatment          cells/[mm.sup.3])

                          Monocytes             Basophils

4 h    Healthy animal     12.80 [+ or -] 3.21    0.0 [+ or -] 0.0
       Albumin 10 mg/kg    8.52 [+ or -] 0.07   0.30 [+ or -] 0.30
       LP 10 mg/kg         9.46 [+ or -] 0.09    0.0 [+ or -] 0.0
       [LP.sub.PI], 10
         mg/kg            10.14 [+ or -] 0.09   0.04 [+ or -] 0.03
24 h   Healthy animal     11.40 [+ or -] 2.11    0.0 [+ or -] 0.0
       Albumin 10 mg/kg    4.20 [+ or -] 0.18   0.02 [+ or -] 0.04
       LP 10 mg/kg         5.26 [+ or -] 0.07   0.01 [+ or -] 0.01
       [LP.sub.PI] 10
         mg/kg             4.15 [+ or -] 0.13   0.20 [+ or -] 0.20

* Significant difference in comparison to mice administered
with albumin (P < 0.05).
COPYRIGHT 2016 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Nascimento, Danielle Cristina de Oliveira; Ralph, Maria Taciana; Batista, Jacqueline Ellen Camelo; S
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Article Type:Report
Geographic Code:3BRAZ
Date:Jun 15, 2016
Words:5672
Previous Article:Berberine induces neuronal differentiation through inhibition of cancer stemness and epithelial-mesenchymal transition in neuroblastoma cells.
Next Article:The authenticity and quality of Rhodiola rosea products.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters