Printer Friendly

Isolation of an effective nitrogen-fixing strain N1115 from rice rhizosphere by rice germ lectin.

Nitrogen is an essential element for plant growth as well as is the most significant yield-limiting element in many agricultural production systems. Although more than three quarters of the atmosphere is nitrogen gas, most of them are unavailable to be used directly, attributing to that majority organisms can not assimilate the dinitrogen molecule due to its stable form (1). Nitrogen-fixing (N-fixing) bacteria have the ability to reduce dinitrogen to ammonium, which can be easily absorbed by plants. It is reported that N-fixing bacteria can establish symbioses with plants by forming a specialized organ for symbiosis on the host plant's roots (1). Through this way, N-fixing bacteria can build a stable root system, and fertilize soil through nitrogen fixation, improve soil structure, and promote the virtuous cycle of the soil ecosystem.

As we know, fertilizers are essential components of modern agriculture because they provide essential chemical nutrients to plants. However, overuse of fertilizers can cause inevitable environmental issues, such as soil compaction (2). Under this situation, biofertilizers, which can be used in improving the soil conditions, is defined as a substance which contains living microorganisms when applied to plant leaves, seeds, or soil, and colonizes the rhizosphere or the interior of the plant and promotes growth by increasing the supply or availability of primary nutrients to the host plant (3). Since the use of rhizobia as a biofertilizer is a friendly environmental alternative to mineral fertilization, inoculation of legumes is a common agricultural practice (4). The application of biofertilizers could increase the amount of dry matter production in a root (5). According to Veres et al (6), the application of biofertilizers could increase the amount of dry matter production both in a root and shoot of maize. One potential way to decrease negative environmental impacts resulting from continued use of chemical fertilizers is inoculation with plant growth-promoting rhizobacteria (PGPR) (2). So it is important to isolate bacteria from plants rhizosphere soil to develop the potential biofertilizer and reduce environment pollution.

It is generally believed that bacteria are the main microorganisms in the plant rhizosphere, exhibiting ability in nitrogen-fixation, phosphate-releasing and potassium-releasing. Those kinds of bacteria stimulate plant producing more hormones and increasing higher ability to promote plant growth, prevent disease, increase crop yields, for that reasons those bacteria groups are known as PGPRs (7,8). It has been reported that PGPR (including the root surface and rhizosphere) and microorganisms will be involved in complex signal between the exchange and mutual recognition process if getting the successful colonization on plants root. Meanwhile plants could identify the microorganisms by the secreting substances, such as plant lectins and flavonoids, microbial synthesis of extracellular polysaccharides, LPS, capsular polysaccharide and root-cadherin (rhicadhesin), etc (9,10). As mentioned above, here we mainly focus on lectins.

Lectin, a class of sugar-binding and cell-agglutinating proteins, ubiquitous in nature, being found in all kinds of organisms (11) and lectin recognition hypothesis points out that lectin have specific binding sites both on root hair and bacterial polysaccharides, so it can be used as a bridge to link biomass and root hair. When bacteria locate in root tip, and gathered great amount, then it will start the next phase of the reaction, leading to the successful colonization in plant root. Genetic engineering also confirms that lectins play a key role in the rhizosphere adsorption and infection (12) (13). However, the research focused on the rice germ lectin is still rare. Here, we attempt to use RGL as a possible model to explore the function between the plants and microorganisms.

The purpose of this study is to identify the role of RGL in the plants and microbes. By using the rice germ lectin labeled with fluorescein isothiocyanate (FITC), and through analysis of the physical and biochemical properties as well as 16SrRNA partial gene sequences, we isolated a nitrogen-fixing stain N1115 from rice rhizosphere soil. We proposed a possible attempt for selecting PGPR to be used as biofertilizer.

MATERIALS AND METHODS

Soil sample, rice seeds and rice germ lectin labeled with FITC

Soil sample was collected from rice root rihzosphere in Anhui Agricultural University farm and put in sterilized paper bag, stored in 4[degrees]C. Rice seeds (Guo feng No.1) were bought from Feng Le Company (http://www.fengle.com.cn/). Rice germ lectin (RGL) was extracted and labeled with FITC according to Marshall (14).

Isolation of strains from rice rhizosphere

Ten gram soil sample was weighed and blended with 100 ml sterile water, diluting to different concentration, to prepare soil solution. Rice rhizosphere soil solution was incubated on the Ashby medium with compositions of (g/l): Glucose or mannitol 10.0g, K[H.sub.2]P[O.sub.4] 0.2, MgS[O.sub.4] x 7[H.sub.2]O 0.2, NaCl 0.2, CaS[O.sub.4]2[H.sub.2]O 0.1, CaC[O.sub.3] 5.0, agar 15~20, pH7.0-7.2, cultivated for 5 days at 28[degrees]C, then larger and transparent colonies were picked up to purify, and those strains was rescreened by RGL- FITC, and observed under fluorescence microscope. A FITC-specific green fluorescent could be seen through excited by blue light. One isolates N1115 was screened by this method to do the next experiments and this strain was preserved at -20[degrees]C for later study.

Phenotypic characterization of N1115

The morphology, physiological characteristics of strain N1115 were identified, including shape of colony and cell, gram staining, and the main biochemical attributes were tested, including use of glucose, activities of oxidase, catalase, amylase, H2S production and gelation liquefaction. M.R and V.P were also evaluated.

Test of nitrogen-fixing capacity of N1115

The nitrogen-fixing ability of N1115 was tested by method used as Mal'tseva, N. M et al (15). DNA Extraction, PCR amplification and analysis of 16SrRNA gene sequence

Ten mi-liter cultivated bacteria liquid was placed into a sterile microcentrifuge tube, and moved all the medium with 3500r/min centrifugation, then bacteria were precipitated by adding lysozyme, and 10% SDS and proteinase K, then sample was mixed in potassium acetate with 10000r/min centrifugation in microcentrifuge tube to collect supernatant and slowly added double volume of anhydrous ethanol, DNA was collected carefully and finally dissolved in TE buffer, preserving under the conditions at -20[degrees]C.

The complete 1.5 Kb 16SrRNA region of the isolate N1115 was amplified using primers (50 pmol/iL) as forward primer: (5' AGAGTTTGATCCTGGCTCAG -3') as reverse primer was: (5'- ACGGCTACCTTGTTACGACTT 3'). The total volume of PCR reaction system was 25pl. The PCR process was performed according to Park et at (16). The 16SrRNA partial gene sequence of isolate N1115 was determined commercially by the Shanghai biological Engineering Technology and services Co., Ltd (http://www.sangon.com/sangonindex.aspx).

The nucleotide sequences of the 16S rDNA were subjected to BLAST analysis with the NCBI database (http://blast.ncbi.nlm.nih.gov/Blast.cgi) with accession number KT964815. Sequences with high similarity scores were downloaded and a phylogenetic tree was constructed using MEGA 4.0 (17).

RESULTS

In our study, one nitrogen-fixing strain N1115 was obtained by re-screening with FITC-labeled rice germ lection which was showed in Fig.1. Strain N1115 was characterized on the basis of its morphological and cultural characteristics as well as its ability to produce growth hormones, fix nitrogen and utilize different carbon sources. This strain was Gram positive with rod cell shape and was fast-growing, and single cell length was (0.5 x 1.6) im/cell. The growing colonies were circular, translucent with smooth margins. The strain N1115 could use glucose and mannitol as carbon sources, and VP, M.P reactions were negative. Oxidase was negative while Catalase was positive. Gelatin liquefaction was positive as well as amylase (Table 1). This strain could not produce [H.sub.2]S in the test. The nitrogen-fixing capacity of the strain was 9.217 [+ or -] 0.148mg N/gG.

The total gene was successful extracted (Fig.2 A) and used as a template. 16Sr RNA gene partial sequences of strain N1115 were amplified. PCR amplification products were examined by 1.0% agarose gel electrophoresis, and it was clearly showed that an approximately 1500bp nucleotide fragments was amplified (Fig.2 B). The nucleotide sequences of the 16S rDNA were subjected to BLAST analysis with the NCBI database. A phylogenetic tree was constructed using MEGA 4.0. Based on the partial 16SrRNA sequences, the strain N1115 was closely affiliated with the genus Bacittusmegaterium (Fig.3).

DISCUSSION

The plant rhizosphere is the specific zone (2-3cm) of soil influenced by the roots, consisting of a multi-dimensional and dynamic ecological environment of microorganisms and soil system. PGPR have attracted attention because of the need to reduce the use of chemicals, especially when considering the context of sustainable agriculture and environmental protection (18). Considering this situation, biological nitrogen fixation, which is an essential process in the nitrogen cycle, provides a major source of available nitrogen for organisms (19). Increasing attention is currently being directed towards the contribution of beneficial microorganisms that can assimilate nitrogen from soil. In our study, we provide a possible way to use RGL as a tool to isolate nitrogen fixation bacteria from rice root.

In this study, we explore the function of RGL between PGPR and rice root. Many reports are focused on the research of plant lectins. Yegorenkova et at (20) have reported that Azospirittum brasitense might be involved in the recognition and cross-linking between wheat germ agglutinin and bacterial polysaccharide during the colonization on wheat roots. Antonyuk et at (21) point that wheat germ agglutinin(WGA) may promote the capacity of Brazilian Azospirittum in nitrogen-fixing. Taken all those progresses, we attempt to use RGL as a mediate to isolate bacteria from rice rhizosphere.

It is important to screen beneficial bacteria from plantation soil. Several studies have shown the positive effects of endophytic bacteria inoculation in plants, e.g. sugarcane (Saccharum spp.), leading to increased contribution of biological nitrogen fixation, to promotion of root development, increased biomass and productivity (18). Herein, we isolated a nitrogen fixation strain N1115 from rice root, showing satisfactory in nitrogen-fixing capacity, of which was 9.217 [+ or -] 0.148mg N/gG. This strain was fast-growing on the ashby medium which was lack of nitrogen resource, suggesting that strain N1115 had a strong ability to assimilate [N.sub.2] from the air.

Based on the molecular methods, we identified the 16Sr RNA partial gene sequences. According to the phylogenetic tree, strain N1115 belongs to Bacillus megaterium. Isolating of nitrogen fixation bacteria is still a hot research subject. Lots of bacteria have been reported in various genuses. For instance, species of Pseudomonas (22) and Paenibacillus (23) have been described as being nitrogen-fixers. Here, we obtained an isolate possessing ability to fix nitrogen in genus Bacillus, providing further information about nitrogen-fixing groups in the plant rhizosphere.

In summary, by using RGL as an isolating tool, one nitrogen fixation strain N1115 was obtained from rice root. According to the morphological characteristics and analysis of 16SrRNA partial gene sequence, strain N1115 was belonged to Bacillus genus. Herein, we proposed a possible method for selecting effective PGPR to apply in research and development of biofertilizer. Further studies are needed to test the application of strain N1115 in the field condition.

ACKNOWLEDGMENTS

We thank research assistants and postgraduate students in the lab for their help in this work. This study was supported by the Key Scientific Research Project of Colleges in Henan Province (15B180016), the Key Projects for Exceptional Young Teachers in Anhui Province (No. 2013 SQRL015ZD), the Natural Research Project of Anhui Province (090413082, 1208085QC62), the Basic and Advanced Technology Research in Henan Province (152300410092) the Dean's Youth Innovation Fund from Anhui Academy of Agricultural Sciences (15B0331).

REFERENCES

(1.) Kakoi, K., et al., Isolation of mutants of the nitrogen-fixing actinomycete Frankia. Microbes Environ, 2014; 29(1):31-7.

(2.) Adesemoye, A.O., H.A. Torbert, and J.W. Kloepper, Plant growth-promoting rhizobacteria allow reduced application rates of chemical fertilizers. Microbial Ecol, 2009; 58(4):921-929.

(3.) Vessey, J., Plant growth promoting rhizobacteria as biofertilizers. Plant and Soil, 2003; 255(2): 571-586.

(4.) Zahran, H.H., et al., Identification of rhizobial strains nodulating Egyptian grain legumes. Int Microbiol, 2013; 16(3):157-63.

(5.) Aseri, G.K., et al., Biofertilizers improve plant growth, fruit yield, nutrition, metabolism and rhizosphere enzyme activities of Pomegranate (Punica granatum L.) in Indian Thar Desert. ScientiaHorticul, 2008; 117(2):130-135.

(6.) Veres, S., et al., Correlation of nutrient contents and biofertilization. Cereal Res Commun, 2008; 36:1831-1834.

(7.) Berg, G., Plant-microbe interactions promoting plant growth and health: perspectives for controlled use of microorganisms in agriculture. ApplMicrobiolBiotechnol, 2009; 84(1):11-18.

(8.) Lugtenberg, B. and F. Kamilova, Plant-growth-promoting rhizobacteria. Annu Rev Microbiol, 2009; 63:541-556.

(9.) Hirsch, A.M., Role of lectins (and rhizobial exopolysaccharides) in legume nodulation Curr Opin Plant Biol, 1999; 2(4): 320-6.

(10.) Rodr'yguez-Navarro, D.N., M.S. Dardanelli, and J.e.E. Ru'yz-Sa'ynz, Attachmentof bacteria to the roots of higher plants. FEMS Microbiol Lett, 2007; 272:227-136.

(11.) NathanSharon, Lectins: past, present and future1. Biochem Soc Trans, 2008; 36-6.

(12.) Sharon, N. and H. Lis, Lectins as cell recognition molecules. Science, 1989; 246(4927): 227-234.

(13.) Ma, Q.H., B. Tian, and YL. Li, Overexpression of a wheat jasmonate-regulated lectin increases pathogen resistance. Biochimie, 2009; 92(2): 187-193.

(14.) Tabary, F., J. Balandreau, and R. Bourrillon, Purification of the rice embryo lectin and its binding to nitrogen-fixing bacteria from the rhizosphere of rice. Biochem Biophys Res Commun, 1984; 119(2):549-55.

(15.) Mal'tseva, N.M. and V.M. Iurchenko, The isotope method for the determination of the nitrogen-fixing ability of oligonitrophilous bacteria. Mikrobiol Zh, 1971; 33(5):650-4.

(16.) Park, M., et al., Isolation and characterization of diazotrophic growth promoting bacteria from rhizosphere of agricultural crops of Korea. Microbiol Res, 2005; 160(2):127-33.

(17.) Tamura, K., et al., MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol, 2007; 24(8):1596-9.

(18.) Szilagyi-Zecchin, V J., et al., Identification and characterization of endophytic bacteria from corn (Zea mays L.) roots with biotechnological potential in agriculture. AMB Express, 2014; 26.

(19.) Terakado-Tonooka, J., S. Fujihara, and Y. Ohwaki, Possible contribution of Bradyrhizobium on nitrogen fixation in sweet potatoes. Plant and Soil, 2013; 367(1-2):639650.

(20.) Yegorenkova, I.V., et al., Azospirillum brasilense colonisation of wheat roots and the role of lectin-carbohydrate interactions in bacterial adsorption and root-hair deformation. Plant and Soil, 2001; 231(2): 275-282.

(21.) Albareda, M., et al., Factors affecting the attachment of rhizospheric bacteria to bean and soybean roots. FEMS Microbiol Lett, 2006; 259(1):67-73.

(22.) Chan, Y-K., W.L. Barraquio, and R. Knowles, N2-fixing pseudomonads and related soil bacteria. FEMS Microbiol Rev, 1994; 13(1): 95-117.

(23.) Ma, Y, et al., Paenibacillus sabinae sp. nov., a nitrogen-fixing species isolated from the rhizosphere soils of shrubs. Int J System Evol Microbiol, 2007; 57(1): 6-11.

Jian Zhang [1,2] ([dagger]) *, Huiping Chang [3] ([dagger]), Zhongyou Ma [4], Yuanyuan Cao [1] *, Xinyun Tang [1], Qi an Zhang [2]

[1] School of Life Sciences, Anhui Agricultural University, Hefei 230036, Anhui Province, P R. China.

[2] Institute of Horticulture, Anhui Academy of Agricultural Sciences, Hefei 230031 Anhui Province, P R. China.

[3] Henan Institute of Education, Zhengzhou 450046, Henan Province, P R. China

[4] Department of Biology, Anhui Science and Technology University, Bengbu 233100, Anhui Province, P R. China.

(Received: 21 September 2015; accepted: 13 November 2015)

* To whom all correspondence should be addressed.

([dagger]) Contributed equally

Tel: +86-551-65160817; Fax: +86-551-65148169; E-mail: microbiol@126.com; caoyy721@sina.com

Caption: Fig. 1. Fluorescent photos of isolates stained by RGLFITC. A, Strain stained with RGL-FITC; B, Control treatment. Bar represents 5 pm.

Caption: Fig. 2. Photos of agarose gel electrophoresis. A, total gene extraction of N1115, Marker maximum: 1.5Kb; B, PCR amplification products (1500bp)

Caption: Fig. 3. Neighbor-joining phylogenetic tree based on 16S rRNA partial gene sequence Bar represents 0.005 substitutions per nucleotide position
Table 1. The physiological and biochemical characteristics of the
strain N1115

Strain   Gram        Single   Shape of colony
         staining    Cell
                     shape    surface    edge      color

N1115    [G.sup.+]   Rod      smooth     regular   transparent

Strain   glucose       oxidase   Catalase     VP   M.P
         utilization

N1115    +             -         +            -    -

Strain   gelatin        amylase      Production
         liquefaction   of
                        [H.sub.2]S

N1115    +              +            -
COPYRIGHT 2015 Oriental Scientific Publishing Company
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Zhang, Jian; Chang, Huiping; Ma, Zhongyou; Cao, Yuanyuan; Tang, Xinyun; an Zhang, Qi
Publication:Journal of Pure and Applied Microbiology
Article Type:Report
Date:Dec 1, 2015
Words:2710
Previous Article:First report of wilt disease caused by Fusarium oxysporum spp on fishtail palm in India.
Next Article:Molecular characteristics of anti-inflammatory activities in wood extractives of Quercus Aliena.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters