Printer Friendly

Isolation of Malathion Degrading Chromogenic Pseudomonas aeruginosa Strains From Insecticide Impregnated Soils.

Byline: Shagufta Andleeb, Muhammad Afzal Ghauri and Javed Iqbal Qazi

Abstract

Soil samples from an insecticide contaminated site were processed for isolation of malathion degrading bacteria. Selective medium containing malathion as sole carbon source was used for this purpose. Four isolates were identified as through ribotyping Pseudomonas. The bacteria, yielded water soluble greenish pigment both in nutrient broth as well as in the select media in a growth responsive fashion. These strains can be used for bioremediation of malathion contaminated soils or waters and add to the microbial diversity being conserved by workers from yet polluted environments. Chromogenic nature of these malathion degrading bacteria can make their action visible in select applied sites.

Key words: Bioremediation, malathion,

Pseudomonas

Pesticides geared increased agricultural productivities (Blain, 1990; Hashmi et al., 2004) have been accompanied with contamination of soil and water environments (Cisar and Synder, 2000; Getenga et al., 2000; Tse et al., 2004) and created hazards for human health including cancer (Van Maele-Fabry and Willems, 2003; Engel et al., 2005) and adverse effects on fertility (Golec et al., 2003).

Malathion is one of the general purpose organophosphate (OP), household and agricultural pesticides recommended for control of insects including the stored grains pests (Saleem and Shakoori, 1987; Shakoori and Saleem 1989; Wester and Cashman, 1989; Ali et al., 2007). It has quite earlier been found toxic for a variety of organisms (Butler, 1963; Culley and Applegate, 1967; Tagatz et al., 1974).

Different bacteria have been reported for successful bioremediation of polluted habitats, including insecticide contaminated soils and waters (el-Deeb et al., 2000; Bhadhade et al., 2002; Mohamed et al, 2010). Several bacteria such as Pseudomonas (Gill and Ballesteros, 2000); Actinomycetes (De-Schrijver and De-Mot, 1999); Escherichia coli (Elashvili et al., 1998); Arthrobacter sp. (Ohshiro et al., 1996); Flavobacterium sp. (Mallick et al., 1999) and Rhodococcus sp. (Parekh et al., 1994) capable of completely mineralizing OPs have been described. In fact, malathion has been used as a general insecticide since over the decades. Resultantly, water and soil habitats got contaminated with the insecticide and a large number of bacteria capable of degrading malathion have been reported. For instance various species of Bacillus genus capable of varying levels of malathion degradation have been isolated from soils (Singh et al., 2011; Kumari et al., 2012, Thabit and Naggar, 2012), while Pseudomonas sp.

upto 100% malathion degradation efficiency have been demonstrated by different workers (Rosenberg and Alexender, 1979; Abo- Amer, 2007; Goda et al., 2010; Thabit and Naggar 2012; Pankaj et al., 2013).

This paper reports malathion degrading bacteria from a locality having been influenced for more or less a decade by the run off of an insecticide formulating unit. The bacterial isolates appear good candidates for rehabilitation of soils contaminated with malathion following provision of other ingredients of a minimal medium. Moreover, the chromogenic ability of these Pseudomonas aeruginosa isolates may be helpful in assessing their activities in fluid environments.

Materials and methods

Samples were collected in sterilized glass bottles from insecticide influenced soils including the one that had been receiving drainage of a factory involved in formulation of pesticides. The samples were processed by mixing 10g of soil in 100 ml of autoclaved water and keeping the mixtures on orbital shaker (Digitek instruments) at 100 rpm for 2 hours at 30+-1oC. From each processed soil sample, 0.5 ml was spread over the surface of a selective medium with the help of glass spreader. The selective medium contained 0.5% malathion (commercial grade 50%), as sole source of carbon, 0.1% K2HPO4, 0.5% NH4NO3, 0.2% MgSO4 and 1.5% agar in distilled water.

The medium was routinely autoclaved and then 20ul of separately autoclaved mineral solution containing FeSO4 10%, CaCl2 10%, CuNO3 0.5%, zinc powder 0.5% and MnCl2 0.5% (w/v) was added. The inoculated plates were incubated at 37oC for 48 h. The bacterial growth was then streaked for pure culturing on nutrient agar and again on the selective medium. The isolates were preserved in glycerol stocks (10 % glycerine) for further use.

Each of the isolates was allowed to grow in minimal broth of the selective medium (without malathion) at 37oC for four days. O.D. of the inoculated broths was then noted at 600nm daily to declare their autotrophic/heterorophic nature.

Isolates expressing promising growths in the selective medium were identified by amplifying and sequencing their 16SrDNA as described by Ghauri et al. (2003). Accordingly genomic DNA was isolated from overnight cultivated culture in nutrient broth. Amplification of 16SrDNA was then carried out by using forward (fDI)

AGAGTTTGATCCTGGCTCAG and reverse (rP1)

ACGG (ACT) TACCTTGTTACGACTT primers.

Two times ReadyMix PCR Master Mix (Abgene) was used. Each reaction vial contained 25 ul master mix and the addition of the template (1 ul) and primers (fD1 and rP1, each 1ul) resulted in a final volume of 50 ul with nanopure water. The master mix contained 1.25 U Taq DNA polymerase, 75 mM TRIS-HCl (pH 8.8 at 25oC), 20 mM (NH4)2SO4, 2.5 mM MgCl2, 0.01% (v/v) Tween 20, 0.2 mM each of dATP, dCTP, dGTP, dTTP, precipitant, and red dye for electrophoresis.

The reaction mixture was heated at 95oC for 5 min. Amplification was carried out in thirty cycles. Each cycle comprised 30 s at 95oC, 40 s at 55oC and 2 min at 72oC. The final extension was carried out for 10 min at 72oC. Five ul amplicons were run on 1.5% agarose gel along with 1 kb 5M0313 Fermentas DNA ladder.

The PCR products were sequenced commercially (Macrogen Inc., Seoul, Korea). The gene sequences were compared with others in the Gene Bank databases using the NCBI BLAST (www.ncbi.nlm.nih.gov). Gene sequences of 16S rDNA of selected organisms were obtained from Gene Bank and aligned with gene sequence of our isolates using CLUSTALX.

Results and discussion

Inoculation of the processed soil samples and subsequent incubation yielded small colonies over surface of the selective medium indicating malathion consuming nature of the bacteria. Chemotrophic nature of the bacteria was confirmed by inoculating and incubating them in the minimal medium, where no growth was recorded upto 96 hrs.

Growth of these bacteria in nutrient broth indicated greenish pigment production by the isolates 2A, 3B and S1. These isolates also yielded the pigment when cultivated in the selective medium broth.

The partial sequence of the 16S rDNA of the isolates reported in this study had homology with Pseudomonas spp. (Table I).

Table I.- Relatedness on the basis of 16S rDNA homology.

Isolate code###Nearest Relative###Similarity (%)

3B###Pseudomonas aeruginosa (EF151192)###98%

2A###Pseudomonas aeruginosa strain MY 06 (DQ083947)###97%

3A###Pseudomonas putida strain NAA (DQ864462)###99%

S1###Pseudomonas aeruginosa strain SWD (DQ859983)###98%

S2###Acinetobacter baumannii sp. QN6 (DQ640274)###97%

The present study brings support to the generalization that continuous exposure to a drastic environment exerts selective pressure for microorganisms which results into appropriate ecological succession characterized with appearance of pollutant(s) resistant/utilizing microbes. Bacteria

Table II.- An overview of bacterial diversity reported for malathion degrading potential.

###Name of bacteria###Isolation###Enzyme(s) reported###Degrading efficiency###Reference(s)

###locality###for degradation

Pseudomonas###Soil###-a###100%###Rosenberg and

###Alexander (1979)

Serratia marcescens###Degraded###-###3.33-7.49%###Kannan and Vanitha

###Cattle Bone###(2005)

Pseudomonas aeruginosa AA112###Soil###About 3 Proteins of###Complete degradation###Abo-Amer A.E. (2007)

###high M.W.

Brevibacillus sp. Strain KB2###Soil###Carboxylesterase###36.22% in 7 days###Singh et al. (2011)

###activity

Bacillus cererus strain PU###Soil###Carboxylesterase###49.31% in 7 days###Singh et al. (2011)

###activity

Lysinibacillus sp. KB1###Soil###Carboxylesterase###20% in 7 days###Singh et al. (2012)

###activity

Bacillus sp.###Soil###-###-###Kumari et al. (2012)

Pseudomonas aeruginosa###Soil###-###T-value at P less than 0.05###Thabit and Naggar

###0.0149###(2012)

Bacillus pseudomycoides###Soil###-###T-value at P less than 0.05###Thabit and Naggar

###0.0077###(2012)

Bacillus licheniformes###Soil###-###T-value at P less than 0.05###Thabit and Naggar

###0.0079###(2012)

Pseudomonas xanthomarina###-###70.5% in 2 days###Pankaj et al. (2013)

Pseudomonas sp.###Soil###-###High degrading activity###Goda et al. (2010

Pseudomonas putida###Soil###Carboxylesterase###High degrading activity###Goda et al. (2010)

###enzyme

Micrococcus lylae###Soil###-###Low###Goda et al. (2010

Pseudomonas aurofaciens###Soil###-###Low###Goda et al. (2010)

Acetolacter liquefaciens###Soil###-###Low###Goda et al. (2010)

###-

aInformation was not available

are well known for being capable of adapting themselves to environments exerting a selective pressure by utilizing a myriad of man made toxic chemicals including pesticides.

Drained water from a pesticide formulating unit had altered the effected soils and the microbial community of the reported location. The bacteria reported in this communication used malathion successfully for their energy requirements, as sole carbon source. The isolates 3B, 2A, SI showed maximum homology with Pseudomonas aeruginosa. Production of green pigment in nutrient and the selective media broths, as observed in this study, is also a characteristic biochemical feature of P. aeruginosa. Yet they belonged to different strains as 3B, 2A and SI had 98%, 97% and 98% homologies,respectively with Pseudomonas aeruginosa, Pseudomonas aeruginosaMYO6 Pseudomonas aeruginosa SWD.

The isolate 3A had 99% homology with Pseudomonas putida strain NAA. 16S rDNA is being widely used to develop comparative cataloguing (Stackbrandt and Woese, 1981). Sequence information from the conserved regions is useful for studying phylogentic relationships (Woese et al., 1985) as well as for the design of universal oligonucleotide probes and primers used for identification and amplification, respectively (Giovannoni, 1991). Variable regions provide sequence data to develop specific probes and primers for detection of microorganisms by hybridization or with polymerase chain reaction (Ward et al., 1992). Using conserved primers, the 16S rDNA can be easily amplified by PCR not only from pure cultures but also directly from the environmental samples (Olsen et al., 1986; Giovannoni et al., 1990).

Polygenetic analysis of 16SrDNA strongly suggested that the bacterial isolates 3B, SI, 2A and 3A may be members of the genus Pseudomonas on the basis of their closest relatedness. The ability of Pseudomonas to degrade malathion is well known (Bourquin, 1975; Hashmi et al., 2002; Foster and Bia, 2004; Hashmi et al., 2004; Goda et al., 2010). Rather detoxification potential for other pollutants has also been reported by many workers. For example, Guerin and Boyd (1995), Prijambada et al. (1995), Duetz et al. (1996) and Mclaughlin et al. (2006) have reported detoxification potential of Pseudomonas species for naphthalene, nylon oligodimer, toluene 4-chlorophenol and toluene, respectively. In addition to the Pseudomonas sp. several other bacterial species capable of malathion degradation have been documented. In this regard a brief overview of malathion degrading bacterial isolates with respect to isolation locality and degradation potential is given in Table II.

The present isolates appear good candidates for rehabilitating malathion and/or other pollutant influenced soils. Surely maximum level of malathion tolerance has to be worked out in the presence of field conditions. Further work will delineate their usefulness for remediational strategies meant to be designed for gearing back the polluted environment.

Chromogenic nature of these malathion degrading P. aeruginosa isolates is an attractive attribute for designing water treatment bioremediation strategies where appearance of the pigment may have predictive value of reductions in the levels of a pollutant. Such earmark becomes especially important in field conditions.

References

Abo-Amer, A.E., 2007. Acta Microbial. Immunol. Hung., 54: 261-277.

Ali, N.S., Munir, M., Ali, S.S. and Shakoori, A.R., 2007. Pakistan J. Zool., 39: 179-184.

Bhadhade, B.J., Sarnaik, S.S. and Kanekar, P.P., 2002. Curr. Microbiol., 45: 346-349.

Blain, P.G., 1990. Adverse Drug React. Acute Poison. Rev., 9: 37-68.

Bourquin, A.W., 1975. U.S. Environ. Protec. Agency, Washington. Report No. EPA-660/3-75-035

Butler, P.A., 1963. U.S. fish Wildl. Serv. Circ., 167: 11-24.

Cisar, J.L. and Synder, G.H., 2000. ACS Symp. Ser., 743: 106- 126.

Culley, D.D. and Applegate, H.G., 1967. Pestic. Monit. J., 1: 21-28.

De-Schrijver, A. AND De-Mot, R., 1999. Crit. Rev. Microbiol., 25: 85-119.

Duetz, W.A., Marques, S., Wind, B., Romas, J.L. and Van Andel, J.G., 1996. Appl. environ. Micorbiol., 62: 601-606.

Elashvili, I., Defrank, J.J. and Culotta, V.C., 1998. Appl. environ. Microbiol., 64: 2601-2608.

El-Deeb, B.A., Soltan, S.M., Ali, A.M. and Ali, K.A., 2000. Folia Microbiol. (Praha), 45: 211-216.

Engel, L.S., Hill, D.A., Hoppin, J.A., Lubin, J.H., Lynch, C.F., Pierce, J.J., Samanic, C., Sandler, D.P., Blair, A. and Alavanja, M.C., 2005. Am. J. Epidemiol., 161: 121-125.

Foster, L.J.R. and Bia, H., 2004. FEMS Microbiol. Lett., 240:49-53.

Getenga, Z.M., Jondiko, J.I.O., Wandiga, S.O. and Beck, E.,2000. Bull. environ. Contam. Toxicol., 64: 359-367.

Ghauri, M.A., Khalid, A.M., Grant, S., Haephy, S. and Grant, W.D., 2003. Extremophiles., 7:341-345.

Gill, I. and Ballesteros, A., 2000. Biotechnol. Bioeng., 70: 400-410.

Giovannioni, S.J., Britschgi, T.B., Moyer, C. and Field, K.G., 1990. Nature (London), 345: 60-62.

Giovannoni, S., 1991. In: Nucleic acid techniques in bacterial systematics (eds. E. Stackebrandt and M. Goodfellow), John Wiley and Sons, New York, pp. 177-203.

Goda, S.K., Elsayed, I.E., Khodair, T.A., El-Sayed, W. and Mohamed, M.E., 2010. Biodgradation, 21: 903-913.

Golec, J., Hanke, W. and Dabrowski, S., 2003. Med. Pr., 54: 465-472.

Guerin, W.F. and Boyd, S.A., 1995. Appl. environ. Microbiol., 61: 4061-4068.

Hashmi, I., Khan, M.A. and Jong-Guk, K., 2002. Pak. J. biol. Sci., 5: 699-703.

Hashmi, I., Khan, M.A. and Kim, J.G., 2004. Bitotechnology, 3:82-89.

Kannan, V. and Vanitha, V., 2005. Ind. J. Biotech., 4: 277-283. Kumari, R., Jeevan, G., Ashlock, CH. M. and Rao, K., Vamsi,K.S.K., 2012. IOSR J. Pharm., 2: 37-42.

Mallick, K., Bharati, K., Banerji, A., Shaki, N.A. and Sethunathan, N., 1999. Bull. environ. Contam. Toxicol., 62: 48-54.

Mclaughlin, H., Farrell, A. and Quilty, B., 2006. J. environ. Sci. Hlth., 41: 763-777.

Mohamed, Z.K., Ahmed, M.A., Fetyan, N.A. and Elnagdy, S.M., 2010. J. Adv. Res., 1: 145-149.

Ohshiro, K., Kakuta, T., Sakai, T., Hirota, H., Hoshino, T. and Uchiyama, T., 1996. J. Ferment. Bioeng., 82: 299-305.

Olsen, G.J., Lane, Giovannioni, S.J. and Pace, N.R., 1986. Ann. Rev. Microbia., 40: 337-365.

Pankaj, G., Divya, B. and Kumar, M.D., 2013. Res, J. Chem. Environ., 17: 59.

Parekh, N.R., Walker, A. and Roberts, S.J., 1994. J. Agric. Fd. Chem., 36: 193-199.

Prijambada, I.D., Negoro, S., Yomo, T. and Urabe, I., 1995. Appl. environ. Microbiol., 61: 2020-2022.

Rosenberg, A. and Alexander, M., 1979. Appl. environ. Microbiol., 37: 886-891.

Saleem, M.A. and Shakoori, A.R., 1987. Archiv. Insect Biochem. Physiol., 5: 45-55.

Shakoori, A.R. and Saleem, M.A., 1989. Archiv. Insect Biochem. Physiol., 11: 203-215.

Singh, B., Kaur, J. and Singh, K., 2011. World J. Microbiol. Biotechnol., 28: 1133-1141.

Singh, B., Kaur, J. and Singh, K., 2012. Biotech. Lett., 34: 863- 867.

Stackebrant, E. and Woese, C.R., 1981. Sym. Soc. Gen. Microbiol., 32: 1-32.

Tagatz, M.E., Borthwick, P.W., Cook, G.H. AND Coppage, D.L., 1974. Mosq. News, 34: 38-42.

Thabit, T.M.A. and El-Naggar, M.A.H., 2012. World Rur. Observ., 4: 57-65.

Tse, H., Comba, M. and Alaee, M., 2004. Chemosphere, 54: 41- 47.

Van, M.F.G. and Willems, J.L., 2003. Occup. environ. Med., 60: 634-642.

Ward, M.W., Bateson, M.M., Waller, R. and Ruff-Roberts, A.L., 1992. In: Recent advances in microbial ecology (ed. K.C. Marshall), Plenum Press, New York, pp. 219- 286.

Wester, R.C. and Cashman, J.R., 1989. In: Sulphur containing drugs and related organic compounds: Chemistry, biochemistry and toxicology (ed. L.A. Damani). Halsted Press, New York.

Woese, C.R., Stackebrandt, E., Macke, T. and Fox, G.E., 1985. Appl. Microbial., 6: 143-151.
COPYRIGHT 2013 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2013 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Andleeb, Shagufta; Ghauri, Muhammad Afzal; Qazi, Javed Iqbal
Publication:Pakistan Journal of Zoology
Article Type:Report
Geographic Code:9PAKI
Date:Oct 31, 2013
Words:2634
Previous Article:Anthrenus (Anthrenops) coloratus Reitter, 1881 (Coleoptera: Dermestidae), New Record for Pakistan.
Next Article:The Relationship Between Growth and Parasites in Carp (Cyprinus carpio L., 1758) Inhabiting Karacaoren II Dam Lake.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |