Printer Friendly

Isolation, expression pattern, polymorphism and association analysis of porcine TIAF1 gene.

INTRODUCTION

Some studies have indicated that there is significant phenotypic variance between Chinese indigenous pigs and Western pigs. Meishan pigs (Chinese indigenous pigs) have lower lean meat content in their carcasses compared to Large White pigs (Western pigs), but the lean meat of Meishan pigs is of better quality (Serra et al., 1992). And it is well documented that Meishan pigs have super reproduction traits (Chen et al., 2008). Liver is the most important organ in the process of substrate metabolism by organisms. Glycometabolism, lipid and protein metabolism occur in the liver. Phenotypic variance between Large White and Meishan pigs may be related to substrate metabolism which occurs in the liver. We have identified a set of genes differentially expressed in livers between these two breeds by the mRNA differential display technique (DDRT-PCR) which was first reported by Liang and Pardee (1992) as a fast and efficient method for investigating differences in gene expression.

Among those differentially expressed genes we identified up-regulation of the TIAF1 (TGF-[beta]1-induced anti-apoptotic factor 1) gene transcripts in Meishan pigs compared with Large White pigs. Human TIAF1 gene is located on chromosome 17q11.2 and encodes a protein of 115 amino acids (http://www.ncbi.nlm.nih.gov/). TIAF1 plays a critical role in blocking TNF (tumor necrosis factor) cytotoxicity in mouse fibroblasts (Chang et al., 1998; van der Leij et al., 2003). The TIAF1 expression is regulated by TGF-[beta]1 (transforming growth factor-beta 1) which is a pleiotropic cytokine with demonstrable effects on a wide variety of cellular targets (Bonewald, 1999) and its principal role is as an immune regulator (Shull et al., 1992). Smad2, Smad3, and Smad4 were used as receptors and intracellular signal-transducing proteins by TGF-[beta] to regulate extracellular matrix homeostasis, apoptosis, cell proliferation, and others (Lawrence, 1996; ten Dijke et al., 2000). Khera and Chang (2003) reported that TIAF1 participates in TGF-[beta]-mediated growth regulation. All these studies indicated that the TIAF1 gene might play an important role in apoptosis and cell proliferation of animals. However, there is no report on the function of TIAF1 in pigs.

This study aimed to investigate the functional importance of the porcine TIAF1 gene by analyzing its sequence characteristics and spatial expression profiles. Association analysis between the deletion mutation and carcass and meat quality traits was performed also in 394 pigs of the "Large White x Meishan" [F.sub.2] resource population.

MATERIALS AND METHODS

Experimental animals

In this study, all pigs came from the Jingpin pig station of Huazhong Agricultural University. Screening for polymorphisms in the porcine TIAF1 gene was performed in a total of 160 pigs of Large White (n = 30), Landrace (n = 44), Bamei (n = 46) and Meishan (n = 40) breeds. For association analysis, carcass and meat quality traits were recorded in 394 pigs of a "Large White x Meishan" [F.sub.2] resource population. The Meishan pig (Chinese indigenous pig) is a typical lard type breed and the Large White pig (Western pig) is a lean type breed. All the [F.sub.2] pigs were fed as described by Dai et al. (2006). The finishing animals were slaughtered in the years 2000 (including 51 dams and 49 sires which were produced by mating 5 males to 16 females), 2003 (including 79 dams and 71 sires which were produced by mating 5 males to 22 females) and 2004 (including 73 dams and 71 sires which were produced by mating 5 males to 22 females), and measured according to the method of Xiong and Deng (1999) in the Center of Swine Control of China (Wuhan). All experimental procedures were approved by Hubei Province Committee on Laboratory Animal Care. Genomic DNA was isolated from blood samples of all 554 pigs using a standard phenol: phenol/chloroform purification-based protocol.

cDNA synthesis and differential display of mRNA

Total RNA was isolated with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) from livers of 12 two-month old pigs (six Meishan pigs and six Large White pigs) according to the manufacturer's instructions and treated with DNase I (Promega, Madison, USA) to exclude the DNA contamination. All the harvested samples were treated as described by Gong et al. (2008). Total RNA from the six Meishan pigs and six Large White pigs was mixed to construct the RNA pools. The first strand cDNA was synthesized from 2 [micro]g total RNA in a 25 [micro]l reaction system containing 0.5 [micro]g oligo[(dT).sub.15] primer, 1 x M-MLV first-strand buffer, 200 U M-MLV reverse transcriptase (Promega), 12.5 mM dNTP and 25 U RNasin Ribonuclease Inhibitor (Promega).

Differential display PCR was carried out simultaneously with 15 arbitrary primers in combination with 10 anchor primers. PCR amplification was performed as described by Liu et al. (2004). The PCR products were separated on an 8% non--denaturing polyacrylamide gel (29:1). The bands differentially displayed were re--amplified, cloned, and sequenced, and then the obtained sequences were compared with those available in GenBank using Blast search (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi).

Semi-quantitative reverse transcription--polymerase chain reaction

The primer pair EST167F/EST167R (Table 1) was designed to identify the differentially displayed band, and a semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) was performed as described by Ren et al. (2006). The house-keeping gene glyceraldehydes-3-phosphate dehydrogenase (GAPDH) (Table 1) was also amplified as internal control.

cDNA isolation, sequencing and analysis

The differentially expressed cDNA fragment (EST167) was homologous to the human TIAF1 gene with 81% identity. So the cDNA sequence of the human TIAF1 gene (GenBank accession No. NM_004740) was used to search available ESTs in the 'EST-others' database with the standard BLAST (http://www.ncbi.nlm.nih.gov/BLAST/). The porcine ESTs which shared more than 80% homology with the human cDNA sequence were assembled to produce an EST-contig. In order to obtain the full-length cDNA sequence of the porcine TIAF1 gene, primer pairs Ct1F/Ct1R and Ct2F/Ct2R were designed according to the contig (Table 1), and 5' rapid amplification of cDNA ends (RACE) was used according to BD SMART[TM] RACE cDNA amplification kit (Clontech, Palo Alto, USA) with the primer pair 5' RACE/Ct3R (Table 1).

Polymorphism detection and association analysis

To screen polymorphisms, the primer pair Ct4F/Ct4R was designed based on the PCR fragment which covered the complete coding regions of the TIAF1 gene. Potential polymorphic sites were analyzed by sequence comparison using DNAstar software (DNAstar Inc., Madison, WI, USA). The primer pair Ct5F/Ct5R was used to amplify the fragment from genomic DNA to genotype the polymorphic site in the TIAF1 gene. The association between genotypes and carcass and meat quality traits was evaluated by the least squares method (GLM procedure, SAS version 8.0, 1999). According to the method of Liu (1998), both additive and dominance effect were also estimated using the REG procedure of SAS version 8.0, where the additive effect was denoted as -1, 0 and 1 for AA, AB and BB, respectively, and the dominance effect was represented as 1, -1 and 1 for AA, AB and BB, respectively. The model used to analyze the data was assumed to be:

[Y.sub.ijkl] = [mu] + [S.sub.i] + [Y.sub.j] + [G.sub.k] + [B.sub.l] + [bX.sub.ijkl] + [e.sub.ijkl]

where [Y.sub.ijkl] is the observation of the trait; [mu] is the population mean, [S.sub.i] is the effect of i-th sex (i = 1 for male or 0 for female), [Y.sub.j] is the effect of j-th year (j = 1 for 2000, 2 for 2003 or 3 for 2004), [G.sub.k] is the effect of k-th genotype (k = AA, AB or BB), [B.sub.l] is the effect of l-th boar, b is the regression coefficient of the slaughter weight (carcass traits) or the regression coefficient of the slaughter age (meat quality traits) and [e.sub.ijkl] is the random residue.

PCR reaction amplification was performed in 25 [micro]l reaction volume on a GeneAmp PCR system 9600 (Perkin Elmer, Foster City, CA, USA). Mixes comprised 100 ng porcine genomic DNA or cDNA as template, 0.5 [micro]M of each primer, 200 [micro]M of each dNTP, 1 x PCR buffer (with N[H.sub.4.sup.+]), 1.5 mM of Mg[Cl.sub.2] and 1 U Taq DNA polymerase (Fermentas, Vilnius, Lithuania). The PCR amplifications were performed with the following cycling parameters: initial denaturalization at 94[degrees]C for 4 min, 35 cycles of 94[degrees]C for 45 s, annealing at optimal temperature (Table 1) for 45 s, and 72[degrees]C for 1 min. A final extension was performed at 72[degrees]C for 10 min. PCR products were gel purified, cloned to vector pMD18-T (Takara, Dalian, China) and sequenced commercially.

Real-time PCR analysis of porcine TIAF1 expression levels

Total RNA was extracted from 10 tissues (heart, liver, spleen, lung, kidney, stomach, small intestine, uterus, skeletal muscle and fat) of 3 two-month old Large White pigs. Reverse transcriptase PCR was performed as described above. The primer pair RtF/RtR (Table 1) was used to determine the relative expressed status of the TIAF1 gene with real-time PCR. The reaction mixes comprised 0.5 [micro]l porcine cDNA, 0.25 [micro]M each primer, and 12.5 [micro]l SYBR Green Real-time PCR Master Mix (TOYOBO, Tokyo, Japan). The PCR amplifications were performed in 25 [micro]l with an iCycler 5 iQ real-time PCR system (Bio-Rad). PCR conditions for the expression profiles were as follows: 95[degrees]C for 1 min, then followed by 40 cycles (95[degrees]C for 15 s, 58[degrees]C for 15 s, and 72[degrees]C for 20 s). A threshold cycle (Ct) value for each sample was calculated by the levels of fluorescence. The relative expression levels of the gene were analyzed using the Comparative Ct method, in which the housekeeping gene [beta]-actin (Table 1) was used as an internal control, to correct for the differences in the mRNA quantities.

RESULTS

Identification of EST167 as differentially expressed gene between Meishan and Large White pigs by DDRT-PCR

A band, designated as EST167, which expressed higher in the liver of Meishan pigs but lower in Large White pigs, was isolated from the mRNA differential display gel (Figure 1(A)). Analysis of semi-quantitative RT-PCR also found that EST167 presented higher expression in the liver of Meishan pigs, but lower in Large White pigs. This was approximately consistent with the result of mRNA differential display (Figure 1(B) and (C)).

[FIGURE 1 OMITTED]

Molecular cloning and sequence analysis of porcine TIAF1 gene

The full-length cDNA sequence of the porcine TIAF1 gene was cloned and assembled to obtain 1,633 bp (GenBank accession No. EU872207) including a complete open reading fragment (ORF) of 348 bp encoding a protein of 115 amino acids, 905 bp of 5' UTR and 380 bp of 3' UTR containing a consensus polyadenylation signal (AATAAA). Alignment analysis revealed that the porcine TIAF1 gene has only one exon. Similarity comparison showed that the nucleotide sequences of porcine TIAF1 shared, respectively, 79% and 81% identity with that of human (GenBank accession No. NM_004740) and mouse (GenBank accession No. AF104984).

Polymorphism detection and allele frequencies

The primer pair Ct4F/Ct4R amplified a total of 601 bp of the porcine TIAF1 gene from four different individuals (two Large White pigs and two Meishan pigs). Comparison of those sequences revealed a 6 base-pair deletion mutation from 1,001 bp to 1,006 bp in the exon (GenBank accession No. EU872207) which caused Gln and Val amino acid deletion; further analyses of the deletion mutation were carried out using the restriction fragment length polymorphism (RFLP) method by the restriction enzyme Eco47 I. The primer pair Ct5F/Ct5R was used to distinguish the genotype. PCR products which had a 6-bp deletion mutation could not restrict with the enzyme Eco47 I and were designated as A allele (477 bp), and those which did not have the deletion mutation can restrict with the enzyme Eco47 I and were designated as B allele (304 bp and 179 bp) (Figure 2). We next performed statistical analysis and found that the frequencies of the A allele were dominant in Chinese indigenous breeds and the frequencies of the B allele were dominant in Western pig breeds (Table 2). In order to estimate the association between this polymorphism and carcass and meat quality traits, Eco47--I PCR-RFLP was typed in 394 pigs of the "Large White x Meishan" [F.sub.2] resource population. Association analysis revealed that the deletion mutation had highly significant associations (p<0.01) with meat marbling score of the thorax-waist longissimus dorsi (LD) muscle (MM1) and intramuscular fat percentage (IMF), and significant associations (p<0.05) with carcass length (CL). At this locus, the additive effect seemed to be highly significant (p<0.01) and allele A was associated with increases of the trait value (Table 3).

[FIGURE 2 OMITTED]

Spatial expression pattern of the TIAF1 gene

The spatial expression analysis showed that the TIAF1 gene was expressed at the highest level in liver and kidney with prominent expressions detected in uterus, and lower levels detected in heart, spleen, lung, stomach, small intestine, skeletal muscle and fat of Large White pigs (Figure 3).

DISCUSSION

In this study, we selected the differentially expressed cDNA fragment (EST167) which was homologous to the human TIAF1 gene for future studies according to the important function of this gene, and isolated porcine TIAF1 gene fragments with corresponding knowledge of the known human TIAF1 gene by bioinformatics methods. This proved to be a rapid and effective method to obtain genomic sequence of the candidate genes (Wang et al., 2007). GenBank BLAST analysis revealed that the TIAF1 gene was not homologous to any of the known porcine genes, so the gene was a novel porcine gene.

[FIGURE 3 OMITTED]

We used the real-time PCR technique to detect the tissue-specific expression of these mRNAs in pigs. The spatial expression analysis showed that the TIAF1 gene was widely expressed in all the examined tissues of Large White pigs. This result is similar to the study of Chang et al. (1998) which showed that the TIAF1 gene is ubiquitously expressed in a variety of tissues and organs, such as liver, eyes, stomach, intestine, heart, lung, spleen, testis, ovary, pituitary gland, skeletal muscle and pregnant uterus. These results indicated that TIAF1 might play important roles in various tissues and organs.

TIAF1 protects L929 fibroblasts from TNF-mediated apoptosis, but over-expressed TIAF1 induces growth inhibition and apoptosis of monocytic U937 and non-fibroblast cells (Chang, 2004; Schultz et al, 2004). TIAF1 participates in the TGF-beta signaling by interacting with Smad proteins (Chang, 2003), and the TGF-betas are potent modulators of cell proliferation, cell differentiation, and fibrogenesis (Hellerbrand et al., 1999). TGF[beta]1 and TNF[alpha] (tumor necrosis factor alpha) can stimulate the transdifferentiation of fat-storing cells into highly active and "synthetic" myofibroblast--like cells in the rat liver (Bachem et al., 1993). The deletion mutation of porcine TIAF1 gene, which was found in its exon, causes deletion of two amino acids, which might alter the protein structure and lead to functional variation such as the interaction with TGF[beta]1. The changes may affect fat metabolism and synthesis, which may be the reason the polymorphism had highly significant association with fat depositional traits. According to the association result, if A frequency were increased meat marbling score of the thorax-waist LD muscles, intramuscular fat percentage and carcass length could be greatly improved. Increasing allele A may be favorable for carcass and meat quality traits in pig breeding. Analysis of allelic frequency also revealed great difference between lean- and lard-type breeds. Chinese indigenous breeds (Meishan and Bamei) have higher frequencies of allele A, whereas Large White and Landrace pigs have higher frequencies of allele B. This may be caused by the limited number of animals or long-term and different background of breeding and selection. If the polymorphism effect was the same as found in our study for other larger populations, it may be a useful marker for further porcine breeding.

In this study, we first isolated the full-length cDNA sequence of the TIAF1 gene, analyzed its spatial expression differences, found an important functional deletion mutation, and analyzed the significant association with carcass and meat quality traits in pigs. In summary, this information provides an important basis for conducting future studies on the function of the TIAF1 gene.

ACKNOWLEDGMENTS

We thank the staff at Huazhong Agricultural University Jingpin pig station and teachers and graduate students at the Key Laboratory of Swine Genetics and Breeding of the Ministry of Agriculture for managing and slaughtering the research flocks. This work was financially supported by the National Advanced Technology Development Program of China (No. 2006CB102102, '973' project).

REFERENCES

Bachem, M. G., K. M. Sell, R. Melchior, J. Kropf, T. Eller and A. M. Gressner. 1993. Tumor necrosis factor alpha (TNF alpha) and transforming growth factor beta 1 (TGF beta 1) stimulate fibronectin synthesis and the transdifferentiation of fat-storing cells in the rat liver into myofibroblasts. Virchows. Arch. (B). 63:123-130.

Bonewald, L. F. 1999. Regulation and regulatory activities of transforming growth factor beta. Crit. Rev. Eukaryot. Gene Expr. 9:33-44.

Chang, N. S., J. Mattison, H. Cao, N. Pratt, Y. Zhao and C. Lee. 1998. Cloning and characterization of a novel transforming growth factor-b1-induced TIAF1 protein that inhibits tumor necrosis factor cytotoxicity. Biochem. Biophys. Res. Commun. 253:743-749.

Chang, N. S. 2003. TIAF1 participates in the TGF-beta signaling by interacting with Smad proteins. Proceedings of the American Association for Cancer Research Annual Meeting 44:1038 (Abstr.).

Chang, N. S. 2004. Inhibition of nuclear translocation of serine 15-phosphorylated p53 by silencing TIAF1. FASEB J. 18(Suppl. S):556(Abstr.).

Chen, J. F., L. H. Dai, J. Peng, J. L. Li, R. Zheng, B. Zuo, F. E. Li, M. Liu, K. Yue, M. G. Lei, Y. Z. Xiong, C. Y. Deng and S. W. Jiang. 2008. New evidence of alleles (V199I and G52S) at the PRKAG3 (RN) locus affecting pork meat quality. Asian-Aust. J. Anim. Sci. 21:471-477.

Dai, L. H., Y. Z. Xiong, C. Y. Deng, S. W. Jiang, B. Zuo, R. Zheng, F. E. Li and M. G. Lei. 2006. Association of the A-G polymorphism in porcine adiponectin gene with fat deposition and carcass traits. Asian-Aust. J. Anim. Sci. 19:779-783.

Gong, W. H., Z. L. Tang, J. L. Han, S. L. Yang, H. Wang, Y. Li and K. Li. 2008. Mapping, tissue distribution and polymorphism of porcine retinol binding protein genes (RBP5 and RBP7). Asian-Aust. J. Anim. Sci. 21:1544-1550.

Hellerbrand, C., B. Stefanovic, F. Giordano, E. R. Burchardt and D. A. Brenner. 1999. The role of TGF[beta]1 in initiating hepatic stellate cell activation in vivo. J. Hepatol. 30:77-87.

Khera, S. and N. S. Chang. 2003. TIAF1 participates in the transforming growth factor [beta]1-mediated growth regulation. Ann. N. Y. Acad. Sci. 955:11-21.

Lawrence, D. A. 1996. Transforming growth factor-beta: a general review. Eur. Cytokine. Netw. 7:363-374.

Liang, P. and A. B. Pardee. 1992. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Sci. 257:967-970.

Liu, B.H. 1998. Statistical genomics: linkage, mapping and QTL analysis. CRC Press, LLC.

Liu, G. Y., Y. Z. Xiong, C. Y. Deng, B. Zuo and J. H. Zhang. 2004. Comparison of gene expression patterns in Longissimus dorsi of pigs between the high-parent heterosis cross combination Landrace x Large White and the mid-parent heterosis cross combination Large White x Meishan. Asian-Aust. J. Anim. Sci. 17:1192-1196.

Ren, Z. Q., Y. Z. Xiong, C. Y. Deng and M. G. Lei. 2006. Cloning and identification of porcine SMPX differentially expressed in F1 crossbreds and their parents. Acta Biochim. Biophys. Sin. 38:753-758.

SAS. 1999. Statistical Analysis System institute, Incorporation. Cary, NC, USA.

Serra, J. J., M. Ellis and C. S. Haley. 1992. Genetic components of carcass and meat quality traits in Meishan and Large White pigs and their reciprocal crosses. Anim. Prod. 54:117-127.

Schultz, L., S. Khera, D. Sleve, J. Heath and N. S. Chang. 2004. TIAF1 and p53 functionally interact in mediating apoptosis and silencing of TIAF1 abolishes nuclear translocation of serine 15-phosphorylated p53. DNA Cell Biol. 23:67-74.

Shull, M. M., I. Ormsby, A. B. Kier, S. Pawlowski, R. J. Diebold, M. Yin, R. Allen, C. Sidman, G. Proetzel and D. Calvin. 1992. Targeted disruption of the mouse transforming growth factor-beta1 gene results in multifocal inflammatory disease. Nature 359:693-699.

ten Dijke, P., K. Miyazono and C. H. Heldin. 2000. Signaling inputs converge on nuclear effectors in TGF-beta signaling. Trends Biochem. Sci. 25:64-70.

van der Leij, J., A. van den Berg, E. W. Albrecht, T. Blokzijl, R. Roozendaal, A. S. Gouw, K. P. de Jong, C. A. Stegeman, H. van Goor, N. S. Chang and S. Poppema. 2003. High expression of TIAF-1 in chronic kidney and liver allograft rejection and in activated T-helper cells. Transplantation 75:2076-2082.

Wang, T., L. Chang, Y. Z. Xiong, C. Y. Deng, B. Zuo, H. T. Xie and D. Q. Xu. 2007. Isolation and cloning of porcine SLC27A2 gene and detection of its polymorphism associated with growth and carcass traits. Asian-Aust. J. Anim. Sci. 20:1169-1173.

Xiong, Y. Z. and C. Y. Deng. 1999. Technical testing rule of lean pig. Chinese Agricultural Press, Beijing.

Y. Wang, Y. Z. Xiong **, Z. Q. Ren, B. Zuo, M. G. Lei and C. Y. Deng

Key Laboratory of Swine Genetics and Breeding of Ministry of Agriculture and Key Laboratory of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, Huazhong Agricultural University, Wuhan 430070, China

* This work was financially supported by National Advanced Technology Development Program of China (No. 2006CB1021 02, '973' project).

** Corresponding Author: Y. Z. Xiong. Tel: +86-27-87284285, Fax: +86-27-87394184, E-mail: wynew2004@yahoo.com.cn

Received July 20, 2008; Accepted October 27, 2008
Table 1. Primers used in this study

Primers           Primer sequences           Tm
                       (5'-3')          ([degrees]C)

EST167F         CACCCTCAAGGTCATCCCAC        58
EST167R         CACAGCCCAATGAGTACAAAC
Ct1F            TCAGATGATGAGCACGACC         58.5
Ct1R            AACCCAAACCCAGAAGCA
Ct2F            AGAGGTGGAGGGAAGAGC          58.5
Ct2R            AGCACAGCCCAATGAGTA
5' RACE         AACGCAGAGTACGCGGG           56
Ct3R            TGGGCTAGGCGTTGGTCT
Ct4F            GGACATTCTCGGGTTGCT          58
Ct4R            TCCATCCTCAGGCTTTCT
Ct5F            GCCTACTGGGACATTCTCG         60
Ct5R            GTGGGTGGGATGGGTTTA
RtF             TGAGCAAACCTCCACAGAC         58
RtR             CCAGGCAACTTGGACAGAG
GAPDHF          ACCACAGTCCATGCCATCAC        58
GAPDHR          TCCACCACCCTGTTGCTGTA
[beta]-actinF   CCAGGTCATCACCATCGG          58
[beta]-actinR   CCGTGTTGGCGTAGAGGT

Primers                Product            Template
                      size (bp)

EST167F                   124               cDNA
EST167R
Ct1F                      771               cDNA
Ct1R
Ct2F                    1,015               cDNA
Ct2R
5' RACE                   415               cDNA
Ct3R
Ct4F                      601               DNA
Ct4R
Ct5F                      483               DNA
Ct5R
RtF                       179               cDNA
RtR
GAPDHF                    452               cDNA
GAPDHR
[beta]-actinF             158               cDNA
[beta]-actinR

Table 2. Allele frequencies for the deletion mutation
of the TIAF1 gene in four pig populations

                                Genotype

Breeds        Number     AA       AB       BB

Bamei           46       30       11        5
Meishan         40       35        3        2
Landrace        44        0        0       44
Large White     30        2       11       17

              Allele frequency

Breeds          A        B

Bamei         0.772    0.228
Meishan       0.913    0.087
Landrace      0        1
Large White   0.250    0.750

Table 3. Association between porcine TIAF1 Eco47 I-PCR-RFLP and
carcass and meat quality traits in 394 pigs of the
"Large WhitexMeishan" F2 resource population

                   Genotype (Lsmean [+ or -] SE) (2)

Traits           AA (n = 221)                AB (n = 105)
(1)

CL (cm)   92.095 [+ or -] 0.457 (a)    90.250 [+ or -] 0.545 (b)
MM1        3.507 [+ or -] 0.017 (A)     3.431 [+ or -] 0.021 (B)
IMF (%)    3.424 [+ or -] 0.050 (Aa)    3.303 [+ or -] 0.065 (a)

              Genotype (Lsmean               Effect (mean
              [+ or -] SE) (2)               [+ or -] SE)

Traits           BB (n = 68)                   Additive
(1)

CL (cm)   90.347 [+ or -] 0.659 (b)    0.874 [+ or -] 0.614
MM1        3.383 [+ or -] 0.028 (B)    0.063 [+ or -] 0.021 **
IMF (%)    3.050 [+ or -] 0.083 (Bb)   0.188 [+ or -] 0.048 **

           Effect (mean [+ or -] SE)

Traits            Dominance
(1)

CL (cm)   -0.971 [+ or -] 0.509
MM1       -0.014 [+ or -] 0.018
IMF (%)    0.066 [+ or -] 0.040

(1) CL = Carcass length; MM1 = Meat marbling score of
the thorax-waist longissimus dorsi (LD) muscle;
IMF = Intramuscular fat percentage.

(2) Least square mean values ([+ or -] SE).

(3) Different letters denoting significant difference
between groups: (a), (b) p < 0.05, (A), (B) ** p < 0.01.
n, the number of individuals.
COPYRIGHT 2009 Asian - Australasian Association of Animal Production Societies
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2009 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:transforming growth factor -beta1-induced anti-apoptotic factor 1
Author:Wang, Y.; Xiong, Y.Z.; Ren, Z.Q.; Zuo, B.; Lei, M.G.; Deng, C.Y.
Publication:Asian - Australasian Journal of Animal Sciences
Article Type:Report
Geographic Code:9CHIN
Date:Mar 1, 2009
Words:4016
Previous Article:Association of GHRH, H-FABP and MYOG polymorphisms with economic traits in pigs.
Next Article:Stage-specific expression of lanosterol 14[alpha]-demethylase in mouse oocytes in relation to fertilization and embryo development competence.
Topics:


Related Articles
ASCL2 gene expression analysis and its association with carcass traits in pigs.
Expression analysis of galectin-1 from fat in Berkshire pigs.
Molecular cloning and expression of Forkhead Transcription Factor O1 gene from pig Sus scrofa.
Single-minded 1 gene mapping and its variants association with growth, carcass composition and meat quality traits in the pig.
Tissue distribution, SNP detection and association study with immune traits of porcine LBP and CD14 genes.
Mapping, tissue distribution and polymorphism of porcine retinol binding protein genes (RBP5 and RBP7).
Molecular characterization, chromosomal localizations, expression profile, and association analysis of the porcine PECI gene with carcass traits.
Molecular characterization, chromosomal localizations, expression profile, and association analysis of the porcine PECI gene with carcass traits.

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters