Printer Friendly

Interaction Effects of Season of Birth and Cytokine Genes on Schizotypal Traits in the General Population.

1. Introduction

Evidence suggests that people born during winter months have an increased risk of developing schizophrenia [13]. However, the definitive pathophysiological mechanisms underlying the link between season of birth (SOB) and the disorder are still not completely understood. One plausible explanation is that the increased risk of schizophrenia in individuals born in winter is caused by deleterious effects of innate immune response-related factors on brain development [2, 4, 5]. Recent findings have demonstrated that SOB may shape neonatal immune function, with winter births correlating with higher levels of most immune cell types in cord blood and airway inflammatory mediators, and this season-related immune profile seems to be an outcome of exposures from the maternal environment [6]. Accordingly, epidemiological data implicate maternal infection as a risk factor for schizophrenia, and animal models corroborate this link showing the impact of maternal immune activation on lifelong neuropathology in offspring [7, 8]. Since prenatal exposure to different types of viral or bacterial infections has similar debilitating effects in later life, it is thought that not pathogen itself but the response of the innate immune system, specifically the increased production of inflammatory cytokines, is the critical mediator in altering fetal brain development [9].

Schizophrenia is considered to be a neurodevelopment disorder resulting from complex interactions between genes and environmental exposures [10]. In this context, it is suggested that genotype may mediate prenatal or early postnatal environmental influences that activate the immune system on schizophrenia-related brain pathology [11]. However, while recent years have seen considerable progress in uncovering environmental and genetic factors predisposing to schizophrenia, only a limited number of studies have investigated gene-environment interactions (G x E). Of them, four studies have used SOB as a proxy of environmental exposures, with two studies exploring genes for the human leukocyte antigens and none analyzing cytokine genes (for reviews see [12-14]).

Investigating G x E in schizophrenia is challenging for a number of reasons [13]. It has been proposed that schizotypy promises to increase the power of such studies [15-17]. Schizotypy refers to a constellation of personality traits and perceptual experiences that resemble positive, negative, and disorganized symptoms of schizophrenia. It can be assessed using clinical interviews or self-report questionnaires. Individuals with high levels of schizotypal traits have an enhanced risk of psychosis, and the psychosis continuum hypothesis posits that the same biological factors that underpin schizotypy contribute to the development of schizophrenia. Therefore, schizotypy represents a useful construct for understanding the etiology of schizophrenia-spectrum disorders by allowing for the examination of etiological factors without disease-related confounders and enhancing a possibility of identifying protective mechanisms (for reviews see [15-19]).

Both quantitative and molecular genetic studies indicate overlap of schizotypy with schizophrenia at the genetic level supporting the continuum hypothesis [16,17,20]. About SOB, findings are mixed [21-24]. While the latest meta-analysis does not indicate an association between winter SOB and schizotypy in adults (n = 481) [25], in the largest study to date (n = 8114), a small, but significant, sex-independent effect of late winter and early spring births on schizotypal traits has been found [24]. To our knowledge, no gene X SOB study for schizotypal traits has been published so far.

This study aimed to assess the cytokine genes by SOB interaction effect on self-reported schizotypy measured with the Schizotypal Personality Questionnaire (SPQ-74) [26] in the general population. We focused on the proinflammatory cytokine interleukin- (IL-) 1[beta] because of (1) its suggestive role in altered brain development [27] and schizophrenia etiology and pathogenesis [28, 29] and (2) findings indicating its higher concentration in infants born in winter [6]. Specifically, the IL1B gene promoter single nucleotide polymorphism (SNP) C-511T (rs16944) has been shown to be associated with schizophrenia in European populations, though the data are not univocal [30-33] and to affect brain structure and functions in schizophrenic patients [34-36]. Based on the direction of the IL1B allele effects on schizophrenia risk [30, 32, 33], we hypothesized that the variant C of IL1B would potentiate the development of schizotypal traits in individuals born during winter.

The cytokine hypothesis of schizophrenia posits that the imbalance between pro- and anti-inflammatory cytokine signaling in the fetal brain rather than an increase in proinflammatory cytokines concentration as such may represent a key mechanism involved in the precipitation of schizophrenia-related pathology [5]. Given this, we included two more genes for analysis, namely, IL-1RN, encoding interleukin-1 receptor antagonist (IL-1ra), and IL4, encoding interleukin-4. They were chosen due to the antagonistic relationships of their products with IL-1[beta]. IL-1ra acts as an antagonist by binding competitively to the same membrane receptor as IL-1[beta]. Like IL1B, IL-1RN is located within the 2q13 chromosomal region for which significant evidence of linkage to schizophrenia has been found [37]. IL-4 is an anti-inflammatory cytokine that can inhibit synthesis of IL-1[beta], attenuate IL-1[beta]-induced behavioral and immunological changes, and upregulate the production of IL-1ra [38-40]. To examine the possible influence of these genes on schizotypal traits individually and in combination with IL1B and SOB, we genotyped polymorphisms with functional consequences: a penta-allelic polymorphic site in intron 2 (VNTR, 86 bp repeats) of the IL-1RN gene and rs2243250 in the IL4 gene. Allele 2 (two repeats) of the IL-1RN gene has been related to lower IL-1ra production and a shorter time for endothelial cells' division compared with major allele 1 [41]. rs2243250 is a T/C SNP located in the IL4 gene promoter; the minor allele T is associated with the increased IL4 transcriptional activity [42]. We hypothesized that the potential SOB X IL1B effect on schizotypy would be less pronounced in the presence of the IL-1RN and/or IL4 more active alleles.

2. Materials and Methods

2.1. Sample and Procedure. The study was approved by the Mental Health Research Center's Ethics Committee. Subjects were recruited as part of larger research on the genetics of psychiatric disorders. We selected participants from the staff of research institutes and hospitals, university students, and friends, mostly from the Moscow region (~80%). They did not receive a participation fee. Each individual was interviewed about his/her demographic characteristics, psychiatric diagnoses, substance use, or heard injury personal histories and a family history of psychoses. Individuals who were not Caucasian, did not complete a secondary school (11 years), reported a history of psychiatric or neurologic conditions, or had first-degree relatives with psychotic illness were not included in the sample. The entire research design required subjects to sign an informed consent for participation in the study, to donate blood samples for DNA extraction, and to complete a set of inventories including the SPQ-74.

A two-stage design was applied. In stage 1, a search for associations of all the three cytokine genes, SOB, and their interactions with the SPQ-74 total score was performed. In stage 2, we used an extended sample to conduct follow-up analyses of the significant gene X SOB effect (1) on the SPQ total score with age and gender taken into account and (2) on each of the three SPQ factors.

Two hundred seventy-eight individuals aged between 16 and 65 years with complete genetic, demographic, and SPQ data were included in stage 1 sample. Among them, 75 participants were born in winter (December to February). The winter SOB group did not differ from the nonwinter one on age but included fewer women (52% versus 65.5%; [chi square] = 4.24, p = 0.039). Power analysis conducted by Quanto [43] showed that the sample had over 80% power to detect main and two-way interaction effects with [R.sup.2] [greater than or equal to] 0.03, assuming a dominant model, a minor allele frequency of 18% or higher, and [alpha] = 0.05. The extended sample (stage 2) consisted of 373 individuals approaching 80% power to detect effects of [R.sup.2] [greater than or equal to] 0.02 and remaining similar in age, gender, and SOB composition to the initial sample (Table 1).

2.2. Assessment. The SPQ-74 is a 74-item true-false questionnaire assessing nine diagnostic criteria of schizotypal personality according to DSM-III-R. The criteria are grouped into three factors: cognitive-perceptual (ideas of reference, odd beliefs or magical thinking, unusual perceptual experiences, and suspiciousness), interpersonal (social anxiety, no close friends, constricted affect, and suspiciousness), and disorganized (odd or eccentric behavior and odd speech). These factors presumably correspond to three syndromes of schizophrenia, positive (delusions and hallucinations), negative (flattened affect, avolition, and asociality), and disorganized (thought incoherence or illogicality and bizarre behavior).

2.3. Genotyping. DNA was extracted from peripheral blood leukocytes with the phenol-chloroform method. Genotyping was performed using polymerase chain reaction (PCR). PCR products for IL1B rs16944 and IL4 rs2243250 were analyzed using restriction fragment length polymorphism (RFLP). PCR amplifications were performed in a final volume of 15 [micro]l containing 1x PCR buffer, 2.5 mM of MgCl2,200 [micro]M dNTPs, 10.0 pmol of oligonucleotides, 0.5 U of Taq-polymerase, and 100 ng of DNA extract. Primer sequences, PCR programs, restriction endonucleases, and PCR or digestion products are presented in Table 2. For quality control purposes, 10% of samples were genotyped twice (the results were concordant). Both SNPs conformed to Hardy-Weinberg equilibrium (HWE), p > 0.05. Minor allele frequencies were 0.32 and 0.18 for IL1B and IL4, respectively. Genotype frequencies were as follows. For rs16944, CC = 131, CT = 118, and TT = 29; for rs2243250, CC = 184, CT = 86, and TT = 8. For IL-1RN, the genotype frequencies deviated from HWE (ARLEQUIN, exact test using a Markov chain, p = 0.042). Yet, allele 1 was the most common (0.63), followed by the two-repeat allele (0.35), consistent with the data reported for other cohorts of European ancestry (e.g., [44]).

2.4. Statistical Analyses. The SPQ total score was normally distributed according to the Kolmogorov-Smirnov test. A full factorial multivariate analysis of variance (ANOVA) was conducted to analyze it. The three polymorphisms and SOB (winter versus nonwinter) were used as between-subjects factors. Also, all possible two-, three-, and four-way interactions between the factors were included in the model. Genotypes were grouped as follows: at least one minor allele of any SNP versus homozygosity for its major allele; the presence of the IL-1RN allele 2 versus its absence. Partial eta squared ([[eta].sup.2]) was calculated to investigate effect sizes.

SPQ factor scores did not follow a normal distribution, and log-transformation failed to normalize the data. Given this, they were analyzed with the nonparametric Mann-Whitney test. Bonferroni correction was applied to p values during post hoc comparisons of the SPQ total score and when analyzing factor scores. In the latter case, [p.sub.corr] = p * 3. The significance level for p/[p.sub.corr] values was set at 0.05, two-tailed. All analyses were performed with Statistica 12 for Windows.

3. Results

3.1. Stage 1. A factorial ANCOVA with SOB and gender as between-subjects factors and age as a covariate did not reveal any significant effect of these demographic variables on the SPQ total score. The winter SOB group did not differ from the nonwinter one on the SPQ factor scores.

The full factorial ANOVA with all three polymorphisms, SOB, and their interactions as between-subjects factors yielded a significant effect of the IL4 X SOB interaction on the SPQ total score, F(1,262) = 7.45, p = 0.007,and [[eta].sup.2] = 0.028. T allele carriers born in winter had the lowest mean score and those who were also born in winter but did not have this allele showed the largest score (Table 3). The post hoc LSD analysis revealed nominally significant differences between carriers and noncarriers of the T allele among individuals born in winter (p = 0.023) and between carriers of the T allele with winter and nonwinter births (p = 0.045). None of these differences survived Bonferroni correction. None of the other effects in the full factorial ANOVA was significant.

3.2. Stage 2. A factorial ANCOVA with IL4 genotype, SOB, and gender as between-subjects factors and age as a covariate confirmed the influence of the IL4 X SOB interaction on the SPQ total score, F(1,364) = 4.88, p = 0.028, though the [[eta].sup.2]-value was reduced to 0.013. Homozygotes CC born in winter showed the highest SPQ total score and differed significantly from winter-born T allele carriers ([p.sub.corr] = 0.049). The latter had the lowest mean score among all IL4 X SOB groups (Table 4). In addition, the genotype main effect was significant, F(1,262) = 6.00, p = 0.015, and [[eta].sup.2] = 0.016. Homozygotes CC had higher SPQ total scores than T allele carriers. None of the other effects in the model was significant.

Given these results, we carried out the comparisons between T allele carriers and noncarriers on the three SPQ factors in the winter SOB group. Homozygotes CC showed significantly higher scores of the cognitive-perceptual (U = 488.5, [p.sub.corr] = 0.009) and disorganized (U = 508.5, [p.sub.corr] = 0.017) factors than T allele carriers (Table 4). Analyses of the IL4 effect on the SPQ factors in the whole sample and individuals born during spring-autumn did not reveal genotype-related significant differences.

4. Discussion

Existing literature suggests that the effect of winter birth on schizophrenia risk might be mediated by increased expression of the proinflammatory cytokines, in particular, IL-1[beta], due to prenatal infection and its inadequate regulation by anti-inflammatory factors. Therefore, we hypothesized that winter birth, combined with the presence of the schizophrenia-risk IL1B genotype CC, would be associated with an increase in the severity of schizotypal traits and that this effect could be modulated by genetic polymorphisms of the anti-inflammatory cytokines IL-1ra and IL-4. None of these hypotheses was confirmed. Instead, we found a significant IL4 X SOB interaction effect on schizotypy. Among individuals born in winter, homozygotes for the common allele C had elevated SPQ scores and carriers of the more active T allele demonstrated a lower level of schizotypy. At the same time, individuals born in spring-autumn showed average levels of schizotypal traits regardless of IL4 genotype. Based on this pattern of results, we speculate that potentially detrimental consequences of winter birth can be attenuated by increased activity of the anti-inflammatory cytokine IL4. This hypothesis is in line with evidence of neuroprotective [45, 46] and beneficial cognitive effects of IL-4 in animal models [47, 48] and children [49]. Mechanisms underlying these effects are currently under investigation [39, 45, 50-52]. In particular, the ability of IL-4 to inhibit IL-1[beta]-induced central glial activation and neurotransmitter alterations has recently been shown [39]. It can be suggested that despite the absence of the association of IL1B with SPQ scores in the present study, it is still possible that IL-4 exerts its protective effect against schizotypy through blocking the negative influences of IL-1[beta] on normal brain development. The lack of an association between IL1B and schizotypy could be explained by the fact that regulation of the inflammatory response maybe more important for brain development than the inflammatory reaction itself.

Factors underlying the SOB influence on schizophrenia vulnerability are not known. Apart from maternal infection, they may include perinatal photoperiod and production of vitamin D, which depends on exposure to sunlight [2, 53]. Growing evidence suggests immunomodulating effects of vitamin D [54, 55], including vitamin D ability to upregulate expression of IL-4 [54, 56-58]. As such, it can be speculated that wintertime vitamin D insufficiency can exacerbate the unfavorable effects of the less effective genotype CC on brain development. It should be noted, however, that both low and high concentrations of neonatal vitamin D are associated with increased risk of schizophrenia [59]. Further, the photoperiod might affect schizophrenia risk regardless of vitamin D, for instance, through the seasonal and circadian fluctuation of the melatonin level. Melatonin is involved in T-cell biology and maintenance of normal pregnancy [60, 61]. Treatment with melatonin has been shown to reduce levels of a number of cytokines including IL-4 in a murine model of allergic asthma [62] and to reverse ketamine-induced schizophrenia-like behavioral alterations and increments in hippocampal IL-4 in mice [63]. Finally, the actual causal event making individuals born in winter vulnerable to schizophrenia could have occurred anytime during gestation. This, in turn, suggests that factors, which are more widely dispersed in the warmer months, for example, environmental toxins [2], can be responsible for the IL4 association with schizotypy in individuals with winter SOB.

We found that, in individuals born in winter, IL4 was associated with positive (cognitive-perceptual) and disorganized but not negative (interpersonal) schizotypy dimensions. These results are consistent with the notion that positive and negative schizotypal features may have at least partially specific genetic and environmental underpinning [64-66]. Interestingly, Venables [67] showed that women's exposure to influenza in the 2nd trimester of pregnancy was associated with an elevation of positive schizotypy scores, whereas exposure to low environmental temperatures was associated with an elevation of anhedonia scores in their offspring. Therefore, dimensional perspective seems promising in addressing the molecular mechanisms underlying G x E in schizotypy.

The results must be interpreted in light of the limitations of our sample. First, although our sample size was moderate in comparison to other G x E studies, a larger sample size would increase power to detect three- and four-way interactions. Second, due to the very low frequency of the IL4 TT genotype we combined individuals with TT and TC genotypes. This makes it impossible to distinguish the effects of the T allele from the effects of heterozygosity, which itself can have a beneficial effect known as a heterozygous advantage. Third, convenience sampling used in the present study is not capable of recruiting statistically representative samples of the entire population. This might limit the generalizability of the findings. However, the composition of our samples showed no bias with respect to IL4 genotypes and SOB. Finally, other cytokine genes need to be considered in future studies. Because many anti-inflammatory molecules share similar signal transduction pathways, it may be expected that in addition to IL-4 the enhanced expression of other anti-inflammatory cytokines may also weaken or block the negative influences of winter SOB on brain development, reducing the severity of schizotypal traits in later life.

5. Conclusions

This study was the first to investigate the cytokine genes X SOB effects on schizotypal traits. We explored polymorphisms of IL1B, IL-1RN, and IL4 genes and found the IL4 X SOB influence on self-reported schizotypy. The IL4 T allele appeared to have a protective effect against the development of positive and disorganized schizotypal traits in individuals born during winter months. We were able to replicate the IL4 X SOB interaction effect using an extended sample, a methodological strength that places greater confidence in the findings. Further studies of the molecular mechanisms underlying the IL4 X SOB interaction might suggest novel immunomodulatory strategies for prevention of schizophrenia. Nevertheless, replication on independent samples is desirable and more research should be conducted considering cytokine networks to find abnormalities in specific immune pathways involved in the development of schizotypal traits.

https://doi.org/ 10.1155/2017/5763094

Disclosure

The funder had no role in study design, data analysis, or manuscript preparation.

Conflicts of Interest

The authors have no conflicts of interest to disclose.

Acknowledgments

This study was funded by the RFBR Grant no. 15-04-02063.

References

[1] G. Davies, J. Welham, D. Chant, E. F. Torrey, and J. McGrath, "A Systematic Review and Meta-analysis of Northern Hemisphere Season of Birth Studies in Schizophrenia," Schizophrenia Bulletin, vol. 29, no. 3, pp. 587-593, 2003.

[2] T. L. Demler, "Challenging the Hypothesized link to season of birth in patients with Schizophrenia," Innovations in Clinical Neuroscience, vol. 8, no. 9, pp. 14-19, 2011.

[3] E. F. Torrey, R. R. Rawlings, J. M. Ennis, D. D. Merrill, and D. S. Flores, "Birth seasonality in bipolar disorder, schizophrenia, schizoaffective disorder and stillbirths," Schizophrenia Research, vol. 21, no. 3, pp. 141-149, 1996.

[4] R. E. Kneeland and S. H. Fatemi, "Viral infection, inflammation and schizophrenia," Progress in Neuro-Psychopharmacology & Biological Psychiatry, vol. 42, pp. 35-48, 2013.

[5] U. Meyer, J. Feldon, and B. K. Yee, "A review of the fetal brain cytokine imbalance hypothesis of schizophrenia," Schizophrenia Bulletin, vol. 35, no. 5, pp. 959-972, 2009.

[6] A. H. Thysen, M. A. Rasmussen, E. Kreiner-M0ller et al., "Season of birth shapes neonatal immune function," The Journal of Allergy and Clinical Immunology, vol. 137, no. 4, pp. 1238-1246.e13, 2016.

[7] M. L. Estes and A. K. McAllister, "Maternal immune activation: Implications for neuropsychiatric disorders," Science, vol. 353, no. 6301, pp. 772-777, 2016.

[8] G. Scola and A. Duong, "Prenatal maternal immune activation and brain development with relevance to psychiatric disorders," Neuroscience, vol. 346, pp. 403-408, 2017.

[9] U. Ratnayake, T. Quinn, D. W. Walker, and H. Dickinson, "Cytokines and the neurodevelopmental basis of mental illness," Frontiers in Neuroscience, no. 7, Article ID 00180, 2013.

[10] J. L. Rapoport, A. M. Addington, S. Frangou, and M. R. C. Psych, "The neurodevelopmental model of schizophrenia: update 2005," Molecular Psychiatry, vol. 10, no. 5, pp. 434-449, 2005.

[11] T. A. Jenkins, "Perinatal complications and schizophrenia: Involvement of the immune system," Frontiers in Neuroscience, no. 7, Article ID Article 110, 2013.

[12] Y. Ayhan, R. McFarland, and M. V. Pletnikov, "Animal models of gene-environment interaction in schizophrenia: a dimensional perspective," Progress in Neurobiology, vol. 136, pp. 1-27, 2016.

[13] European Network of National Networks studying Gene-Environment Interactions in Schizophrenia (EU-GEI), Identifying Gene-Environment Interactions in Schizophrenia: Contemporary Challenges for Integrated, Large-scale Investigations, Schizophrenia Bulletin, vol. 40, no. 4, pp. 729-736, 2014.

[14] G. Modinos, C. Iyegbe, D. Prata et al., "Molecular genetic gene-environment studies using candidate genes in schizophrenia: a systematic review," Schizophrenia Research, vol. 150, no. 2-3, pp. 356-365, 2013.

[15] N. Barrantes-Vidal, G. M. Gross, T. Sheinbaum, M. Mitjavila, S. Ballespi, and T. R. Kwapil, "Positive and negative schizotypy are associated with prodromal and schizophrenia-spectrum symptoms," Schizophrenia Research, vol. 145, no. 1-3, pp. 50-55, 2013.

[16] N. Barrantes-Vidal, P. Grant, and T. R. Kwapil, "The role of schizotypy in the study of the etiology of schizophrenia spectrum disorders," Schizophrenia Bulletin, vol. 41, pp. S408S416, 2015.

[17] E. E. Walter, F. Fernandez, M. Snelling, and E. Barkus, "Genetic consideration of schizotypal traits: A review," Frontiers in Psychology, vol. 7, article no. 1769, 2016.

[18] U. Ettinger, I. Meyhofer, M. Steffens, M. Wagner, and N. Koutsouleris, "Genetics, cognition, and neurobiology of schizotypal personality: a review of the overlap with schizophrenia," Frontiers in Psychiatry, vol. 5, article 18, 2014.

[19] O. J. Mason, "The assessment of schizotypy and its clinical relevance," Schizophrenia Bulletin, vol. 41, 2, pp. S374-S385, 2015.

[20] A. H. Fanous, M. C. Neale, C. O. Gardner et al., "Significant correlation in linkage signals from genome-wide scans of schizophrenia and schizotypy," Molecular Psychiatry, vol. 12, no. 10, pp. 958-965, 2007.

[21] P. K. Bolinskey, C. A. Iati, H. K. Hunter, and J. H. Novi, "Season of birth, mixed-handedness, and psychometric schizotypy: Preliminary results from a prospective study," Psychiatry Research, vol. 208, no. 3, pp. 210-214, 2013.

[22] A. S. Cohen and G. M. Najolia, "Birth characteristics and schizotypy: evidence of a potential 'second hit'," Journal of Psychiatric Research, vol. 45, no. 7, pp. 955-961, 2011.

[23] H. Hori, T. Teraishi, D. Sasayama et al., "Relationships between season of birth, schizotypy, temperament, character and neurocognition in a non-clinical population," Psychiatry Research, vol. 195, no. 1-2, pp. 69-75, 2012.

[24] L. Konrath, D. Beckius, and U. S. Tran, "Season of birth and population schizotypy: results from a large sample of the adult general population," Psychiatry Research, vol. 242, pp. 245-250, 2016.

[25] A. Cordova-Palomera, R. Calati, B. Arias et al., "Season of birth and subclinical psychosis: Systematic review and meta-analysis of new and existing data," Psychiatry Research, vol. 225, no. 3, pp. 227-235, 2015.

[26] A. Raine, "The SPQ: a scale for the assessment of schizotypal personality based on DSM-III-R criteria," Schizophrenia Bulletin, vol. 17, no. 4, pp. 555-564,1991.

[27] G. Arrode-Bruses and J. L. Brusos, "Maternal immune activation by poly(I:C) induces expression of cytokines IL-1[beta] and IL13, chemokine MCP-1 and colony stimulating factor VEGF in fetal mouse brain," Journal of Neuroinflammation, vol. 9, article 83, 2012.

[28] D. H. Dimitrov, S. Lee, J. Yantis, C. Honaker, and N. Braida, "Cytokine serum levels as potential biological markers for the Psychopathology in Schizophrenia," Advances in Psychiatry, vol. 2014, pp. 1-7, 2014.

[29] B. J. Miller, P. Buckley, W. Seabolt, A. Mellor, and B. Kirkpatrick, "Meta-analysis of cytokine alterations in schizophrenia: clinical status and antipsychotic effects," Biological Psychiatry, vol. 70, no. 7, pp. 663-671, 2011.

[30] V. E. Golimbet, G. I. Korovaltseva, M. V. Gabaeva et al., "A study of IL-1B and IDO gene polymorphisms in patients with schizophrenia," Zhurnal of Nevrologii i Psikhiatrii Im S S Korsakova, vol. 114, no. 5, pp. 46-49, 2014.

[31] P. Kapelski, M. Skibinska, M. Maciukiewicz et al., "An Association Between Functional Polymorphisms of the Interleukin 1 Gene Complex and Schizophrenia Using Transmission Disequilibrium Test," Archivum Immunologiae et Therapia Experimentalis, vol. 64, pp. 161-168, 2016.

[32] B. H. Shirts, J. Wood, R. H. Yolken, and V. L. Nimgaonkar, "Association study of IL10, IL1[beta], and IL1RN and schizophrenia using tag SNPs from a comprehensive database: Suggestive association with rs16944 at IL1[beta]," Schizophrenia Research, vol. 88, no. 1-3, pp. 235-244, 2006.

[33] M. Xu and L. He, "Convergent Evidence Shows a Positive Association of Interleukin-1 Gene Complex Locus with Susceptibility to Schizophrenia in the Caucasian population," Schizophrenia Research, vol. 120, no. 1-3, pp. 131-142, 2010.

[34] M. Fatjo-Vilas, E. Pomarol-Clotet, R. Salvador et al., "Effect of the interleukin-1[beta] gene on dorsolateral prefrontal cortex function in schizophrenia: A genetic neuroimaging study," Biological Psychiatry, vol. 72, no. 9, pp. 758-765, 2012.

[35] E. M. Meisenzahl, D. Rujescu, A. Kirner et al., "Association of an interleukin-1[beta] genetic polymorphism with altered brain structure in patients with schizophrenia," The American Journal of Psychiatry, vol. 158, no. 8, pp. 1316-1319, 2001.

[36] S. Papiol, V. Molina, A. Rosa, J. Sanz, T. Palomo, and L. Fananas, "Effect ofinterleukin-1[beta] gene functional polymorphism on dorsolateral prefrontal cortex activity in schizophrenic patients," American Journal of Medical Genetics Part B: Neuropsychiatric Genetics, vol. 144, no. 8, pp. 1090-1093, 2007.

[37] D. F. Levinson, M. D. Levinson, R. Segurado, and C. M. Lewis, "Genome scan meta-analysis of schizophrenia and bipolar disorder, part I: Methods and power analysis," American Journal of Human Genetics, vol. 73, no. 1, pp. 17-33, 2003.

[38] P. Mendez-Samperio, A. Badillo-Flores, A. Nunez-Vazquez, and M. Hernandez Garay, "Interleukin-4 inhibits secretion of interleukin-1[beta] in the response of human cells to mycobacterial heat shock proteins," Clinical and Diagnostic Laboratory Immunology, vol. 4, no. 6, pp. 665-670,1997.

[39] H. Park, H. Shim, K. An, A. Starkweather, K. S. Kim, and I. Shim, "IL-4 Inhibits IL-1," Mediators of Inflammation, vol. 2015, Article ID 941413, pp. 1-9, 2015.

[40] S. Sone, E. Orino, K. Mizuno et al., "Production ofIL-1 and its receptor antagonist is regulated differently by IFN-y and IL4 in human monocytes and alveolar macrophages," European Respiratory Journal, vol. 7, no. 4, pp. 657-663, 1994.

[41] R. Dewberry, H. Holden, D. Crossman, and S. Francis, "Interleukin-1 receptor antagonist expression in human endothelial cells and atherosclerosis," Arteriosclerosis, Thrombosis, and Vascular Biology, vol. 20, no. 11, pp. 2394-2400, 2000.

[42] L. J. Rosenwasser, D. J. Klemm, J. K. Dresback et al., "Promoter polymorphisms in the chromosome 5 gene cluster in asthma and atopy," Clinical & Experimental Allergy, vol. 25, supplement 2, pp. 74-78, 1995.

[43] W. J. Gauderman, "Sample size requirements for association studies of gene-gene interaction," American Journal of Epidemiology, vol. 155, no. 5, pp. 478-484, 2002.

[44] S. Cauci, M. Di Santolo, K. K. Ryckman, S. M. Williams, and G. Banfi, "Variable number of tandem repeat polymorphisms of the interleukin-1 receptor antagonist gene IL-1RN: A novel association with the athlete status," BMC Medical Genetics, vol. 11, no. 1, article no. 29, 2010.

[45] K. Psachoulia, K. A. Chamberlain, D. Heo et al., "IL4I1 augments CNS remyelination and axonal protection by modulating T cell driven inflammation," Brain, vol. 139, no. 12, pp. 3121-3136, 2016.

[46] J. T. Walsh, S. Hendrix, F. Boato et al., "MHCII-independent CD4+ T cells protect injured CNS neurons via IL-4," The Journal of Clinical Investigation, vol. 125, no. 2, pp. 699-714, 2015.

[47] S. P. Gadani, J. C. Cronk, G. T. Norris, and J. Kipnis, "IL-4 in the brain: a cytokine to remember," The Journal of Immunology, vol. 189, no. 9, pp. 4213-4219, 2012.

[48] Z. Li, F. Liu, H. Ma et al., "Age exacerbates surgery-induced cognitive impairment and neuroinflammation in Sprague-Dawley rats: the role of IL-4," Brain Research, vol. 1665, pp. 65-73, 2017.

[49] O. S. Von Ehrenstein, G. I. Neta, W. Andrews, R. Goldenberg, A. Goepfert, and J. Zhang, "Child intellectual development in relation to cytokine levels in umbilical cord blood," American Journal of Epidemiology, vol. 175, no. 11, pp. 1191-1199, 2012.

[50] X. Liu, J. Liu, S. Zhao et al., "Interleukin-4 is essential for microglia/macrophage M2 polarization and long-term recovery after cerebral ischemia," Stroke, vol. 47, no. 2, pp. 498-504, 2016.

[51] S. Mori, P. Maher, and B. Conti, "Neuroimmunology of the Interleukins 13 and 4," Brain Sciences, vol. 6, no. 2, article 18, 2016.

[52] J. Yang, S. Ding, W. Huang et al., "Interleukin-4 ameliorates the functional recovery of intracerebral hemorrhage through the alternative activation of microglia/macrophage," Frontiers in Neuroscience, vol. 10, article no. 61, 2016.

[53] M. Tochigi, Y. Okazaki, N. Kato, and T. Sasaki, "What causes seasonality of birth in schizophrenia?" Neuroscience Research, vol. 48, no. 1, pp. 1-11, 2004.

[54] N. H. A. Suaini, Y. Zhang, P. J. Vuillermin, K. J. Allen, and L. C. Harrison, "Immune modulation by vitamin D and its relevance to food allergy," Nutrients, vol. 7, no. 8, pp. 6088-6108, 2015.

[55] M. Wrzosek, J. Lukaszkiewicz, M. Wrzosek et al., "Vitamin D and the central nervous system," Pharmacological Reports, vol. 65, no. 2, pp. 271-278, 2013.

[56] A. Boonstra, F. J. Barrat, C. Crain, V L. Heath, H. F. J. Savelkoul, and A. O'Garra, "1alpha,25-Dihydroxyvitamin D3 has a direct effect on naive CD4+T cells to enhance the development of Th2 cells," The Journal of Immunology, vol. 167, no. 9, pp. 4974-4980, 2001.

[57] R. Calvello, A. Cianciulli, G. Nicolardi et al., "Vitamin D treatment attenuates neuroinflammation and dopaminergic neurodegeneration in an animal model of Parkinson's disease, shifting M1 to M2 microglia responses," Journal of Neuroimmune Pharmacology, vol. 12, no. 2, pp. 327-339, 2017.

[58] B. D. Mahon, A. Wittke, V. Weaver, and M. T. Cantorna, "The targets of vitamin D depend on the differentiation and activation status of CD4 positive T cells," Journal of Cellular Biochemistry, vol. 89, no. 5, pp. 922-932, 2003.

[59] J. J. McGrath, D. W. Eyles, C. B. Pedersen et al., "Neonatal vitamin D status and risk of schizophrenia: a population-based case-control study," Archives of General Psychiatry, vol. 67, no. 9, pp. 889-894, 2010.

[60] G. C. Man, T. Zhang, X. Chen et al., "The regulations and role of circadian clock and melatonin in uterine receptivity and pregnancy-An immunological perspective," American Journal of Reproductive Immunology, vol. 78, no. 2, Article ID e12715, 2017.

[61] W. Ren, G. Liu, S. Chen et al., "Melatonin signaling in T cells: functions and applications," Journal of Pineal Research, vol. 62, no. 3, 2017.

[62] I.-S. Shin, J.-W. Park, N.-R. Shin et al., "Melatonin reduces airway inflammation in ovalbumin-induced asthma," Immunobiology, vol. 219, no. 12, pp. 901-908, 2014.

[63] T. da Silva Araujo, A. J. Maia Chaves Filho, A. S. Monte et al., "Reversal of schizophrenia-like symptoms and immune alterations in mice by immunomodulatory drugs," Journal of Psychiatric Research, vol. 84, pp. 49-58, 2017.

[64] C. C. H. Lin, C.-H. Su, P.-H. Kuo, C. K. Hsiao, W.-T. Soong, and W. J. Chen, "Genetic and environmental influences on schizotypy among adolescents in Taiwan: a multivariate twin/sibling analysis," Behavior Genetics, vol. 37, no. 2, pp. 334-344, 2007.

[65] Y. M. Linney, R. M. Murray, E. R. Peters, A. M. MacDonald, F. Rijsdijk, and P. C. Sham, "A quantitative genetic analysis of schizotypal personality traits," Psychological Medicine, vol. 33, no. 5, pp. 803-816, 2003.

[66] S. E. Morton, K. J. O'Hare, J. L. Maha et al., "Testing the validity of taxonic schizotypy using genetic and environmental risk variables," Schizophrenia Bulletin, vol. 43, pp. 633-643, 2017.

[67] P. H. Venables, "Schizotypy and maternal exposure to influenza and to cold temperature: the Mauritius study," Journal of Abnormal Psychology, vol. 105, no. 1, pp. 53-60,1996.

Margarita V. Alfimova, Galina I. Korovaitseva, Tatyana V. Lezheiko, and Vera E. Golimbet

Mental Health Research Center, Kashirskoe Shosse 34, Moscow 115522, Russia

Correspondence should be addressed to Margarita V. Alfimova; m.alfimova@gmail.com

Received 15 August 2017; Accepted 13 December 2017; Published 31 December 2017

Academic Editor: Luis San
TABLE 1: Sociodemographic characteristics of participants.

Variables                      Stage 1       Stage 2

N                                278           373
Age (M, SD, years)             35.112.8     33.412.2
Sex (women, N, %)             172 (62%)     223 (60%)
Season of birth (N, %)
  Winter                       75 (27%)     92 (25%)
  Spring                       67 (24%)     94 (25%)
  Summer                      68 (24.5%)    88 (24%)
  Autumn                      68 (24.5%)    99 (26%)
SPQ total score               17.7210.85   17.25 11.13
Cognitive-perceptual factor   7.51 5.65     7.135.62
Interpersonal factor          8.44 5.77     8.13 5.82
Disorganized factor           3.88 3.13     3.98 3.30

Note. SPQ: Schizotypal Personality Questionnaire.

TABLE 2: Genotyping conditions for the IL1B rs16944, IL4 rs2243250,
and IL-1RN VNTR polymorphisms.

                                            PCR reaction
Polymorphism   Primer                        mixture and
                                               program

                                          94[degrees]C/2 min
IL1B           Forward                       30 cycles:
rs16944        5'TGGCATTGATCTGGTTCATC3'   94[degrees]C/20 s
               reverse                    50[degrees]C/20 s
               5'GTTTAGGAATCTTCCCACTT3'   72[degrees]C/20 s
                                          72[degrees]C/4min

                                          94[degrees]C/2 min
IL4            Forward                       30 cycles:
rs2243250      5'ACTAGGCCTCACCTGATACG3'   94[degrees]C/30 s
               reverse                    50[degrees]C/30 s
               5'GTTGTAATGCAGTCCTCCTG3'   72[degrees]C/30 s
                                          72[degrees]C/4min

                                          94[degrees]C/2 min
IL-1RN         Forward                       30 cycles:
VNTR           5'-CTCAGCAACACTCCTAT-3'    94[degrees]C/20 s
               reverse                    50[degrees]C/20 s
               5'-TCCTGGTCTGCAGGTAA3'     72[degrees]C/20 s
                                          72[degrees]C/4min

                                          Restriction
Polymorphism   Primer                     endonuclease

                                             Ama87I
IL1B           Forward                     (SybEnzym,
rs16944        5'TGGCATTGATCTGGTTCATC3'     Russia)
               reverse
               5'GTTTAGGAATCTTCCCACTT3'

                                             BslFI
IL4            Forward                     (SybEnzym,
rs2243250      5'ACTAGGCCTCACCTGATACG3'     Russia)
               reverse
               5'GTTGTAATGCAGTCCTCCTG3'

IL-1RN         Forward
VNTR           5'-CTCAGCAACACTCCTAT-3'
               reverse
               5'-TCCTGGTCTGCAGGTAA3'

                                               PCR or
Polymorphism   Primer                        digestion
                                              products

                                              Digested
IL1B           Forward                       C allele,
rs16944        5'TGGCATTGATCTGGTTCATC3'        190 +
               reverse                        115 bp,
               5'GTTTAGGAATCTTCCCACTT3'     nondigested
                                             T allele,
                                               305 bp

                                             Digested C
IL4            Forward                        allele,
rs2243250      5'ACTAGGCCTCACCTGATACG3'        177 +
               reverse                         18 bp,
               5'GTTGTAATGCAGTCCTCCTG3'     nondigested
                                          T allele, 195 bp

                                             Allele 1,
                                              412 bp,
                                             allele 2,
IL-1RN         Forward                        240 bp,
VNTR           5'-CTCAGCAACACTCCTAT-3'       allele 3,
               reverse                        498 bp,
               5'-TCCTGGTCTGCAGGTAA3'        allele 4,
                                              326 bp,
                                             allele 5,
                                               584bp

TABLE 3: Means and SD of the SPQ total score by SOB and genotypes.

Polymorphism                        Winter SOB

IL1B rs16944          CC homozygotes     T allele carriers
                          n = 33              n = 42
                        16.6411.24          18.69 8.95

IL4 rs2243250 (1)     CC homozygotes     T allele carriers
                          n = 55              n = 20
                        19.53 9.73          13.00 9.35

IL-1RN VNTR              Allele 2        Allele 2 carriers
                    noncarriers n = 28        n = 47
                        16.7910.48          18.38 9.77

Polymorphism                  Nonwinter SOB

IL1B rs16944        CC homozygotes   T allele carriers
                        n = 98            n= 105
                      17.7611.64        17.6410.77

IL4 rs2243250 (1)   CC homozygotes   T allele carriers
                       n = 129            n = 74
                     17.20 11.26        18.54 11.03

IL-1RN VNTR            Allele 2      Allele 2 carriers
                     noncarriers          n= 111
                        n = 92          17.74 11.02
                      17.6411.41

Note. SPQ: Schizotypal Personality Questionnaire; SOB: season of
birth. (1) The effect of the IL4 X SOB interaction on the SPQ total
score is significant, p < 0.01.

TABLE 4: Means and SD of the SPQ total and factor scores by SOB and
IL4 genotype in the extended sample.

                                         Winter SOB
SPQ scores                    CC homozygotes   T allele carriers
                                  n = 68            n = 24

SPQ total score                20.59 10.36       13.5810.04 *
Cognitive-perceptual factor     8.37 4.66        5.42 4.29 **
Interpersonal factor            9.28 5.95          7.045.77
Disorganized factor             5.06 3.79         2.83 2.37 *

                                        Nonwinter SOB
SPQ scores                    CC homozygotes   T allele carriers
                                 n = 173            n = 108

SPQ total score                16.75 11.39        16.78 11.09
Cognitive-perceptual factor     6.71 5.54          7.416.40
Interpersonal factor            8.17 5.92          7.575.53
Disorganized factor             3.83 3.33          3.81 2.94

Note. SPQ: Schizotypal Personality Questionnaire; SOB: season of
birth. Differences between carriers of CC genotype and T allele are
significant in the winter SOB group: * Bonferroni adjusted P < 0.05.
** Bonferroni adjusted p < 0.01.
COPYRIGHT 2018 Hindawi Limited
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2018 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research Article
Author:Alfimova, Margarita V.; Korovaitseva, Galina I.; Lezheiko, Tatyana V.; Golimbet, Vera E.
Publication:Schizophrenia Research and Treatment
Date:Jan 1, 2018
Words:6089
Previous Article:Long-Acting Injectable Second-Generation Antipsychotics Improve Negative Symptoms and Suicidal Ideation in Recent Diagnosed Schizophrenia Patients: A...
Next Article:A Possible Link between Anxiety and Schizophrenia and a Possible Role of Anhedonia.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters