Printer Friendly

Interaction Effect of Rsal and BamHI Polymorphisms of TGF[alpha], BMP2 and BMP4 on the Occurrence of Non-Syndromic Cleft Lip and Palate in Iranian Patients.

Introduction

Orofacial cleft is the most common congenital defect of the maxillofacial region. It has the highest prevalence in the East Asia such as China and Japan with 1/500 live births and the least prevalence among the African-Americans with 0.21 to 0.41/1000 live births (1,2) The prevalence of orofacial cleft in Iran is 1.05 to 1.9/1000 live births (3-5). Orofacial cleft decreases the quality of life of patients and their family and negatively affects the speech, oral health and mental health of patients (6). The non-syndromic form is multifactorial, and environmental factors such as cigarette smoking, alcohol consumption, folate consumption, infections and viruses as well as genetics may be involved in its occurrence (1,7). Nonetheless, the molecular mechanism of action of these factors has not been well recognized. Several genes may be involved in the occurrence of Cleft Lip and Palate (CLP). TGF[alpha] is a member of the epidermal growth factor superfamily, which codes a protein with the same name. During craniofacial development, TGF[alpha] is expressed in the internal border of the epithelium of fusing palatal shelves and stimulates the synthesis of extracellular matrix and migration of mesenchymal cells, which further strengthens the palatal tissue. Rsal (rs3732288) and BamHI (rsl 1466297) are the two common variants of this gene (8,9). Ardinger et al evaluated the role of Transforming Growth Factor-alpha (TGFa) gene variants in the occurrence of CLP (10). Ebadifar et al showed that polymorphism of TGF[alpha] variants plays a role in the occurrence of CLP (11).

Evidence shows that Bone Morphogenetic Proteins (BMPs) and their antagonist, Noggin, play a role in fusion of the upper lip and the primary palate (12). The two subgroups of BMP2 and BMP4 play a fundamental role in craniofacial development and are specifically expressed in epithelial and mesenchymal cells of the palatal shelves. The significance of BMP2 (rs235768) and BMP4 (rs 17563) variants in the occurrence of CLP has been emphasized in previous studies (13,14). Saket et al indicated that polymorphism of BMP2 (rs235768) and BMP4 (rs 17563) variants plays an important role in the occurrence of CLP in the Iranian population (15). Blanco et al demonstrated that although the interaction between BMP4 and IRF6 is mild, presence of specific haplotypes indicates higher risk of occurrence of CLP (16).

Molecular studies have shown that interaction of gene-gene such as Sonic Hedgehog (SHH), bone morphogenetic proteins, the homeobox containing genes BarxJ and Msxl can control the initiation, outgrowth and specification of the facial processes (17-19). Evidence suggests genetic predisposition of NSCLP, caused by the interactions of multiple interacting genes (20). Song et al showed that the interaction of PAX9 and IRF6 plays a potentially important role in the occurrence of CLP (21). Lidral et al found that the 4-2-2-2-2 haplotype for MSX1 CA-X1.1-X1.3-X2.1-X2.4 was most frequently transmitted among both CLP and CP cases (22). Jugessur et al raised the possibility of interaction between TGFA, TGFB3, and MSXL The effect of this TGFA TaqI genotype was stronger among children homozygous for the MSX1-CA A4 allele, raising the possibility of interaction between these two genes (23). Since the individual role of polymorphism of the aforementioned variants has been previously confirmed in the occurrence of CLP in the Iranian population (11,15), this study aimed to assess the interaction effect of Rsal and BamHI polymorphisms of TGFa and BMP2 and BMP4 on the occurrence of Non-Syndromic Cleft Lip and Palate (NSCLP) in the Iranian population.

Materials and Methods

This case-control study was approved in the ethics committee of Shahid Beheshti University of Medical Sciences (IR.SBMU.RIDS.REC. 1395.195). The study group included blood samples of 120 children with NSCLP born at Mofid Hospital from 2013 to 2016. Patients with other skeletal and facial malformations such as congenital lip pits, cardiac diseases or neurologic anomalies were excluded. The control group included 215 healthy children born in Tehran city between 2013 to 2016. Written informed consent was obtained from the parents. The mothers of children were requested to sign the consent form and fill out a questionnaire regarding the presence of congenital anomalies, medication intake, cigarette smoking, tobacco use and intake of folate during the three months before and one month after conception and pregnancy. In brief, 3 ml of peripheral blood was collected in tubes containing 200 [micro]l of 0.5 M EDTA, and genomic DNA was extracted from the peripheral blood using the salting out method (24). Genotyping of the TGFA/BamHI (rs11466297), TGFA/Rsal (rs3732248), BMP4 (rsl7563) and BMP2 (rs235768) was performed by Polymerase Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP) methods, according to a previous study (24). A total volume of 25 [micro]l containing 30 ng of genomic DNA. 10 pmol of each primer. 1 [micro]l dNTPs mix (Fermentas, Life Science), 2.5[micro]l 10xbuffer and 0.5 U of Taq DNA polymerase (Fermentas Life Science, Lithuania) with 1.5 mM [MgCl.sub.2] was prepared in 0.5 ml Eppendorf microtube for amplification of the target sequences. Amplification conditions started with an initial denaturation step of 4 min at 95 [degrees]C, followed by 33 cycles of 45 ,s of denaturation (94 [degrees]C), 30 s of annealing (60 [degrees]C) and 40 s of extension (72 [degrees]C), ended by a final extension for 5 min (72[degrees]C) and finally cooling to 4[degrees]C. All PCR products were subjected to 8% poly-acrylamide gel electrophoresis and stained with silver nitrate. Table 1 shows the primer sequences and the pattern of restriction fragments.

Statistical analysis

Data were analyzed using SPSS 18 (SPSS Inc., Chicago, USA). Chi square and Fisher's exact test with Open Epi Version 2.2 (free statistical software) were performed to compare genotype and allele frequency among the study groups. Logistic regression was used to determine the effect of influential factors and the interaction effect of different variants on the occurrence of CLP. p<0.05 was considered statistically significant.

Results

There were 59.3% males and 40.7% females in the case and 43.6% males and 56.4% females in the control group. The results showed that gender had no significant association with the occurrence of CLP (p= 0.335).

Table 2 shows the genotype and allele frequency of TGFa variants namely Rsal and BamHI in the case and control groups. Table 3 shows the genotype and allele frequency of BMP2 and BMP4 in the two groups. Table 4 demonstrates the interaction effect of Rsal, BamHI, BMP2 and BMP4 polymorphisms on the occurrence of NSCLP. Multiple logistic regression showed that the interaction effect of polymorphisms of the BMP family, TGFa family and combination of all four on the occurrence of NSCLP was not statistically significant (p=l.000).

Discussion

NSCLP is a common genetic defect that occurs due to the interaction of different genes and environmental factors (25). Several genes have been implicated in the occurrence of this defect among which FGF8, FGFR1, MSX1, BMP and TGFa can be named (26,27).

BMP4 and BMP2 are the main two subgroups of BMP superfamily, which play an important role in regulation of osteogenesis and chondrogenesis. They are expressed in epithelial and mesenchymal cells in the palatal shelves during palatogenesis (12). Rsal and BamHI are the two common variants of TGFa that induce Table 4. Interaction effect of BamHI, Rsal, BMP4 and BMP2 polymorphisms on the occurrence of NSCLP extracellular matrix synthesis and migration of mesenchymal cells. They also play a pivotal role in strengthening of the palatal tissue (8,9). Several studies have evaluated the relationship of the aforementioned genes and occurrence of CLP. The results of previous studies are controversial, which may be attributed to the difference in sample size, genetic background and environmental factors. Ebadifar et al showed that a correlation exists between polymorphism of BamHI variant and occurrence of CLP in the Iranian population such that the frequency of AC genotype and C allele was significantly higher in the patient group (12.4 and 8%, respectively) ". Ardinger et al found a significant correlation between the polymorphism of BamHI and Tag 1 variants and the occurrence of CLP in the American population (8). On the other hand, Lidral et al found no significant correlation between TGFa gene and the occurrence of CLP in a non-Caucasian population (28).

Regarding BMP gene, Saket et al showed that the frequency of BMP4 and BMP2 genotypes was 70 and 59.8% higher in CLP patients compared to the values in the control group, respectively; this indicates a positive correlation between variants of this gene and occurrence of CLP in the Iranian population (15). Jianyan et al indicated that the frequency of BMP4 polymorphism was twice the value in the control group in patients with CLP in a Chinese population (29). On the other hand, Wang et al did not find a significant association between this polymorphism and occurrence of CLP in a Chinese population (30). Hu et al, in their meta-analysis stated that BMP4 increases the risk of occurrence of CLP in the Chinese population while it has a positive inhibitory effect on the occurrence of CLP in the Brazilian population (31).

The role of BMP4, BMP2, Rsal and BamHI polymorphisms in the occurrence of CLP in the Iranian population has been previously confirmed (11,15). Thus, this study assessed the interaction effect of these polymorphisms on the occurrence of CLP. The results showed that the interaction effect of two polymorphisms of BMP gene and TGF[alpha] gene had no significant effect on the occurrence of NSCLP. On the other hand, the overall and pairwise interaction effects of the four variants on the occurrence of CLP were not significant either.

Some previous studies have shown the interaction effect of different variants on the occurrence of NSCLP. Song et al showed that combinations of rs2073485 (GG) and rsl7176643 (aC+CC), rs2235371 (CC) and rsl7176643 (aC+CC) and also rs2236909 (aG+aa) and rsl7176643 (aC+CC) were significantly correlated with the occurrence of NSCLP (17). Sull et al demonstrated that the interaction of TGFa and IRF6 may play a role in the occurrence of NSCLP (32). Difference between the results of aforementioned studies and ours may be attributed to different study populations and the tested variants.

Conclusion

Although the individual role of BMP4, BMP2, Rsal and BamHI variants has been shown in the occurrence of NSCLP separately in various studies in Iranian population (11,15), this study showed that their interaction effect on the occurrence of NSCLP was not significant.

Acknowledgement

The authors would like to thank Dr. Rouzrokh, the administrator of Mofid Hospital and the personnel of this hospital for their sincere cooperation in the conduction of this study. This study was part of a thesis for doctorate degree in dental surgery by Saba Samadi and was financially supported by a grant from Dentofacial Deformities Research Center, Research Institute of Dental Sciences, Shahid Beheshti University of Medical Sciences.

References

(1.) Dixon MJ, Marazita ML, Beaty TH, Murray JC. Cleft lip and palate: understanding genetic and environmental influences. Nat Rev Genet 2011;12(3): 167-178.

(2.) Conway JC, Taub PJ, Kling R, Oberoi K, Doucette J, Jabs EW Ten-year experience of more than 35 000 oro-facial clefts in Africa . BMC Pediatr2015;15:8.

(3.) Mirfazeli A, Kaviany N, Hosseinpour KR, Golalipour MJ. Incidence of cleft lip and palate in gorgan - northern iran: an epidemiological study. Oman Med J 2012;27(6): 461-464.

(4.) Kianifar H, Hasanzadeh N, Jahanbin A, Ezzati A, Kianifar H Cleft lip and palate: A 30-year epidemiologic study in north-east of Iran. Iran J Otorhinolaryngol 2015; 27(78):35-41.

(5.) Cooper ME, Ratay JS, Marazita ML. Asian oral-facial cleft birth prevalence. Cleft Palate Craniofac J 2006;43 (5):580-589.

(6.) Mossey PA, Little J, Munger RG, Dixon MJ, Shaw WC. Cleft lip and palate. Lancet 2009;374(9703): 1773-1785.

(7.) Seto-Salvia N, Stanier P.Genetics of cleft lip and/or cleft palate: association with other common anomalies. Eur J Med Genet 2014;57(8):381-393.

(8.) Vieira AR. Association between the transforming growth factor alpha gene and nonsyndromic oral clefts: a HuGE review. Am J Epidemiol 2006;163(9):790-810.

(9.) Lu XC, Yu W, Tao Y, Zhao PL, Li K, Tang LJ, et al. Contribution of transforming growth factor [alpha] polymorphisms to nonsyndromic orofacial clefts: a HuGE review and meta-analysis. Am J Epidemiol 2014;179(3):267-281.

(10.) Ardinger HH, Buetow KH, Bell GI, Bardach J, VanDemark DR, Murray JC. Association of genetic variation of the transforming growth factor-alpha gene with cleft lip and palate. Am J Hum Genet 1989;45(3):348-353.

(11.) Ebadifar A, Hamedi R, Khorram Khorshid HR, Saliminejad, Kamali K, Aghakhani Moghadam F, et al. Association of transfonning growth factor alpha polymorphisms with nonsyndromic cleft lip and palate in Iranian population. Avicenna J Med Biotechnol 2015;7(4): 168-172.

(12.) Nie X, Luukko K, Kettunen P. BMP signalling in craniofacial development. Int J Dev Biol 2006;50(6):511-521.

(13.) Kempa 1, Ambrozaityte L, Stavusis J, Akota I, Barkane B, Krumina A, et al. Association of BMP4 polymorphisms with non-syndromic cleft lip with or without cleft palate and isolated cleft palate in Latvian and Lithuanian populations. Stomatologija 2014; 16(3):94-101.

(14.) Araujo TK, Simioni M, Felix TM, de Souza LT, Fontes MI, Monlleo IL, et al. Preliminary analysis of the non-synonymous polymorphism rsl7563 in BMP4 gene in Brazilian population suggests protection for nonsyndromic cleft lip and palate. Plast Surg Int 2012;2012: 247104.

(15.) Saket M, Saliminejad K, Kamali K, Moghadam FA, Anvar NE, Khorram Khorshid HR. BMP2 and BMP4 variations and risk of non-syndromic cleft lip and palate. Arch Oral Biol 2016;72:134-137.

(16.) Blanco R, Colombo A, Pardo R, Suazo J. Haplotype-based gene-gene interaction of bone morphogenetic protein 4 and interferon regulatory factor 6 in the etiology of non-syndromic cleft lip with or without cleft palate in a Chilean population. Eur J Oral Sci 2017;125(2): 102-109.

(17.) Lee SH, Fu KK, Hui JN, Richman JM. Noggin and retinoic acid transform the identity of avian facial prominences. Nature 2001 ;414(6866):909-912.

(18.) Ashique AM, Fu K, Richman JM. Endogenous bone morphogenetic proteins regulate outgrowth and epithelial survival during avian lip fusion. Development 2002; 129 (I9):4647-4660.

(19.) Hu D, Marcucio RS, Helms JA. A zone of frontonasal ectoderm regulates patterning and growth in the face. Development 2003; 130(9): 1749-1758.

(20.) Mehrotra D. Genomic expression in non syndromic cleft lip and palate patients: a review. J Oral Biol Craniofac Res 2015;5(2):86-91.

(21.) Song T, Wu D, Wang Y, Li H, Yin N, Zhao Z. SNPs and interaction analyses of IRF6, MSX1 and PAX9 genes in patients with non-syndromic cleft lip with or without palate. Mol Med Rep 2013;8(4): 1228-1234.

(22.) Lidral AC, Romitti PA, Basarl AM, Doetschman T, Leysens NJ, Daack-FIirsch S, et al. Association of MSX1 and TGFB3 with nonsyndromic clefting in humans. Am J Hum Genet 1998;63(2):557-568.

(23.) Jugessur A, Lie RT, Wilcox AJ, Murray JC, Taylor JA, Saugstad OD, et al. Variants of developmental genes (TGFA, TGFB3, and MSX1) and their associations with orofacial clefts: a case-parent triad analysis. Genet Epidemiol 2003;24(3):230-239.

(24.) Koshy L, Anju AL, Harikrishnan S, Kutty VR, Jissa VT, Kurikesu I, et al. Evaluating genomic DNA extraction methods from human whole blood using endpoint and real-time PCR assays. Mol Biol Rep 2017;44(1):97-108.

(25.) Sivertsen A, Wilcox AJ, Skjaerven R, Vindenes HA, Abyholm F, Harville E, et al. Familial risk of oral clefts by morphological type and severity: population based cohort study of first degree relatives. BMJ 2008,336 (7641):432-434.

(26.) Leslie EJ, Marazita ML. Genetics of cleft lip and cleft palate. Am J Med Genet C Semin Med Genet 2013,163C

(4):246-258.

(27.) Leslie EJ, Murray JC. Evaluating rare coding variants as contributing causes to non-syndromic cleft lip and palate. Clin Genet 2013,84(5):496-500.

(28.) Lidral AC, Murray JC, Buetow KH, Basart AM, SchearerH, Shiang R, et al. Studies of the candidate genes TGFB2, MSX1, TGFA, and TGFB3 in the etiology of cleft lip and palate in the Philippines. Cleft Palate Craniofac J 1997;34(1): 1-6.

(29.) Jianyan L, Zeqiang G, Yongjuan C, Kaihong D, Bing D, Rongsheng L. Analysis of interactions between genetic variants of BMP4 and environmental factors with non-syndromic cleft lip with or without cleft palate susceptibility. Int J Oral Maxillofac Surg 2010;39(l):50-56.

(30.) Wang H, Zhou X, Cui Y, Liu J, Wang W. Relationship between nonsyndromic cleft lip with or without cleft palate (NSCL/P) and genetic polymorphisms of BMP4. Jiangsu Med J 2012,38(8):897-900.

(31.) Hu YY, Qin CQ, Deng MH, Niu YM, Long X. Association between BMP4 rs 17563 polymorphism and NSCL/P risk: a meta-analysis. Dis Markers 2015;2015:763090.

(32.) Sull JW, Liang KY, Hetmanski JB, Wu T, Fallin MD, Ingersoll RG, et al. Evidence that TGFA influences risk to cleft lip with/without cleft palate through unconventional genetic mechanisms. Hum Genet 2009;126(3):385-394.

Saba Samadi (1), Asghar Ebadifar (2*), Hamid Reza Khorram Khorshid (3), Koorosh Kamali (4), and Mohammadreza Badiee (5)

(1.) General Dentist, Tehran, Iran

(2.) Dentofacial Deformities Research Center, Research Institute of Dental Sciences, Department of Orthodontic, Faculty of Dentistry, Shahid Behehsti University of Medical Sciences, Tehran, Iran

(3.) Genetic Research Centre, University of Social Welfare and Rehabilitation Sciences, Tehran, Iran

4 Department of Public Health, Faculty of Public Health, Zanjan University of Medical Sciences, Zanjan, Iran

(5.) Dentofacial Deformities Research Center, Research Institute of Dental Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran

(*) Corresponding author:

Asghar Ebadifar, Ph.D.,

Dentofacial Deformities Research

Center, Research Institute of

Dental Sciences, Shahid Beheshti

University of Medical Sciences,

Tehran, Iran

Tel: +98 9122173808

E-mail:

a.ebadifar@sbmu.ac.ir

Received: 17 May 2017

Accepted: 19 Jul 2017
Table 1. Primer sequences, product size and RE fragments for the BamH1,
Rsal, BMP4 and BMP2

SNPs                          Global MAF  Primer(5'[right arrow] 3)

                                          F: GCCTGGCTTATTTGGGGATT
TGFA/ BamHI (rsll466297 A/C)  C=0.0238    R:AAGGGCAAGGAAACACAGG
                                          F: TGCCTTCCTTCTGCTATCACT
TGFA/Rsal (is3732248 C/T)     A=0.2075    R: CAGAGCCAATGTCACCAAGT
                                          F: CACCATTCATTGCCCAAC
BMP4(rsl7563)                 C = 0.3257
                                          R:AGTTTGGCTGCTTCTCCC
                                          F: GAAACGAGTGGGAAAACAACC
BMP2(rs235768)                T = 0.2332
                                          R: GAGACACCTTGTTTCTCCTCCA

SNPs                          Product Size (bp)  RE fragments (bp)

                                                 Aallele=120+54
TGFA/ BamHI (rsll466297 A/C)  174                Callele=174
                                                 Callele=91+75
TGFA/Rsal (is3732248 C/T)     153                Tallele=166
                                                 AA: 165
BMP4(rsl7563)                 179                TT: 86 + 79
                                                 AT: 165 + 86 + 79
                                                 TT: 118 + 61
BMP2(rs235768)                165                CC: 179
                                                 TC: 179+ 118 + 61

Table 2. Genotype and allele frequency of the TGF[alpha] BamHI and Rsal
polymorphisms in the case and control groups

Genotype/allele      Case group   Control group  p-value

BamHI (rs11 466297)
GG                    97 (93.3%)  185 (92%)      Reference group
GC                     5 (4.8%)    16 (8%)       0.322
CC                     2 (1.9%)     0 (0%)       0.241
G                    199 (95.7%)  386 (96%)      Reference allele
C                      9 (4.3%)    16 (4%)       0.838
Rsal (rs3732288)
CC                    70 (66%)    112 (58.3%)    Reference group
CT                    30 (28.3%)   60 (31.3%)    0.409
TT                     6 (5.7%)    20 (10.4%)    0.127
C                    170 (80.2%)  284 (74%)      Reference allele
T                     42 (19.8%)  100 (26%)      0.087

Genotype/allele      OR (95% CI)

BamHI (rs11 466297)
GG
GC                   0.6 (0.2-1.7)
CC                   Undefined
G
C                    1.1 (0.47-2.5)
Rsal (rs3732288)
CC
CT                   0.8(0.5-1.4)
TT                   0.5(0.2-1.3)
C
T                    0.7(0.5-1.05)

Table 3. The genotype and allele frequency of the BMP2 and BMP4
polymorphisms in the case and control groups

Genotype/allele  Case group   Control group  p-value

BMP2 (rs235768)
TT                35 (32.1%)  124 (59.3%)    Reference group
TA                65 (59.6%)   74 (39.4%)    0.561
AA                 9 (8.3%)    11 (5.3%)     0.002
T                135 (61.9%)  322 (77%)      Reference allele
A                 83 (38.1%)   96 (23%)      0.001
BMP4(rs17563)
TT                22 (20.2%)   74 (35.4%)    Re
TC                70 (64.2%)   96 (45.9%)    0.585
CC                17 (15.6%)   39 (18.7%)    0.056
T                114 (52.3%)  244 (58.4%)    Reference allele
C                104 (47.7%)  174 (41.6%)    0.142

Genotype/allele  OR (95% CI)

BMP2 (rs235768)
TT
TA               0.2(0.13-3)
AA               2.7(1.4-5.1)
T
A                2(1.4-2.9)
BMP4(rs17563)
TT               ference group
TC               1.3 (0.5-3].4)
CC               2.1(0.98-4.5)
T
C                1.3(0.9-1.8)

Table 4. Interaction effect of BamHI, Rsal, BMP4 and BMP2 polymorphisms
on the occurrence of NSCLP

Interaction terms                                              p-value

BMP2 c.893 T>A(rs235768) & BMP4 c.538 C>T (rsl 7563)           0.997
BMP4 c.538 C>T (rsl7563) &TGF[alpha] (BamHI)                   1.000
BMP4 c.538 C>T (rs 17563) & TGF[alpha] (Rsal) rs3732248        1.000
BMP2 c.893 T>A(rs235768) &TGF[alpha] (BamHI)                   1.000
BMP2 c.893 T>A(rs235768) &TGF[alpha] (Rsal) rs3732248          1.000
TGFa (BamHI) &TGFa (Rsal) rs3732248                            1.000
BMP2 c.893 T>A (rs235768) & BMP4 c.538 C>T (rs 17563)
&TGF[alpha] (Rsal) rs3732248                                   1.000
BMP2 c.893 T>A(rs235768) &TGFa (BamHI) &TGFa (Rsal) rs3732248  1.000
BMP2 c.893 T>A(rs235768) &BMP4 c.538 OT (rs 17563)
&TGF[alpha] (BamHI) & TGF[alpha] (Rsal) rs3732248              1.000
COPYRIGHT 2018 Avicenna Research Institute
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2018 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Original Article; Transforming growth factor alpha; Bone morphogenetic protein 2; Bone morphogenetic protein 4
Author:Samadi, Saba; Ebadifar, Asghar; Hamid Reza Khorshid, Khorram; Kamali, Koorosh; Badiee, Mohammadreza
Publication:Avicenna Journal of Medical Biotechnology (AJMB)
Article Type:Report
Geographic Code:7IRAN
Date:Oct 1, 2018
Words:3570
Previous Article:Association of G/C (rs638405) Polymorphism in [beta]-secretase Gene with Alzheimer's Disease.
Next Article:The Association of PON1192 Q/R Polymorphism with the Risk of Idiopathic Male Infertility in Northern Iran.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |