Printer Friendly

Inmunogenicidad de la proteina recombinante ASP1r de Ancylostoma caninum en un modelo murino.

IMMUNOGENICITY OF THE PROTEIN RECOMBINANT ASP1r OF A caninum IN A MURINE MODEL

INTRODUCCION

Ancylostoma spp, es un helminto redondo que se localiza en el intestino delgado de perros, y otros carnivoros silvestres. Dentro de esta familia se distinguen tres especies de importancia: A. braziliense, A. caninum y A. tubaeforme, los cuales se caracterizan por su hematofagia. A. caninum macho miden de 11 a 13 mm y la hembra de 14 a 20 mm (1).

Presentan un ciclo de vida directo, teniendo dos vias de entrada al hospedero: la mas frecuente es la ingestion de la larva ([L.sub.3]) encapsulada; la segunda en orden de importancia, es por penetracion a traves de la piel, tambien se transmiten por ingestion de [L.sub.3] presentes en la leche materna. Despues de ingresar, la [L.sub.3] se transporta rapidamente al intestino, por via sanguinea, ingresa a los pulmones y luego continua hacia la traquea.

El principal signo de la infeccion por los ancilostomidos es la anemia (1). En el humano y en el perro en la forma cronica se presenta emaciacion, perdida del apetito y debilitamiento. Tambien, se presenta diarrea ligera y heces oscuras, algunas veces tenidas con sangre. En infecciones masivas produce edema en las partes bajas del cuerpo y la piel de estas areas puede ulcerarse. En las ultimas etapas puede presentarse epistaxis y el indice de coagulacion sanguinea baja.

La reaccion intensa que manifiestan los animales a la superinfeccion consiste en hemorragias del intestino delgado, reaccion vesicular grave y, a veces, desprendimiento de tejido necrotico.

Las larvas infectivas L3 de A. caninum cuando se cultivan in vitro en condiciones favorables liberan dos proteinas secretorias ricas en cisteina (CRISPs), las cuales son conocidas como proteinas de secrecion/excrecion ASP-1 y ASP-2 (2,3). Por otro lado, estas larvas cuando son incubadas bajo condiciones de un probable hospedero en cultivos de tejido liberan continuamente ASP1 y ASP2 en cantidades pequenas, pero cuando este medio es suplementado con fracciones de suero del hospedero y analogos de glutation, la larva L3 experimenta un cambio fenotipico caracterizado por la adaptacion al medio (2-6).

Este fenomeno coincide con la liberacion de ASP1 Y ASP2, las cuales son moleculas predominantemente producidas por L3 in vitro (2,7). La larva L3 de A. caninum tambien libera menor cantidad de macromoleculas adicionales bajo esas condiciones incluyendo una metaloproteasa de zinc las cuales podrian ser utilizadas como posibles blancos terapeuticos (8,9).

La funcion de la ASPs de las larvas no estan bien definidas aunque, han sido descritas en otros nematodos, incluyendo parasitos de animales y plantas (4,10-11). Las ASPs exhiben propiedades angiogenicas que son importantes durante la transicion del estadio larval de forma libre en el suelo lo que facilita su ingreso al hospedero mamifero (2, 12) y posee homologia con regiones de aminoacidos de alergenos del veneno del reptil vestid (2-3), sugiriendo que estas ASP pueden tener un papel importante en la patogenesis de infecciones causadas por nematodos en animales y humanos (13). Sin embargo, esto puede ser dispuesto por la presencia de al menos 17 genes diferentes relacionados a ASPs encontrados en el nematodo de vida libre Caenorhabditis elegans (3), proponiendo que la familia de proteinas ASP cumplen un papel importante en la biologia y no en el parasitismo.

Las ASPs son de interes terapeutico por que tienen potencialidad como candidato vacunal contra infecciones por nematodos en humanos y animales (13,14). Ademas han demostrado ser inmunodominantes y por lo tanto son facilmente reconocidos por el sistema inmune de los rumiantes vacunados con ASPs y retados con larvas L3 (15,16). Las ASPs recombinantes de Larvas L3 y producidas naturalmente son antigenos efectivos para vacunas establecidos en modelos animales de laboratorio probados con L3 de A. caninum (17-19), Haemonchus contortus (20), Brugia Malawi (21) y Onchocerca volvulus (22). Similarmente, las ASPs aisladas de H. contortus adultos han demostrado ser altamente efectivos en la proteccion de ovejas contra infecciones (23-26).

Hasta el momento no hay reportes en la literatura de la utilizacion de vacunas de acidos nucleicos desnudos con los genes de las proteinas ASP1 de A. caninum, por ello, el objetivo del presente trabajo fue construir un sistema de expresion plasmidico recombinante con pcDNA3 para expresar la proteina ASP1 de A. caninum, evaluando su capacidad inmunogenica en un modelo murino

MATERIALES Y METODOS

Animales. Se utilizaron ratones Balb/c endocriados del bioterio de la Universidad Nacional de Colombia (Bogota) libres de infecciones por helmintos verificada por examen coprologico. Los ratones se mantuvieron en la unidad de experimentacion animal del CIBM-UQ, siguiendo las normas de utilizacion de animales de la convencion de Helsinki. En el estudio se utilizo un total de 16 ratones hembras de 20 gramos distribuidos en 3 grupos para los estudios de inmunizacion.

El proyecto y los procedimientos del mismo fueron aprobados por el comite de bioetica de la facultad de ciencias de la salud de la Universidad del Quindio.

Parasitos: Obtencion de larvas L3 y adultos de A. caninum y preparacion de productos de excrecion/secrecion. Las larvas L3 y adultos fueron obtenidos de intestinos delgado de perros sacrificados en el centro de zoonosis de la ciudad de Armenia dentro del programa de control de animales callejeros y/o terminales, siguiendo las normas estipuladas para estos procedimientos por la sociedad protectora de animales.

Los intestinos se transportaron al laboratorio en solucion salina esteril en una nevera a 4[grados]C, una vez en el laboratorio se disecaron y se tomaron las larvas de aquellos que estaban parasitados, despues se lavaron con PBS varias veces y fueron cultivadas en 1000 ml de RPMI 1640(Gibco, USA), suplementado con 25 mM HEPES, 100 U/ml de penicilina y 100 mg/ml de estreptomicina y se incubaron a 37[grados]C por 15 horas. Posteriormente se filtro la suspension en un filtro de policarbonato de 0.2 [micron]m. (Nucleopore.Inc, Cambridge, USA), finalmente la suspension se concentro por medio de evaporacion y se guardo igual que los ancylostomas a -70[grados]C hasta su uso.

Extraccion de ARN. La extraccion de ARN se realizo a partir de una suspension de larvas L3 y adultos de A. caninum las cuales se maceraron; la extraccion total del ARN de las L3 se realizo con el kit comercial de extraccion SV isolation Promega [R].

RT-PCR. A partir de ARN obtenido de larvas L3, se realizo el procedimiento de retrotranscripcion y PCR en un solo paso, mediante el kit comercial de Promega [R].

Las secuencias de iniciadores fueron las siguientes: ASP1:

Oligo 15'- GGGG BamH1GATCC ATGTTTTCTCCTGTAGTCGT -3' Ollgo 2 3'-GGGG Et-QR-IAATTC GACTGATTAAGGAGCGC-5' Ollgo 15'- GGGG BamH1GATCC ACTGTGCAATGGAACAGCAG -3 Ollgo 2 3'-GGGG EC0RIAAHC AGTAGCACCAGGCGAACACT -5'

Los Primers se disenaron utilizando el programa Primer-3 y genruner, usando la secuencia para aSp1 de A. caninum reportada en el Gen Bank (AF132291). Se utilizo la siguiente mezcla para un volumen final de 50 [micron]l: Tampon 10 X, dNTPs 100 [micron]M, 2.5 mM cloruro de magnesio, cebadores 0.2 [micron]M, 1U Taq polimerasa (Invitrogen,Carlsbad,Ca,USA). Con el siguiente ciclo termico: Un ciclo de 37[grados]C/50 min para Rt, predenaturacion 95[grados]C x 5 min y 35 ciclos de denaturacion 94[grados]C x 45 seg, templado 49[grados]C x 1 min, extension 72[grados]C x 1:30 min, y una extension final a 72[grados]C x 10 min.

Los productos de amplificacion se verificaron por electroforesis en gel de agarosa al 1% (p/v) tenido con 1 [micron]l de bromuro de etidio al 0.0004% (v/v) y visualizado en transiluminacion con luz ultravioleta. Se considero como amplificacion positivas para A. caninum la visualizacion de una unica banda de 1079 pb para ASP1.

Clonaje de los fragmentos amplificados usando el Plasmido pcDNA3. El clonaje del producto de RT-PCR de ASP1 se hizo directamente en el plasmido pcDNA3 (Invitrogen,Carlsbad,Ca,USA) con la enzima T4 ADN ligasa (Promega, Madison, WI, USA), realizando la reaccion con el plasmido y el inserto previamente digeridos con las enzimas de restriccion BamH1 (Promega, Madison, WI, USA) y ECOR1 (Promega, Madison, WI, USA), obteniendo un clonaje direccional con los dos fragmentos adherentes.

Transformacion de celulas de E. coli DH5a con plasmido-inserto. El crecimiento bacteriano de la cepa DH5 a de E. coli se realizo en medio LB (Oxoid,Lenexa,Ks,USA) sin ampicilina y posteriormente se trato con CaCl2 (Sigma,St.Louis,MO,USA) para obtener celulas competentes (27). Se realizo la transformacion y se incubo a 37[grados]C con agitacion por 1.5 horas, luego se sembraron 100 [micron]l de esta solucion con celulas en LB-agar (1.5%)- ampicilina a una concentracion de 50ug/ml (Invitrogen, Carlsbad,Ca,USA) y se incubo toda la noche a 37[grados]C.

Seleccion de las colonias de E. coli DH5a recombinantes y purificacion del plasmido recombinante. El primer tamizaje de las colonias se hizo mediante la presion de seleccion de la ampicilina presente en los platos de cultivo, se cultivaron en medio liquido LB-ampicilina a 37[grados]C y se realizo la purificacion de los plasmidos por lisis osmotica con [H.sub.2]0d y choque termico a 100[grados]C por 2 min, luego se procedio a centrifugar a 14.000 g por 1 min para recuperar el sobrenadante. A partir de esta purificacion se realizo un tamizaje secundario por PCR usando los cebadores con que se realizo la amplificacion primaria, buscando la presencia del gen de ASP1. Las colonias seleccionadas como positivas por PCR se repicaron a 15 ml de medio LB/ampicilina 50[micron]g/ml y se incubaron a 37[grados]C toda la noche, posteriormente se cosecho y se purifico el plasmido PcDNA3 con el inserto ASP1 mediante el metodo de lisis alcalina y limpieza con PEG 8000 (27).

La determinacion de la concentracion y pureza del ADN plasmidico se hizo mediante espectrofotometria a 260 y 280 nm. Posteriormente se procedio a eliminar las endotoxinas con el Kit removal endotoxin (Sigma, USA) siguiendo las especificaciones del fabricante.

Inmunizacion intramuscular e intraglandular de ratones (Balb/c endocriados) con pcDNA3-ASP1. 3 grupos de ratones de 20 gramos se inocularon en la glandula parotida y via intramuscular con 2 dosis a intervalos de 15 dias con 50 [micron]l de suspension de pcDNA3-ASP1(50[micron]g/ml) en solucion salina libre de pirogenos. Se formaron los grupos 1 inoculado intramuscular con pcDNA3-ASP1, grupo 2 intraglandular con pcDNA3-ASP1 y el grupo control con pcDNA3 resuspendido en solucion salina libre de pirogenos.

Obtencion de muestras de saliva y sangre de los ratones inmunizados. Previa a cada inoculacion se tomaron muestras de sangre asi: dias 1, 15, 30; se indujo la salivacion con pilocarpina 5% 40 [micron]l por raton. Despues de 5 min de inyectar intraperitonealmente la pilocarpina, se procedio a la obtencion de muestras de saliva con el objetivo de determinar la presencia de anticuerpos contra el antigeno de A. caninum mediante ELISA.

Determinacion de anticuerpos en sangre y saliva mediante ELISA de los animales inmunizados. Para determinar la presencia de anticuerpos murinos sericos y en saliva contra la proteina ASP1 de A. caninum se diseno la siguiente ELISA. Los pozos de placas maxisorp [TM] se recubrieron con 100 jl de solucion a 5 [micron]g/ml del antigeno en buffer de recubrimiento pH 9.6 (N[a.sub.2]C[O.sub.3]: 0.159 g/100 ml, NaHC[O.sub.3]:0.293 g/ 100 ml) se incubaron a 37[grados]C por 2 horas al cabo de las cuales se realizaron 3 lavados con PBS-Tween 20 (0.05% v/v), posteriormente se adicionaron 300 [micron]l de solucion de bloqueo con albumina serica bovina(Sigma,St.Louis,MO,USA) al 1% (p/v), al cabo de dos horas se lavo varias veces, luego se adicionaron 100 jl las muestras a una dilucion de 1:20 para la saliva y 1:50 para los sueros en PBS-tween 20 (0.05% v/v).

Se incubo la placa en camara humeda a 37[grados]C por 2 horas, luego se realizaron 3 lavados con PBS -Tween20 (0.05% v/v). Posteriormente se anadieron 100 [micron]l de solucion de conjugado anti-IgG de raton- fosfatasa alcalina (Sigma,St.Louis,MO,USA) para suero y anti- IgA raton-fostatasa alcalina (Sigma,St.Louis,MO,USA) a una dilucion 1:30.000 en PBS- tween 20. Se incubo a 37[grados]C por una hora, luego se realizaron 3 lavados con PBS-tween 20 y se adiciono 200 [micron]l por pozo de la solucion sustrato p-Nitrophenyl phosphate (pNPPSigma,St.Louis,MO,USA). La reaccion se detuvo a los 30 min con 25 [micron]l de NaOH 3N. Se leyo la reaccion a una longitud de onda de 410 nm con un lector de ELISA Dynatech 5000.

Inmunohistoquimica. Con el fin de determinar la especificidad de los anticuerpos desarrollados por los animales inmunizados con el plasmido recombinante, se realizo una prueba de inmunolocalizacion de los parasitos, para ello los Ancylostomas que fueron recuperados se fijaron con formaldehido al 10%, se incluyeron en bloques de parafina a partir de los cuales se realizaron cortes histologicos longitudinales con el microtomo. Primero se fijaron tres laminas con acetona, se realizaron lavados suaves, luego se sensibilizaron las laminas, dos con el anticuerpo primario (suero de ratones inmunizados con los plasmidos recombinantes) a una dilucion 1:10 en PBS-Tween20 y una con PBS-Tween20 (control negativo) y se incubo por 24 horas en camara humeda, despues se retiro el anticuerpo primario lavando 3 veces suavemente con PBS Tween20, posteriormente se aplico como anticuerpo secundario conjugado anti-IgG de raton-peroxidasa en una dilucion 1:30.000. Se incubo por 24 horas en camara humeda, se lavo 3 veces suavemente con PBS Tween20, la inmunoreaccion fue revelada con nitroblue tetrazolium (NBT) como substrato; se interrumpio la reaccion con agua corriente, por ultimo se deshidrato la lamina con alcohol al 70% y se aclaro con Xilol. Finalmente se procedio a observar en el microscopio optico.

RESULTADOS

Clonacion del gen de la proteina ASP1 de A. caninum en el plasmido PCDNA3. Se recuperaron plasmidos recombinantes que contenian el inserto del gen de la proteina ASP1 a partir de las bacterias E.coli DH5a competentes y transformadas con el plasmido, adquirieron la capacidad de ser resistentes a la ampicilina, lo que les permitio crecer en medio LB agar suplementado con 50 [micron]g/ml de ampicilina. Esto fue evidenciado mediante electroforesis en gel de agarosa al 1% coloreado con bromuro de etidio de los productos amplificados mediante PCR del ADN molde obtenido luego de la lisis osmotica de las colonias de E. coli DH5a transformadas obtenidas del LB-agar ampicilina y observado mediante transiluminador con luz ultravioleta (Figura 1,,A).

Al purificar los plasmidos por medio de lisis alcalina y limpieza con PEG 8000, se verifico por medio del gel de agarosa 1% (Figura 1B). La concentracion final del ADN plasmidico obtenida fue de 700 [micron]g/ml cuantificado por espectrofotometria a 260nm/280nm. A partir de esta concentracion de ADN plasmidico, y despues de remover las endotoxinas, las concentraciones finales de ADN plasmidico se midieron nuevamente, se ajusto la solucion a una concentracion de 50 [micron]g/ml y se inocularon los ratones.

Reactogenicidad de los animales inmunizados. Los animales que se inmunizaron con los diferentes esquemas utilizados hasta el dia 30 de observacion presentaron en buen estado de salud aparente. No se presento ninguna muerte luego de la inmunizacion, ni se observaron efectos adversos durante el seguimiento.

Resultados de anticuerpos anti A. caninum en ratones Balb/c. Los valores de anticuerpos determinados mediante la tecnica ELISA, mostraron valores de absorbancia para IgG anti- A. caninum en los animales preinmunizados que oscilaron entre 0.059 y 0.077; mientras la cuantificacion en los sueros de los mismos animales despues de la inmunizacion muestra claramente un incremento muy marcado de los ratones que se inmunizaron con pcDNA3-ASP1r utilizando cualquiera de las dos vias de inmunizacion intramuscular o intraglandular comparados con los sueros de ratones sanos (Figuras 2A), tambien se encontro una diferencia estadisticamente significativa entre los dias de inoculacion con una p = 0.0018, indicando que los refuerzos son importantes para obtener un fuerte respuesta inmune, pero no se presentaron diferencias estadisticamente significativas entre las vias de inoculacion (Figura 2B, C y 3).

[FIGURA 1 OMITIR]

No fue posible detectar anticuerpos tipo IgA secretorios en saliva Anti- A. caninum en los animales preinmunizados debido a la escasa cantidad de saliva que se obtuvo.

Inmunohistoquimica. La interpretacion de la inmunoreaccion de marcaje tisular, fue considerada positiva cuando se presento un color marron en el tejido, indicativa de la expresion de la proteina ASP1, en este estudio correspondio hasta el 100% y en el control negativo se obtuvo un color rosa lo que corresponde a una ausencia de expresion. La inmunoreactividad fue claramente identificada al microscopio optico (Figura 3).

[FIGURA 2 OMITIR]

[FIGURA 3 OMITIR]

DISCUSION

A. caninum es un parasito que tiene una amplia distribucion mundial, tiene un ciclo de vida directo y no tiene hospedero intermediario, posee una proteina llamada ASP1 que es liberada durante la infeccion del hospedero. Esta molecula juega un papel importante en el establecimiento de la invasion, se expone directamente al sistema inmune del hospedero y puede inducir inmunidad protectora.

La proteina de excrecion/secrecion ASP1 es predominante, bajo la activacion in vitro en condiciones similares a las que existen en el hospedero, la cual presenta un peso molecular de 42kDa, esta desempena un papel importante en la patogenesis de infecciones causadas por helmintos en animales y humanos (8).

En trabajos realizados con proteinas recombinantes de A. caninum y su utilizacion como vacuna en ratones, han demostrado dificultades debido a los problemas en probar este candidato en modelos murinos ya que el estado infectivo de A. caninum no se desarrolla en este hospedero y por lo tanto no se puede realizar un reto con larvas infectivas L3 (28). Por esta razon muchos investigadores consideran que este modelo para A. caninum no es fisiologico, en cambio la prueba preclinica del candidato requiere la vacunacion de perros antes de hacer un reto (29).

Estudios realizados en ratones BALB/c al ser inmunizados con Ac-asp-1 recombinante precipitada con sal de aluminio obtuvieron una proteccion de 58% y 72%, pero no midieron los niveles de anticuerpos de los animales inmunizados que pudieran ser comparados con lo obtenido en el presente estudio (30).

Otros trabajos se han realizado utilizando proteinas de excrecion/secrecion de Ancylostoma sp como posible candidato vacunal, se han medido los efectos de la combinacion de antigenos ASP2 y la metaloproteasa 1 en hamsters infectados y enfermos con Ancylostoma ceylanicum, estas fueron clonadas y expresadas en Pichia pastoris y cuando se inmunizaron animales con esta proteina se encontraron altos titulos de IgG para ASP-2 (1:62,850) y anti MTP1 (1:151,356) los cuales disminuyeron a traves del tiempo. La combinacion de estos dos antigenos no presentaron efectos significativos, pero si presentaron proteccion en la reduccion de la carga parasitaria y mejoraron perceptiblemente los parametros clinico-patologicos asociados a enfermedad aumentando valores de la hemoglobina y pesos corporales en hamsters infectados (31).

En este estudio se encontro que la concentracion de anticuerpos de tipo IgG aumento desde la primera inmunizacion, gracias a que el plasmido persistio en el tiempo. Esto se pudo confirmar por medio de ensayos ELISA anti-ASP-1 realizados en los dias 0, 10 y 20 postinmunizacion. Por otro lado, se utilizo la tecnica de inmunohistoquimica para confirmar que ASP-1 se encuentra localizada en el intestino del adulto de A caninum. Un trabajo similar fue realizado por Zhan et al (9) utilizando como blanco una glutation S-tranferasa (AcGST-1), y por medio de inmunolocalizacion y ELISA confirmaron que Ac-GST-1 se localiza en la hipodermis, tejido muscular e intestino de adultos de A. caninum (32). Lo anterior permite concluir que por medio de la utilizacion de la inmunohistoquimica, que tiene el mismo principio de la inmunolocalizacion, para determinar la ubicacion de la ASP-1 en el nematodo reconocida por los anticuerpos desarrollados durante la inmunizacion con el plasmido recombinante lo que muestra la especificidad de la respuesta suscitada por la proteina expresada por el plasmido inoculado por via intramuscular e intraglandular en el modelo murino.

En este trabajo se obtuvo un plasmido pcDNA3-ASP1 que no presento reacciones desfavorables en ratones BALB/c al ser administrado por via intraglandular e intramuscular, ademas se indujo una respuesta de tipo humoral contra la proteina de excrecion/secrecion ASP1 de A. caninum.

El plasmido persistio en el tiempo y la respuesta del sistema inmune mejoro con el refuerzo de la inmunizacion, lo que permitio la localizacion del antigeno y su fuerte reconocimiento por los anticuerpos producidos mediante la inmunizacion con el plasmido.

En conclusion, se demostro que la utilizacion de pcDNA3-ASP1 no produjo reacciones desfavorables en ratones BALB/C y concomitantemente indujo respuesta humoral contra la proteina pcDNA3-ASP1 de excrecion/ secrecion de ancylostoma caninum en ratones.

Con la obtencion de estos resultados se pretendera probar el plasmido recombinante en un modelo canino y de igual manera saber si se genera una respuesta inmune que permita obtener un nuevo candidato a vacuna.

REFERENCIAS

(1.) Cordero Del Campillo, M et al. Parasitologia veterinaria. Madrid, Espana; McGraw-Hill: 2000.

(2.) Hawdon JM, Hotez PJ.Hookwoorm: developmental biology of the infectious process. Curr Opin Gen Surg 1996; 6:618-23.

(3.) Hawdow JM, Narasimhan S, Hotez PJ. Ancylostoma secreted protein 2: Cloning and characterization of a second member of a family of nematode secreted proteins from Ancylostoma caninum. Mol Biochem parasitol 1999; 99:149-65.

(4.) Hawdon JM, Schad GA.Serum stimulated feeding in vitro by 3 stage infective larvae of canine hookworm Ancylostoma caninum. J Parasitol 1990;76:394-8.

(5.) Hawdon JM, Jones BF, and Hotez PJ.. Cloning and characterization of a cDNA encoding the catalytic subunit ofa c AMP-dependient protein kinase from Ancylostoma caninum third-stage infective larvae. Mol Biochem Parasitol 1995;69 :127-30.

(6.) Hawdom JM, Jones BF, Perre gaux MA, Hotez PJ. Ancylostoma caninum metaloprotease release coincides with activation of infective larvae in vitro. Exp Parasitol 1995;80: 2005-11.

(7.) Zhan B, Hawdon J, Shan Q, Ren HN, Quiang HQ, Hu W, et al. Ancylostoma secreted protein 1 (ASP-1) homologues in human hook worms. Mol Biochem Parasitol 1999; 98:143-9.

(8.) Hawdow JM, Jones Bf, Hoffman DR, Hotez PJ. Cloning and characterization of Ancylostoma secreted protein: a novel protein associated with the transition to parasitism by infective hookworm larvae. J Biol Chem 1996;271:6672-8.

(9.) Zhan B, Hotez PJ, Wang Y, Hawdon J. A developmental^ regulated metalloproteasa secreted by host-stimulated Ancylostoma caninum third- stage infective larvae is a member of the astacin family of proteases. Mol Biochem Parasitol 2002; 120: 291-6.

(10.) Ding X, Shields J, Allen R, Hussey RSMolecular cloning and caracterization of a vemon allergen AG5- like cDNA from Meloidogyne incognita. Int J Parasitol 2000; 30: 77-81.

(11.) Gao B, Allen R, Maier T, Davis EL, Braum TJ, Hussey RS. Molecular characterization and expression of two venom allergen-like protein genes in Heterodera glycines. Int Parasitol 2001; 31: 1617-25.

(12.) Tawe W, Pearlman E, Unnasch TR, Lustigman SAngiogenic activity of Onchocerca volvulus recombinant proteins similar to vespid venom antigen 5. Mol Biochem Parasitol 2000; 109:91-9.

(13.) Hotez PJ, Ghosh K, Hawdon JM, Narasimhan S, Jones B, Xiao SH, et alExperimental approaches to the development of a recombinant hookworm vaccine. Immunol Rev 1999; 171: 163-71.

(14.) Hotez PJ, Zhan B, Bethony J M, Loukas A, Williamson A, Goud G N, et al. Progress in the development of a recombinant vaccine for human hookworm disease: the Human Hookworm Vaccine Initiative. Int J Parasitol 2003; 33:1245-58.

(15.) Schalling H, Va Leewen M, Verstrepen B, Cornelissen A. Molecular characterization and expression of two putative protective excretory secretory proteins of Haemonchus contortus. Mol Biochem Parasitol 1997; 88:203-13.

(16.) De Maere V, Vercauteren I, Saverwyns H, Claerebout E, Bern G, Vercruysse J. Identification of potential protective antigens of Ostertagia ostertagi with local antibody probes. Parasitology 2002;125: 383-91.

(17.) Ghosh K, Hawdon J, Hopez P. Vaccinacion with alum-precipitated recombinant Ancylostoma secreted protein 1 protects mice against challenge infeccion with infective hookworm (Ancylostoma caninum) larvae. J Infect Dis 1996;174: 1380-3.

(18.) Ghosh K, Hopez JP. Antibody- dependent reduccion in mouse hookworm burden after vaccination with Ancylostoma caninum secreted protein 1 (Ac- ASP-1). J Infect Dis 1999; 180: 1674-81.

(19.) Liu S, Gosh K; Zhan B, Shan Q, Thompson MG, Hawdon J, et al. Hookworm burden reductions in Balb/c mice vaccinated with Ancylostoma secreted protein 1 (ASP-1) from Ancylostoma duodenale, A. caninum and Necator americanus. Vaccine 2000;18: 1096-02.

(20.) Sharp PJ, Wagland BM, inventors. Nematode vaccine.US Patent 5 734 035, 1998 March 31.

(21.) Murray J, Gregory WF, Gomez- Escobar N, Atmadja AK, Maizels RM. Expression and immune recognition of Brugia malayi VAL1, a homologue of vespid venom allergens and Ancylostoma secreted proteins. Mol Biochem Parasitol 2001;118: 89-96.

(22.) Lustigman S, James ER, Tawe W, Abraham D. Towards a recombinant antigen vaccine against Onchocerca volvulus. Trends Parasitol 2002; 18:135-41.

(23.) Sharp PJ, Wagland BM (Biotech Australia and CSIRO). Nematode Vaccine. International Patent Application Number PCT/AU92/00041. International Publication Number WO 92/13890.

(24.) Schalling H, Va Leewen M, Hendrikx W. Immune responses of sheep to excretory/ secretory products of adult Haemonchus contontus. Parasitol 1994; 108:351-7.

(25.) Schallig H, Van Leeuwen M.Protective immunity to the blood-feeding nematode Haemonchus contortus induced by vaccination with parasite low molecular weight antigens. Parasitology 1997; 114:293-99.

(26.) Kooyman F, Schallig H, Van Leewen M, Mackellar A, Huntley JF, Cornelissen A, et al. Protection in lambs vaccinated with Haemonchus contortus antigens is age related, and correlated, with IgE rather than IgG1 antibody. Parasite Immunol 2000; 22:13-20.

(27.) Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual 3a edition, Vol. 1, 2 and 3. USA: Cold Spring Harbor Laboratory Press; 2001.

(28.) Kerr KB. Studies on acquired immunity to the dog hookworm Ancylostoma caninum. Am J Hyg 1936; 23:381-406.

(29.) Miller TA. Immunity to hookworm. In: Souls by EJL. ed, Immune responses in parasitic infections: immunology, immunopathology and immunoprophylaxis, Vol I, Nematodes, Boca Raton, FL: CRC Press; 1981.

(30.) Sen L, Ghosh K, Bin Z, Qiang S, Thompson M, Hawdon J, et al. Hookworm burden reductions in BALB/c mice vaccinated with recombinant Ancylostoma secreted proteins (ASPs) from Ancylostoma duodenale, Ancylostoma caninum and Necator americanus. Vaccine 2000; 18:1096-1102.

(31.) Mendez S, Zhan B, Goud G, Ghosh K, Dobardzic A, Wu W, et al. Effect of combining the larval antigens Ancylostoma secreted protein 2 (ASP-2) and metalloprotease 1 (MTP-1) in protecting hamsters against hookworm infection and disease caused by Ancylostoma ceylanicum. Vaccine 2005;23: 3123-30.

(32.) Zhan B, Liu S, Perally S, Xue J, Fujiwara R, Brophy P et al. Biochemical Characterization and Vaccine Potential of a Heme Binding Glutathione Transferase from the Adult Hookworm Ancylostoma caninum. Infect immun 2005; 75:6903-6911.

Maria Giraldo G, M.Sc, Jhon C Castano O, Ph.D.

Universidad del Quindio, Facultad Ciencias de la Salud, Grupo de Inmunologia Molecular, Armenia, Quindio, Colombia. Correspondencia: gymol@uniquindio.edu.co

Recibido: Mayo 15 de 2009; Aceptado: Agosto 19 de 2009
COPYRIGHT 2009 Universidad de Cordoba
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2009 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:ORIGINAL
Author:Giraldo G., Maria; Castano O., Jhon C.
Publication:Revista MVZ (Medicina Veterinaria y Zootecnia)
Article Type:Report
Date:May 1, 2009
Words:4854
Previous Article:Estilos modernos de vida, cambio climatico y ecosistemas alterados: un desastre anunciado para el surgimiento de las enfermedades infecciosas.
Next Article:Resistencia a antibioticos de bacterias aisladas de biopeliculas en una planta de alimentos.
Topics:

Terms of use | Privacy policy | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters