Printer Friendly

Inhibition of SbABI5 Expression in Roots by Ultra-high Endogenous ABA Accumulation Results in Sorghum Sensitivity to Salt Stress.

Byline: Lu Sun, Che Wang, Yu-Fei Zhou, Yan Ye Ruan, Xue Gong, Jing Zhang and Rui Dong Huang

Abstract

In this study, we firstly investigated the germination rate, growth and dry weight of shoots and roots in two sorghum cultivars, Liaoza15 and Longza11, to analysis the physiological responses of sorghum to salt and ABA. We found that Liaoza15 had high salt and ABA tolerance, but Longza11 was hypersensitive to salt and ABA stress during germination and early seedling growth. Secondly, we found that salt-induced ABA accumulation was higher and more sustained in Longza11 than in Liaoza15. Nextly, we analyzed the salt-induced expression of SbABIs in the two sorghum cultivars and AtABIs in wild type Arabidopsis.

The result showed that the change in SbABI5 expression in the roots was the most obvious difference between the two cultivars, namely salt did not induce SbABI5 in the roots of Longza11 but increased it by about 3-fold in the roots of Liaoza15. And the salt treatments also increased the expression of AtABI5 in the roots, suggesting changes of SbABI5 expression in the roots is a key step in the ABA signaling pathway to improve salt tolerance in sorghum. Finally, we found that the expression of SbABI5 was strongly induced by relatively low concentrations of ABA rather than by extremely high concentrations of ABA.

Keywords: Salt stress; Sorghum; Abscisic acid; Roots; SbABI5; Ultra-high endogenous ABA

Introduction

Salt is a significant soil component and stressor that limits plant growth and crop productivity in agricultural fields worldwide (Zhu, 2002; Chinnusamy et al., 2005). Substantial research efforts have been devoted to understanding the mechanisms of salt tolerance in plants (Brocard et al., 2002; Jia et al., 2002; Nishiyama et al., 2011; Gurmani et al., 2014). Abscisic acid (ABA) is a signaling molecule that mediates the responses to salt stress (Knight and Knight, 2001; Nishiyama et al., 2011), and is considered a vital signal of salt tolerance because of its rapid biosynthesis and significant accumulation in plant cells upon exposure to salt stress conditions. Plant roots are the first tissues to sense soil stress, and are the main sites of ABA biosynthesis (Chinnusamy et al., 2005). Many studies have shown that environmental signals stimulate ABA biosynthesis in the roots, which is translocated to the shoot (Laurie et al., 2002; Chinnusamy et al., 2005; Rus et al., 2001).

Many genes are involved in ABA-mediated salt tolerance in plants, including ABIs (ABA-insensitive) (Lopez-Molina et al., 2001; Finkelstein et al., 2002; Nambara et al., 2002; Gong et al., 2015), and ABFs (ABA Responsive Element Binding Factor) (Choi et al., 2000). The ABIs are divided into two major classes according to their biochemical functions: protein phosphatases (ABI1 and ABI2) and transcription factors (ABI3/VP1, ABI4, and ABI5) (Giraudat et al., 1992; Leung et al., 1994; Meyer et al., 1994; Leung et al., 1997; Finkelstein et al., 1998; Rodriguez et al., 1998; Hu and Yu, 2014). ABI1 and ABI2 encode two homologous serine/threonine phosphatases of class 2C and are highly homologous to one another. ABI3, ABI4 and ABI5 are members of the B3, APETALA2- (AP2) and basic leucine zipper- (bZIP) domain families, respective (Giraudat et al., 1992; Finkelstein et al., 1998; Finkelstein et al., 2000; Lopez-Molina et al., 2000).

It has been found that AtABIs are involved in Arabidopsis salt stress response. For example, the mutants of ABI1, ABI2 ABI4 are sensitivity to salt stress in Arabidopsis. AtABI5 is induced salt stress in Arabidopsis (Quesada et al., 2000; Brocard et al., 2002; Ohta et al., 2003). Some salt-tolerance regulation factors affect level of AtABI3 transcripts (Bu et al., 2009; Li et al., 2013).

Sorghum (Sorghum bicolor) is one of the most important cereal crops in the world and is a major source of human food, animal feed, and biofuel feedstock (Bafeel 2014; Ngara and Ndimba, 2014). Many studies have attempted to unravel the complex physiological mechanisms of salt stress tolerance in sorghum, and have implicated increasing Ca2+ concentrations (Bernstein et al., 1993), osmotic adjustment (Richardson and McCree, 1985; Anjaneyulu et al., 2014), and chromosome endoreduplication (Ceccarelli et al., 2006) as contributing processes.

Some studies have demonstrated the involvement of the ABA mechanism in sorghum salt tolerance. For example, Monreal et al. (2007) showed that salt stress strongly enhances the activity of phosphoenolpyruvate carboxylase kinase (PEPCK), which is known to be controlled by ABA in sorghum leaves. Salt- and ABA-treatments were shown to cause up-regulation of mRNA encoding the glycine-rich RNA-binding protein, which is known to be modulated in sorghum by the light signal (Aneeta et al., 2002). The differential gene expression profile was monitored in Sorghum bicolor following exposure of seedlings to high salinity, osmotic stress, or ABA; the findings indicated that 89 genes were induced greater than 2-fold in the shoots and 84 genes were induced greater than 2-fold in the roots by salt and ABA treatments (Buchanan et al., 2005).

Thus, there is a large extent of overlap in gene expression response to salt and ABA treatments. Although those studies have indicated that sorghum salt tolerance is dependent upon the ABA signaling pathway, there is a lack of molecular evidence linking ABA signal with sorghum in response to salt stress.

We predict that ABIs may play an important role in sorghum salt stress tolerance. Thus, we identified two sorghum cultivars (Liaoza15 and Longza11), which are obviously different in salt tolerance from 50 different sorghum cultivars from Northeast China. In this study, we analyzed the responses to salt and ABA during germination and young seedling growth of Liaoza15 and Longza11.

Then, we examined the ABA accumulation and expression of ABI genes in the two cultivars under salt stress conditions. Our results explore that SbABIs expression is related with ABA content for salt tolerance in sorghum, and SbABI5 expression is a key step in the ABA signaling pathway for salt tolerance in sorghum, which can be inhibited by ultra-high ABA level.

Materials and Methods

Plant Materials and Growth Conditions

Seeds of the sorghum hybrid cultivars Liaoza15 (LA- 17xLR9198) and Longza11 (403AxHahui576) were obtained from the Liaoning Academy of Agricultural Sciences and the Heilongjiang Academy of Agricultural Sciences, respectively (Liu et al., 2010; 2011). The two sorghum cultivars had been characterized as having obviously different salt tolerances by examining the salt tolerance of 50 different sorghum cultivars from Northeast China (data not shown). Sorghum seeds were sown in Petri dishes under controlled conditions, and grown in a growth chamber at 28oC with 16 h light/8 h dark cycles to examine the germination rates. The sorghum seeds were germinated for 4 d then were transplanted to fresh plates for experimental treatments and to examine shoot length, root length, shoot dry weight, and root dry weight. Seedlings were photographed using a digital camera (Cyber-shot DSC-S85; Sony, Japan).

Salt and ABA treatments

Two NaCl and four ABA treatments of sorghum (sorghum bicolor (L.)) seeds and seedlings were conducted (Table 1). For the purpose of measuring germination rates of two sorghum hybrid cultivars under salt stress and ABA treatments, sorghum seeds were sown in Petri dishes for a total of 4 d, 6 d, and 8 d. To investigate shoot length, root length, shoot dry weight, and root dry weight, sorghum seeds were germinated for 3 d, then were transferred to fresh plates for different treatments lasting 3 d and 5 d each. At least 20 seedlings were observed for each experiment, and three replications were conducted for each experiment. Statistical analyses of the numerical data were conducted by Microsoft Excel 2003 and SPSS statistical software 13.0 (SPSS Inc.).* and ** indicates significant differences in comparison to WT at Pless than 0.05 and Pless than 0.01, respectively (Student's t-test).

ABA Analysis

After salt-inducement treatments, the samples were immediately frozen in liquid nitrogen and homogenized at ice-cold temperature. The homogenates were centrifuged for 15 min at 3000 g, and the supernatants were used for the ABA assay. ABA analyses were carried out using the competitive ELISA method described by Chen et al. (2006) and Lu et al. (2007). The antigens and IgG-horseradish peroxidase used in the ELISAs were purchased from the Phytohormones Research Institute at China Agricultural University. The experiments were repeated at least 3 times with similar results. Statistical analyses of the numerical data were conducted by Microsoft Excel 2003 and SPSS statistical software 13.0 (SPSS Inc.).* and ** indicates significant differences in comparison to WT at Pless than 0.05 and Pless than 0.01, respectively (Student's t-test).

Quantitation of Gene Expression by RT-PCR

To assay the expression levels of of SbABI1, SbABI3, SbABI4, SbABI5 and SbRAB28 genes after stress, 14-d seedlings were treated with 200 mM NaCl. Seedlings grown at 22C and treated with distilled water were used as control.

Equal amounts of leaves and roots were sampled at 0-, 3-, 6- and 12-h time points. Total RNA was extracted with the RNasy plant mini kit (Qiagen) supplemented with an on-column DNA digestion (Qiagen RNase-Free DNase set), according to the manufacturer's instructions. Total RNA (3 uL) was reverse transcribed and subjected to the RT reaction with the Superscript II RT kit (Invitrogen) in a 25 uL reaction volume at 42C for 1 h. Real-time PCR reactions were performed with gene-specific primers for genes (Table 1). Expression levels of the actin gene (Table 1) served as an internal control. The real-time PCR was conducted using SYBR Premix Ex TaqTM(TaKaRa) with 1 uL of cDNA in a 10 uL reaction volume.

The amplification program was as follows:

1 cycle of 95C for 30 s; and 40 cycles of 95C for 15 s, 60C for 30 s and 72C for 30 s.

At least 3 technical replicates were performed for each experiment. The expression of genes in untreated wild type at 22C was used as control. Since there were no significant differences among the time intervals in untreated wild type, we chose 0 h for data normalization as suggested by manufacture's guide (Applied Biosystems guide for real- time qPCR). The experiments were repeated at least 3 times with similar results. Statistical analyses of the numerical data were conducted by Microsoft Excel 2003 and SPSS statistical software 13.0 (SPSS Inc.).* and ** indicates significant differences in comparison to WT at Pless than 0.05 and Pless than 0.01, respectively (Student's t-test).

The expression of all genes in Arabidopsis under control conditions and salt treatments were downloaded from the publicly available microarray data set in the AtGenExpress expression atlas (http://weigelworld.org/resources/microarray/AtGenExpress) (Schmid et al., 2005). The expression of AtABIs under control and salt treatments were extracted from the data set and used to calculate the ratio of gene expression in control to salt stress conditions in order to identify the expression change of AtABIs under salt stresses.

Results

Phenotype of Two Sorghum Cultivars under Salt Stress

First, germination of the two cultivars was examined under salt stress. After the length of the radicels equals to the length of seeds, and the length of embryos equal to 1/2 length of seeds, the germination process of sorghum seeds are completed. The result showed that germination of the two cultivars was completed within 4 d and showed no significant differences under the control condition (Fig. 1). However, germination under salt stress was significantly different in Liaoza15 and Longza11, the germination process are delayed in salt treated Liaoza15 and Longza11 (Fig. 1). Beside of this, the germination rate of Liaoza15 was obvious higher than Longza11 in both 150 mM and 200mM treatment of NaCl (Fig. 1A). These results indicated that the salt treatments altered the sorhum seed germination, and Longza11is sensitivity to salt stress in seed germination.

Table 1: Experimental treatments

Group No.###Treatments

1###Control (distilled water treatment)

2###150 mmol l-1 NaCl

3###200 mmol l-1 NaCl

4###1 mmol l-1 ABA

5###5 mmol l-1 ABA

6###10 mmol l-1 ABA

7###20 mmol l-1 ABA

Table 2: Sequences of primers used in this work for gene expression determination by real-time PCR after reverse transcription

Gene name###Forward###Reverse

SbABI1###cgaatgaagaggcatgcaaa###tgcgacaccattgttcttgtg

SbABI3###acatcgaccagatcctcgac###ccagaacgggtttgtgttga

SbABI4###gatcagcacgacgcttcttaatt###aaacttcaaaccgaccaagca

SbABI5###gcagcagacaatgctgtttcc###gcagcggaggcaccaa

SbRAB28###gagaggcacacccaaatctc###cctctggctcattgtcaagc

SbActin###gccgtcctctctctgtatgc###cgagcttctccttcatgt

Moreover, we observed the growth of young seedlings of the two sorghum cultivars under salt stress. The results showed that under the control condition, the shoots were longer and the roots were shorter in Liaoza15 than in Longza11 (Fig. 2A-C).

Under the salt condition, the growth of roots and shoots were obviously inhibited in both cultivars, the shoots and roots of Longza11 were both shorter than Liaoza15 (Fig. 2A-C). The dry weights of the roots and the shoots of both cultivars were obviously reduced under salt stress, compared with those of the control condition, and were higher in Liaoza15 than in Longza11 under the control and salt treatments (Fig. 2D, E), suggesting Longza11 is sensitivity to salt stress in seedling growth. The results state that compared with Liaoza15, Longza11 is hypersensitivity to salt stress.

Phenotypes of Sorghum Cultivars under Exogenously- applied ABA

To indicate the relationship between salt sensitivity of the two sorghum cultivars and ABA signaling pathway, we examined phenotypes of the two sorghum cultivars under exogenously-applied ABA. The result showed that the germination rates of both cultivars decreased gradually following the concentrations exposed to ABA, but the reduction was consistently more significant in Longza11 than in Liaoza15 (Fig. 3A). Similarly, the lengths and the dry weights of the roots and the shoots of the two cultivars decreased gradually following the concentrations exposed to ABA, and decreased more significantly in Longza11 than in Liaoza15 (Fig. 3B-E). Under the control condition, the roots of Liaoza15 were shorter than those of Longza11, whereas under the ABA treatment conditions, the roots of Liaoza15 were longer than those of Longza11 (Fig. 3C). These results indicated that Liaoza15 has a higher tolerance and Longza11 has a hypersensitivity to ABA.

Phenotypes of Sorghum Cultivars under Salt and Exogenously-applied ABA

We also examined phenotypes and ABA accumulation in the two sorghum cultivars under salt stress and exogenously applied ABA. The result showed that the germination rates of both cultivars decreased in the conditions treated with salt stress and additional ABA, compared with treatments with salt stress. However, the reduction was consistently more significant in Longza11 than in Liaoza15 (Fig. 4A). Similarly, the lengths and the dry weights of the roots and the shoots of the two cultivars decreased under the treatments with salt and ABA, compared with only salt stress, and decreased more significantly in Longza11 than in Liaoza15 (Fig. 4B). These results further indicated that Liaoza15 has a higher tolerance and Longza11 has a hypersensitivity to ABA.

ABA Accumulation in Sorghum Cultivars under Salt Stress and Exogenously-applied ABA

Then, we examined ABA accumulation in the two sorghum cultivars under salt stress. The results showed that ABA content in the roots and shoots showed not significant differences between the two cultivars under the control condition. But under salt stress, the salt-induced ABA accumulation was obvious and that the highest ABA accumulation occurred in the 6 h treatments of both cultivars (Fig. 5A, B). Beside of this, the ABA accumulation was higher in Longza11 than in Liaoza15 (Fig. 5A, B). The ABA content after 24 h treatment was still obvious more than that of 0 h treatment in Longza11 but were not significant different after 12 h of treatment in Liaoza15 (Fig. 5A, B). In addition, the ABA accumulation was also higher in Longza11 than in Liaoza15 (Fig. 5A, B) under salt stress treatments and under salt and applied ABA treatments. The result state that compared with Liaoza15, Longza11 has a much higher ABA accumulation, which should the main reason of the ABA sensitivity of Longza11.

Expression of ABA-regulated Genes in Sorghum Cultivars and Arabidopsis under Salt Stress and Exogenously-applied ABA

We next tested the expression of the following ABA- inducible genes in the two sorghum cultivars: SbABI1, SbABI3, SbABI4, SbABI5 and SbRAB28. The results showed that under salt stress, SbABI1 was induced in the shoots and roots in tow cultivars, and the expression of SbABI3 and SbABI4, only except SbABI4 expression in Longza11 in the 3 h treatment, decreased in the shoots and roots in tow cultivars. SbABI5 showed no significant change in the shoots for any salt stress condition. However, salt did not induce SbABI5 in the roots of Longza11 but increased it by about 3-fold in the roots of Liaoza15 (Fig. 6I). SbRAB28 increased at 3 h and 6 h in the shoots of Longza11 and Liaoza15, respectively (Fig. 6J) and it highly induced in the roots by salt treatments. The expression of SbRAB28 had more increase in the roots of Liaoza15 than in that of Longza11. The similar pattern of the expression of the genes was found under salt stress and applied ABA.

The results indicate that the expression of SbABI5 and SbRAB28 in the roots is obvious difference between the two cultivars, suggesting the two gene responses in the roots are the key step to cause the two sorghum cultivars in response to salt and ABA treatments. For further prove whether the expression of ABI5 affects plant salt tolerance, we also analyzed the salt-induced expression of AtABIs in Arabidopsis using the AtGenExpress visualization tool. Results showed that the salt treatments increased the expression of AtABI1, AtABI2, and AtABI5 (Fig. 7A, B). In addition, the salt-induced expression of AtABI5 was higher in the roots than in the shoots (Fig. 7A, B). The expression of AtABI3 and AtABI4 showed no obvious change under any of the salt stress conditions (Fig. 7A, B). The result further states that ABI5 are a key responsive gene in plant salt tolerance.

Expression of SbABI5 in the Roots of Sorghum Cultivars under Exogenously-applied ABA

To definite the relationship between expression of SbABI5 in the roots and the ABA accumulation in the two sorghum cultivars, we analyzed that the expression of SbABI5 in the roots of two sorghum cultivars under different concentration of exogenous ABA treatments. The results showed that low concentration of ABA strongly induced expression of the SbABI5 gene in the roots of the two cultivars (Fig. 8). Treatment with high concentration of ABA led to no obvious accumulation of SbABI5 transcript at any of the times (Fig. 8). The results indicate that salt did not induce SbABI5 in the roots of Longza11 is produced by the high endogenous ABA level. Thus appropriate ABA accumulation induces the expression of SbABI5 in the roots to enhance sorghum salt tolerance. On the contrary, ultra-high ABA accumulation inhibits the expression of SbABI5 in the roots, resulting in sorghum sensitivity to salt stress (Fig. 9).

Discussion

In this study, we used two sorghum cultivars, which have different salt-tolerances, to evaluate their physiological responses to ABA and differential expression of ABIs induced by salt stress. The results showed that Liaoza15 has high salt and ABA tolerance and Longza11 is hypersensitive to salt and ABA stress during germination and early seedling growth (Fig. 1, 2 and 3). In addition, obvious differences in ABA content and ABA-related gene expression were observed in both of the two cultivars (Fig. 4 and 5). Plants under salt stress are known to rely on at least two signal transduction pathways: ABA-independent and ABA-dependent (Knight and Knight, 2001; Kim et al., 2003). Thus, the two sorghum cultivars generated salt-tolerance mechanisms through an ABA-dependent signal transduction process.

We compared the initial and overall salt-induced ABA accumulation in the two cultivars and found that the most significant difference was that ABA accumulation was ultra-high in the salt-sensitive cultivar Longza11 (Fig. 4). Although less information is available for the negative response mechanism. Pandey et al. (2005) found that the Arabidopsis ABR1 mutant was sensitive to salt and ABA and that norflurazon (NF, an inhibitor for ABA biosynthesis) restored the germination rate of the mutant seeds, which was obviously decreased by NaCl. These findings suggested that the main reason for mutant sensitivity to salt and ABA was high or/and sustained ABA accumulation. Thus, we believe that ultra-high and sustained ABA accumulation is the main reason for sorghum sensitivity to salt and ABA and that instantaneous and appropriate ABA accumulation may be a more effective response mechanism of salt stress tolerance in sorghum.

Many studies have shown that ABI proteins are both required and sufficient for ABA signaling, and that some ABIs are involved in ABA-mediated salt stress tolerance in plants (Uno et al., 2000; Brocard et al., 2002). For example, the plants carrying ABI4 mutant alleles display increased tolerance to osmotic and salt stress during germination and early seedling growth and ABI5 expression is induced by salt treatments (Quesada et al., 2000; Uno et al., 2000; Brocard et al., 2002; Reeves et al., 2011). In the current study, we found that expression of SbABI3 and SbABI4 obviously decreased and that expression of SbABI1 obviously increased in the roots and shoots of both cultivars (Fig. 5). The increasing expression of AtABI1 and AtABI2 also occurred in Arabidopsis under salt stress, as shown by the data in the AtGenExpress expression database. A previous study showed that AtABI1 and AtABI2 are associated with salt tolerance in Arabidopsis thaliana (Ohta et al., 2003).

Thus, ABI1 and ABI2 may be involved in a common salt-tolerance mechanism shared between sorghum and Arabidopsis. Because ABI1 acts early in the ABA signaling pathway and stimulates all known signaling responses, such as increases in the free cytosolic calcium concentration ([Ca2+]cyt), and the reactive oxygen species (ROS) production (Allen et al., 1999; Murata et al., 2001; Hubbard et al., 2011), ABI1 may be the factor that stimulates some of the signaling responses under salt stress in sorghum.

Comparison of ABA accumulation in root and leaf tissues under salt stress conditions has revealed that the roots are more sensitive to salt-induced ABA accumulation than the shoots, suggesting that roots are more important than shoots for the ABA signaling mechanism of salt stress tolerance in plants (Jia et al., 2002). Because of obvious changes in the roots of our cultivars in the salt and ABA treatment conditions (Fig. 1 and 2), it is likely that the roots of our cultivars may contain the key factors and mechanism of salt tolerance.

Remarkably, AtABIs are involved in Arabidopsis response salt stress (Quesada et al., 2000; Brocard et al., 2002; Ohta et al., 2003; Bu et al., 2009; Li et al., 2013) but when we examined the expression of SbABI1, SbABI3, SbABI4 and SbABI5 in the two cultivars under salt stress, only SbABI5 expression in the roots was the most obvious change between the two cultivars, and the high expression of SbRAB28 and salt-induced SbABI5 occurred jointly in the roots of salt-tolerant cultivars (Fig. 6). RAB28 is a downstream ABA response gene (Nieva et al., 2005). In Arabidopsis, AtABI5 overexpression can induce RAB18 and some downstream stress-response genes (Brocard et al., 2002). Thus, here the high expression of SbRAB28 can be induced by SbABI5 and the expression of SbRAB28 may be sufficient to promote salt stress tolerance. AtABI5 is induced by salt stress in Arabidopsis (Fig. 7).

In addition, AtABI5 was induced by salt in Arabidopsis and the expression of AtABI5 was higher in the roots than in shoots (Fig. 7). Thus, we speculate that SbABI5 in the roots is the key factor mediating salt tolerance in sorghum.

Our results also showed that SbABI5 expression was increased by exposure to low concentration of exogenously applied ABA, while exposure to ultra-high concentration of ABA did not obviously induce the SbABI5 in the roots of either of the two cultivars (Fig. 8). Integrating with the sensitivity phenotype (Fig. 1, 2 and 3) and in ultra-high ABA accumulation in Longza11(Fig. 4), this finding further supports the conclusion that SbABI5 in the roots is the key factor mediating salt tolerance in sorghum, which can be inhibited by ultra-high ABA accumulate. SbABI5 can improve salt tolerance in plants not only by inducing salt-related genes, such as SbRAB28, but also by regulating plant growth, based on the fact that ABI5 has been shown to play a key role in arresting growth caused by ABA in the young seedling stage (Lopez-Molina et al., 2001; Brocard et al., 2002).

The role of salt-induced ABA accumulation is to induce ABA-related gene expression, which then induces some salt-related genes to improve salt tolerance in plants (Zhu 2002; Chinnusamy et al., 2005). It is possible that the weakening of salt tolerance in plants caused by ultra-high and sustained ABA accumulation may be a result of no or insufficient inducement of ABA-related genes.

Conclusion

In conclusion, the increase expression of SbABI5 gene in the roots is benefit for sorghum salt tolerance, the SbABI5 gene expression can be induced by a moderate ABA accumulation rather than an ultra-high ABA accumulation. In future, we will investigate how SbABI5 modulates gene transcription to regulate the sorghum growth and improve salt tolerance.

Acknowledgements

This work was supported by grants from the China Agriculture Research System (No. CARS-06-02-02), the National Natural Science Foundation of China (No. 31470358, 31070157 and 31170232), the Talent Funding Project of Liaoning Province Colleges and Universities (LJQ2013073), the China Postdoctoral Science Foundation (No. 20110490145, 2012T50253), and the Opening Project of State Key Laboratory of Shenyang Agricultural University, and the Doctoral Scientific Research Foundation of Shenyang Institute of Technology (No. BS201402).

References

Allen, G.J., K. Kuchitsu, S.P. Chu, Y. Murata and J.I. Schroeder, 1999. Arabidopsis abi1-1 and abi2-1 phosphatase mutations reduce abscisic acid-induced cytoplasmic calcium rises in guard cells. Plant Cell, 11: 1785-1798

Aneeta, N., N. Sana.n-Mishra, N. Tuteja and S. Kumar Sopory, 2002. Salinity-and ABA-induced up-regulation and light-mediated modulation of mRNA encoding glycine-rich RNA-binding protein from Sorghum bicolor. Biochem. Biophy. Res. Commun., 296: 1063-1068

Anjaneyulu, E., P.S. Reddy, M.S. Sunita, P.B. Kishor and B. Meriga, 2014. Salt tolerance and activity of antioxidative enzymes of transgenic finger millet overexpressing a vacuolar H(+)- pyrophosphatase gene (SbVPPase) from Sorghum bicolor. J. Plant Physiol., 171: 789-798

Bafeel, S.O., 2014. Physiological parameters of salt tolerance during germination and seedling growth of Sorghum bicolor cultivars of the same subtropical origin. Saudi J. Biol. Sci., 21: 300-304

Bernstein, N., W.K. Silk and A. Lauchli, 1993. Growth and development of sorghum leaves under conditions of NaCl stress. Planta, 191: 433-439

Brocard, I.M., T.J. Lynch and R.R. Finkelstein, 2002. Regulation and role of the Arabidopsis abscisic acid-insensitive 5 gene in abscisic acid, sugar, and stress response. Physiol. Plant., 129: 1533-1543

Bu, Q.Y., H.M. Li, Q.Z. Zhao, H.L. Jiang, Q.Z. Zhai, J. Zhang, X.Y. Wu, J.Q. Sun, Q. Xie, D.W. Wang and C.Y. Li, 2009. The Arabidopsis RING finger E3 ligase RHA2a is a novel positive regulator of abscisic acid signaling during seed germination and early seedling development. Physiol. Plant., 150: 463-481

Buchanan, C.D., S. Lim, R.A. Salzman, I. Kagiampakis, D.T. Morishige, B.D. Weers, R.R. Klein, L.H. Pratt, M.M. Cordonnier-Pratt and P.E. Klein, 2005. Sorghum bicolor's transcriptome response to dehydration, high salinity and ABA. Plant Mol. Biol., 58: 699-720

Ceccarelli, M., E. Santantonio, F. Marmottini, G.N. Amzallag and P.G. Cionini, 2006. Chromosome endoreduplication as a factor of salt adaptation in Sorghum bicolor. Protoplasma, 227: 113-118

Chen, Y., F. Ji, H. Xie, J. Liang and J. Zhang, 2006. The regulator of G-protein signaling proteins involved in sugar and abscisic acid signaling in Arabidopsis seed germination. Physiol. Plant., 140: 302-310

Chinnusamy, V., A. Jagendorf and J.K. Zhu, 2005. Understanding and improving salt tolerance in plants. Crop Sci., 45: 437-448

Choi, H., J. Hong, J. Ha, J. Kang and S.Y. Kim, 2000. ABFs, a family of ABA-responsive element binding factors. J. Biol. Chem., 275: 1723-1730

Finkelstein, R.R., S.S.L. Gampala and C.D. Rock, 2002. Abscisic acid signaling in seeds and seedlings. Plant Cell, 14: S15-S45

Finkelstein, R.R., M.L. Wang, T.J. Lynch, S. Rao and H.M. Goodman, 1998. The Arabidopsis abscisic acid response locus ABI4 encodes an APETALA 2 domain protein. Plant Cell, 10: 1043-1054

Finkelstein, R.R. and T.J. Lynch, 2000. The Arabidopsis abscisic acid response gene ABI5 encodes a basic leucine zipper transcription factor. Plant Cell, 12: 599-610

Giraudat, J., B.M. Hauge, C. Valon, J.E. Small, F. Parcy and H.M. Goodman, 1992. Isolation of the Arabidopsis ABI3 gene by positional cloning. Plant Cell, 4: 1251-1261

Gong, X., M. Liu, L. Zhang, Y. Ruan, R. Ding, Y. Ji, N. Zhang, S. Zhang, J. Farmer and C. Wang, 2015. Arabidopsis AtSUC2 and AtSUC4, encoding sucrose transporters, are required for abiotic stress tolerance in an ABA-dependent pathway. Physiol. Plant., 153: 119-136

Gurmani, A.R., S.U. Khan, F. Mabood, Z. Ahmed, S.J. Butt, J. Din, A. Mujeeb-Kazi and D. Smith, 2014. Screening and selection of synthetic hexaploid wheat germplasm for salinitytolerance based on physiological and biochemical characters. Int. J. Agric. Biol., 16: 681-690

Hu, Y.R. and D.Q. Yu, 2014. BRASSINOSTEROID INSENSITIVE2 interacts with ABSCISIC ACID INSENSITIVE5 to mediate the antagonism of brassinosteroids to abscisic acid during seed germination in Arabidopsis. Plant Cell, 26: 4394-4408

Hubbard, K.E., N. Nishimura, K. Hitomi, E.D. Getzoff and J.I. Schroeder, 2011. Early abscisic acid signal transduction mechanisms: newly discovered components and newly emerging questions. Genes Dev., 24: 1695-1708

Jia, W., Y. Wang, S. Zhang and J. Zhang, 2002. Salt-stress-induced ABA accumulation is more sensitively triggered in roots than in shoots. J. Exp. Bot., 53: 2201-2206

Kim, K.N., Y.H. Cheong, J.J. Grant, G.K. Pandey and S. Luan, 2003. CIPK3, a calcium sensor-associated protein kinase that regulates abscisic acid and cold signal transduction in Arabidopsis. Plant Cell, 15: 411-423

Knight, H. and M.R., 2001. Abiotic stress signalling pathways: specificity and cross-talk. Trends Plant Sci., 6: 262-267

Laurie, S., K.A. Feeney, F.J.M. Maathuis, P.J. Heard, S.J. Brown and R.A. Leigh, 2002. A role for HKT1 in sodium uptake by wheat roots. Plant J., 32: 139-149

Leung, J., M. Bouvier-Durand, P.C. Morris, D. Guerrier, F. Chefdor and J. Giraudat, 1994. Arabidopsis ABA response gene ABI1: features of a calcium-modulated protein phosphatase. Science, 264: 1448-1452

Leung, J., S. Merlot and J. Giraudat, 1997. The Arabidopsis ABSCISIC ACID-INSENSITIVE2 (ABI2) and ABI1 genes encode homologous protein phosphatases 2C involved in abscisic acid signal transduction. Plant Cell, 9: 759-771

Li, Y.J., Y. Fang, Y.R. Fu, J.G. Huang and C.A. Wu, 2013. NFYA1 is involved in regulation of postgermination growth arrest under salt stress in Arabidopsis. PLoS ONE, 8: e61289

Liu, M.X., Y.W. Wang, J.G. Han and P.S. Mao, 2011. Phenolic compounds from Chinese Sudangrass, sorghum, Sorghum-Sudangrass hybrid, and their antioxidant properties. Crop Sci., 51: 247-258

Liu, M.X., Y.W. Wang, J.G. Han, P.S. Mao and W. Yn-Wen, 2010. Prolamin extraction from high polyphenol seeds of sorghum (Sorghum spp.) and species discrimination and varieties identification by ultrathin-layer isoelectric focusing. Afr. J. Biotechnol., 9: 6645-6653

Lopez-Molina, L. and N.H. Chua, 2000. A null mutation in a bZIP factor confers ABA-insensitivity in Arabidopsis thaliana. Plant Cell Physiol., 41: 541-547

Lopez-Molina, L., S. Mongrand and N.H. Chua, 2001. A postgermination developmental arrest checkpoint is mediated by abscisic acid and requires the ABI5 transcription factor in Arabidopsis. Proc. Natl. Acad. Sci., 98: 4782-4787

Lu, B., F. Chen, Z.H. Gong, H. Xie and J.S. Liang, 2007. Integrin-like protein is involved in the osmotic stress-induced abscisic acid biosynthesis in Arabidopsis thaliana. J. Integr. Plant. Biol., 49: 540-549

Meyer, K., M.P. Leube and E. Grill, 1994. A protein phosphatase 2C involved in ABA signal transduction in Arabidopsis thaliana. Science, 264: 1452-1455

Monreal, J.A., A.B.Feria, J.M. Vinardell, J. Vidal, C. Echevarria and S. Garcia-Maurino, 2007. ABA modulates the degradation of phosphoenolpyruvate carboxylase kinase in sorghum leaves. FEBS Lett., 581: 3468-3472

Murata, Y., Z.M. Pei, I.C. Mori and J. Schroeder, 2001. Abscisic acid activation of plasma membrane Ca2+ channels in guard cells requires cytosolic NAD (P) H and is differentially disrupted upstream and downstream of reactive oxygen species production in abi1-1 and abi2-1 protein phosphatase 2C mutants. Plant Cell, 13: 2513-2523

Nambara, E., M. Suzuki, S. Abrams, D.R. McCarty, Y. Kamiya and P. McCourt, 2002. A screen for genes that function in abscisic acid signaling in Arabidopsis thaliana. Genetics, 161: 1247-1255

Ngara, R. and B.K. Ndimba, 2014. Model plant systems in salinity and drought stress proteomics studies: a perspective on Arabidopsis and Sorghum. Plant Biol., 16: 1029-1032

Nieva, C., P.K. Busk, E. Dominguez-Puigjaner,V. Lumbreras, P.S. Testillano, M.C. Risueno and M. Pages, 2005. Isolation and functional characterisation of two new bZIP maize regulators of the ABA responsive gene rab28. Plant Mol. Biol., 58: 899-914

Nishiyama, R., Y. Watanabe, Y. Fujita, D.T. Le, M. Kojima, T. Werner, R. Vankova, K. Yamaguchi-Shinozaki, K. Shinozaki, T. Kakimoto, H. Sakakibara, T. Schmulling and L.S.P. Tran, 2011. Analysis of cytokinin mutants and regulation of cytokinin metabolic genes reveals important regulatory roles of cytokinins in drought, salt and abscisic acid responses, and abscisic acid biosynthesis. Plant Cell, 23: 2169-2183

Ohta, M., Y. Guo, U. Halfter and J.K. Zhu, 2003. A novel domain in the protein kinase SOS2 mediates interaction with the protein phosphatase 2C ABI2. Proc. Natl. Acad. Sci., 100: 11771-11776

Pandey, G.K., J.J. Grant, Y.H. Cheong, B.G. Kim, L. Li and S. Luan, 2005. ABR1, an APETALA2-domain transcription factor that functions as a repressor of ABA response in Arabidopsis. Physiol. Plant., 139: 1185-1193

Quesada, V., M.R. Pnce and J.L. Micol, 2000. Genetic analysis of salt-tolerant mutants in Arabidopsis thaliana. Genetics, 154: 421-436

Reeves, W.M., T. Lynch, R. Mobin and R.R. Finkelstein, 2011. Direct targets of the transcription factors ABA-Insensitive (ABI) 4 and ABI5 reveal synergistic action by ABI4 and several bZIP ABA response factors. Plant Mol. Biol., 75: 347-363

Richardson, S.G. and K.J. McCree, 1985. Carbon balance and water relations of sorghum exposed to salt and water stress. Physiol. Plant., 79: 1015-1020

Rodriguez, P.L., G. Benning and E. Grill, 1998. ABI2, a second protein phosphatase 2C involved in abscisic acid signal transduction in Arabidopsis. FEBS Lett., 421: 185-190

Rus, A., S. Yokoi, A. Sharkhuu, M. Reddy, B. Lee, T.K. Matsumoto, H. Koiwa, J.K. Zhu, R.A. Bressan and P.M. Hasegawa, 2001. AtHKT1 is a salt tolerance determinant that controls Na+ entry into plant roots. Proc. Natl. Acad. Sci., 98: 14150-14155

Schmid, M., T.S. Davison, S.R. Henz, U.J. Pape, M. Demar, M. Vingron, B. Scholkopf, D. Weigel and J.U. Lohmann, 2005. A gene expression map of Arabidopsis thaliana development. Nat. Genet., 37: 501-506

Uno, Y., T. Furihata, H. Abe, R. Yoshida, K. Shinozaki and K. Yamaguchi-Shinozaki, 2000. Arabidopsis basic leucine zipper transcription factors involved in an abscisic acid-dependent signal transduction pathway under drought and high-salinity conditions. Proc. Natl. Acad. Sci., 97: 11632-11637

Zhu, J.K., 2002. Salt and drought stress signal transduction in plants. Annu. Rev. Plant. Biol., 53: 247-273
COPYRIGHT 2016 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:abscisic acid
Author:Sun, Lu; Wang, Che; Zhou, Yu-Fei; Ruan, Yan Ye; Gong, Xue; Zhang, Jing; Huang, Rui Dong
Publication:International Journal of Agriculture and Biology
Article Type:Report
Geographic Code:9CHIN
Date:Feb 29, 2016
Words:5823
Previous Article:Discovery and Weed Inhibition Effects of Coumarin as the Predominant Allelochemical of Yellow Sweetclover (Melilotus officinalis).
Next Article:A Self-developed System for Visual Detection of Vegetable Seed Vigor Index.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters