Printer Friendly

Inheritance of fifteen microsatellite loci in Ceratitis capitata (Diptera: Tephritidae).

Abstract

Molecular methods that rely on microsatellite markers have been developed for population genetic studies and diagnostics of tephritid pest species such as the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae). Whereas many of these markers are tested to see if they are within the Hardy--Weinberg equilibrium, very few markers developed for pest species are tested to ensure the selected alleles behave according to the laws of Mendelian inheritance. Fifteen previously developed microsatellite markers were examined for Mendelian inheritance. Nine parental groups consisting of a laboratory reared parent and a wild type parent and their respective progeny were examined. In total, 174 flies, consisting of 90 males and 84 females, were analyzed. Seventy-seven segregation ratio tests were performed to determine if any departures from expected Mendelian inheritance occurred. Representatives from each of the observed alleles were cloned and sequenced. Troubleshooting was performed on loci that did not conform to expected Mendelian inheritance ratios to confirm the cause and improve laboratory procedures. Issues observed included incomplete adenylation at the 5' end in Ccmic3, the presence of artifactual bands leading to false calls in Ccmic25, and monomorphic alleles in Ccmic7. Only 1 locus, Ccmic25, deviated from Mendelian expectations after protocol optimization in the form of a detected transmission ratio distortion leading to excessive heterozygosity. Finally, 1 locus, Ccmic9, showed evidence of allelic homoplasy.

Key Words: allelic inheritance; Mediterranean fruit fly; medfly; Mendelian expectations; multiplex

Resumen

Se han desarrollado metodos moleculares que dependen de marcadores de microsatelites para los estudios geneticos de poblacion y el diagnostico de las especies de plagas tefritidos como la mosca de la fruta del Mediterraneo, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae). Mientras que muchos de estos marcadores se prueban para ver si estan dentro del equilibrio de Hardy Weinberg, muy pocos de los marcadores desarrollados para especies plaga se prueban para asegurar que los alelos seleccionados se comportan segun las leyes de la herencia Mendeliana. Quince marcadores de microsatelites desarrollados anteriorment fueron examinados para la herencia Mendeliana. Se examinaron nueve grupos de parentales que consistian en un parental de crianza de laboratorio y un parental de mosca silvestre y su progenie respectiva. En total, se analizaron 174 moscas, compuestas de 90 machos y 84 hembras. Se realizaron 77 pruebas de relacion de segregacion para determinar si se produjo alguna desviacion de la herencia Mendeliana esperada. Los representantes de cada uno de los alelos observados fueron clonados y secuenciados. Se realizo la solucion de problemas en loci que no se ajustan a las proporciones esperadas de herencia Mendeliana para confirmar la causa y mejorar los procedimientos de laboratorio. Los problemas observados incluyeron adenilacion incompleta en el extremo 5'en Ccmic3, la presencia de bandas artifactuales que conducen a llamadas falsas en Ccmic25 y alelos monomorficos en Ccmic7. Solo 1 locus, Ccmic25, se desvio de las expectativas Mendelianas despues de la optimizacion del protocolo en forma de una distorsion de la relacion de transmision detectada que conduce a heterozigosidad excesiva. Finalmente, 1 locus, Ccmic9, mostro evidencia de homoplasia alelica.

Palabras Clave: herencia alelica; mosca mediterranea de la fruta; moscamed; expectativas Mendelianas; multiplex

The increase in human travel and trade worldwide has facilitated the accidental introduction of non-native species and destructive pests such as the Mediterranean fruit fly (medfly), Ceratitis capitata (Wiedemann) (Diptera: Tephritidae). Accidental introduction of invasive insect species has impacted economies, habitat, diversity of native species, and has been responsible for the introduction of destructive diseases (Horsefall 1983; Vitousex et al. 1997; Cox 1999; Gandhi & Herms 2010). The spread of the medfly from its native Sub-Saharan Africa to established regions throughout the world, including countries in the Mediterranean, South America, and Central America, as well as Australia and Hawaii, has been well documented (White & Elson-Harris 1992; Malacrida et al. 2007; De Meyer et al. 2008; Barr 2009). This highly polyphagous pest has a broad geographic distribution and is capable of using more than 250 plants as hosts and thereby placing many economically important crops at risk should the pest become established in new areas with tropical to dry-summer subtropical and dry-summer temperate climates (White & Elson-Harris 1992; Copeland et al. 2002; De Meyer et al. 2002; Barr 2009). The use of molecular techniques can help identify the pathways of accidental introductions, which in turn can allow managers to develop programs to mitigate potential spread and establishment of pest species into non-native habitats (Barr 2009). Microsatellite DNA techniques have been used successfully to track medfly movement and diagnose geographic sources of invasive populations (Bonizzoni et al. 2000, 2001, 2004; Karsten et al. 2013).

Source estimations used in determining the origin of introduced organisms, such as medfly, are improved only after the estimated allele frequencies from potential source populations have been determined (Paetkau et al. 1995; Rannala & Mountain 1997; Pritchard et al. 2000). In order to achieve this objective, the loci chosen should be neutral, unlinked to other loci being used in the same study, and conform to Mendelian expectations (Kimura & Crow 1964; Ohta & Kimura 1971; Kimura 1979). These assumptions are commonly addressed during the development of the markers by testing loci for deviations from the Hardy--Weinberg equilibrium (HWE) (Detwiler & Criscione 2011). However, the cause of the deviations from HWE may not be easy to determine due to many factors at the molecular or the population level or both. At the molecular level, mutations resulting in null alleles, unrecognized duplicated loci, and unrecognized sex-chromosome loci can cause deviations from HWE (Callen et al. 1993; Jones et al. 1998; Guichoux et al. 2011; Detwiler & Criscione 2011). Inbreeding, selection, and the Wahlund effect can affect the HWE at the population level (Detwiler & Criscione 2011; Lee et al. 2012). Finally, the population just may not adhere to Mendelian expectations due to modifiers during meiosis allowing preferential associations that lead to greater fitness of an allele (Ubeda 2006). Testing for inheritance using Mendelian segregation analysis can address the HWE assumption that a population must conform to Mendelian expectations to be considered in equilibrium.

Mendelian segregation analysis is an accurate method for confirming the performance of microsatellite primer sets (McGoldrick et al. 2000; Reece et al. 2004; Guichoux et al. 2011; Detwiler & Criscione 2011). The use of family design provides advantages over unrelated samples as they can elucidate some of the individual errors via Mendelian inconsistencies, such as segregation distortion, and unlikely recombination patterns (Kirk & Cardon 2002; Ubeda 2006). Performing controlled crosses is ideal for nuclear DNA-based marker development and is common practice in the development of markers for plants (e.g., Smith & Devey 1994; Jakse et al. 2001; Tarazi et al. 2010; Carneiro et al. 2012; Lefevre et al. 2012). For many insect groups, including pest tephritids such as medfly, this can be quite expensive and requires great care because it involves the rearing and the cross-mating of a reproductively viable agricultural pest species. This practice is difficult and resource intensive because such crosses would need to be performed in a specialized controlled environment. One research group was able to develop microsatellites for medfly by performing controlled crosses (Stratikopoulos et al. 2008). Using these and a few other previously published markers, Stratikopoulos et al. (2008) were able to estimate a genetic linkage map associating 67 microsatellite markers across 4 chromosomes. Additionally, these markers were tested for deviation from expected Mendelian ratios by back-crossing F2 progeny to F1 parents and most segregated in a 1:1 ratio (Stratikopoulos et al. 2008). However, information regarding Mendelian segregation observed for each specific microsatellite marker between family groups was not provided. The wild type strains used in initial crosses most likely exhibited low heterozygosity.

While microsatellite markers are readily available for medfly, the need to validate these markers is becoming increasingly important. This validation step is important when the markers have the potential to be used in making decisions that have large economic and ecological impacts. This is true for the medfly, which poses a significant risk to agricultural production and global trade (Barr 2009). The microsatellite methods developed to date for this invasive pest have been used to understand invasion patterns in fruit producing regions around the world (Bonizzoni et al. 2000, 2001, 2004; Gasperi et al. 2002), to estimate multiple paternity (Bonizzoni et al. 2002), and for the construction of cytogenetic maps (Straikopulos et al. 2008, 2009). Although verified using HWE tests with an initial examination to determine if these markers fall within Mendelian ratios, a more comprehensive examination of a select few markers is needed. We have selected 15 previously published microsatellite loci developed by Bonizzoni et al. (2000) and Stratikopoulos et al. (2009) for Mendelian segregation analysis. Initially 3 populations using 23 markers (data not shown) were analyzed during a pilot study to address the ease of interpreting the chromatographs when using these markers in a multiplex system. Linkages between each marker were measured using Fstat v2.9.3.2, and 15 loci were selected (unpublished data). Eight of the markers that we report here were developed in Bonizzoni et al. (2000) and were selected based on their historical use, application, and impact in decisions of regulatory importance. The 7 markers from Stratikopoulos et al. (2009) were selected based on their reported heterozygosity estimates, were within Hardy--Weinberg expectations, and estimates showed no linkage. Additionally, these same 15 loci are included in an ongoing study to examine population structure and genetic diversity of medfly to support United States Department of Agriculture (USDA) pathway analysis of the pest (Ruiz-Arce et al., unpublished).

Evaluation for these selected markers was conducted by testing and analyzing information from single-pair matings of medfly. Using a multiplex PCR system, our objective was to evaluate the performance of the aforementioned 15 loci. Segregation analysis between known parental-progeny strains will be conducted to detect any bias that may exist in the selected markers.

Materials and Methods

SAMPLES ANALYZED

Mediterranean fruit fly, C. capitata, families for this segregation analysis were produced at Planta El Pino Moscamed Guatemala. The laboratory strain used as the basis to perform these crosses is the currently mass reared genetic sexing strain (GSS) temperature sensitive lethal (TSL) known as Vienna [8.sup.(-invD53)]/Toliman99, which lacks the inversion characteristic of Vienna 8 strains, which were developed at a later date. To mass rear this strain, huge numbers of individuals are maintained in the breeding colony, which favors the presence of heterozygosity. This strain was selected because it is the current choice for sterile insect technique releases to control outbreaks in areas where the medfly has not established. This laboratory strain was crossed to wild type flies that emerged from larvae recovered from ripe coffee beans Coffea arabica L. (Rubiaceae) collected in the field in Guatemala.

SCHEME OF CROSSES

Twenty single-pair matings of laboratory insects were set up to collect eggs to produce F1 progeny for the parental-progeny analysis. Ten single pairs were formed by laboratory reared males crossed to wild type females (identified as "A" families) for the reciprocal cross, 10 single pairs of laboratory reared females were crossed to wild type males were identified as "B" families. Eggs collected from the respective crosses were raised on an artificial diet, which consisted of a blend of ground corn cob, torula yeast, granular sucrose, water, and preservatives. The environmental conditions for insect rearing were 24 [+ or -] 1 [degrees]F (-4 [degrees]C) and 60 to 65% RH for 6 d followed by 68 [+ or -] 1 [degrees]F (20 [degrees]C) and 60 to 65% RH for 4 d to reach full larval development for collection. From these crosses, 9 families from cross A and 10 from cross B were collected. Nineteen glass test tubes containing a minimum of 25 F1 pairs of insects (tube A4 had only 14 F1 pairs and was not included) in 1,2-propylene glycol USP (BASF CORP., Florham Park, New Jersey) were shipped to the CPHST laboratory (Mission, Edinburg, Texas) for analysis. Upon arrival, offspring were sexed and family groups that yielded a sex ratio close to 1:1 (male to female) were chosen to be included in this study. Five of the groups were pooled from family A (i.e., families A1, A2, A3, A7, and A8), and 4 groups were selected from family B (i.e., families B1, B3, B5, and B8). In total, 174 flies, consisting of 90 males and 84 females, were analyzed (Table 1).

DNA ISOLATION

DNA was isolated from whole fly samples using a nondestructive high-throughput magnetic bead-based genomic DNA purification technology using the extraction kit InviMag[R] Tissue DNA Mini Kit/KF96 (STRATEC Biomedical AG, Birkenfeld, Germany), on an automated magnetic-particle nucleic acid purification system, KingFisher[TM] Flex (Model # 711, Thermo Scientific, Waltham, Massachusetts). Each whole fly was placed in an individual well containing 400 [micro]L of the lysis buffer and 25 [micro]L of proteinase K. The plate containing the reagents and specimen was then placed in an ultrasonic water bath (Lab Companion UC-10, Jeio Tech, Seoul, Korea) at 52 [degrees]C and sonicated at the medium setting for approximately 30 min to increase tissue disruption. The lysis plate was then placed on a rocking platform located in an incubator set to 52 [degrees]C and left to rock overnight. The lysate was then transferred to a new deep well plate containing a 200 [micro]L of binding buffer (Binding Buffer T) and 20 [micro]L of magnetic beads (MAP Solution A). The "binding plate," containing DNA lysate, binding buffer, and magnetic beads, 3 wash plates (800 [micro]L Wash Buffer per well), and an elution plate (200 [micro]L Elution Buffer D per well) were loaded into the bead beater. The following program was used for isolating DNA: an initial binding for 5 min at fast speed setting at room temperature, 3 washes at 1.5 min on medium speed setting at room temperature, drying for 5 min at room temperature, and elution for 15 min at slow speed setting at 70 [degrees]C.

PCR MULTIPLEX AND FRAGMENT ANALYSIS

Fifteen microsatellites primer sets reported by Bonizzoni et al. (2000) and Stratikopoulos et al. (2009) to be in HWE were used in this study (Table 2). These primer sets were first tested in a singleplex method on 93 Mediterranean fruit flies representing 3 geographic areas (data not shown). They were then assigned to 1 of 6 panels to be used in a multiplex system. Three panels consisted of a combination of 3 primer sets, and the 3 additional panels consisted of 2 primer sets (Table 2). Each forward primer was end-labeled with either 6-carboxyfluorescein (6-FAM) or VIC[R] dye set (Life Technologies, Carlsbad, California). Pairing loci to panels was determined based on range in allele sizes, hybridization kinetics, and probability of primers forming "primer-dimers." Alternating labeled primers also was used to further allow for differentiating between primer sets, i.e., VIC--FAM--VIC (Table 2). Polymerase chain reactions (PCR) were performed in 15 [micro]L reactions containing 1 [micro]L DNA template, 1.5 [micro]L of 10X buffer, 1.2 [micro]L of 25 mM dNTP mix, 0.3 [micro]L of each labeled 5' primer (10 nmol, Applied Biosystems, Foster City, California), 0.3 [micro]L of each unlabeled 3' primer (10 nmol, Eurofins MWG Operon LLC, Huntsville, Alabama), and 0.08 [micro]L taqDNA polymerase (TaKaRa Ex Taq[TM] Hot Start Version, Takara Bio Inc., Otsu, Japan). Adjusting to a final volume of 15 [micro]L required a varying amount of water dependent on the number of primers used in a single reaction. Amplification was performed on a GeneAmp[R] PCR System 9700 thermocycler (Applied Biosystems, Foster City, California). Cycling conditions were 94 [degrees]C for 5 min followed by 39 cycles of 1 min at 94 [degrees]C, 1 min at 55 [degrees]C, 1 min at 72 [degrees]C, and a final extension at 72 [degrees]C for 30 min. An aliquot (10 [micro]L) of PCR product was visualized on a 2% TAE agarose gel prestained with ethidium bromide (0.4 [micro]g/mL final concentration). Documentation of gels was performed using the GelDocIt[R] TS2 Imager (UVP LLC, Upland, California) and VisionWorks[R] LS Image Acquisition and Analysis Software v 7.1 (UVP LLC, Upland, California). A 2 [micro]L portion of the PCR product was diluted 1:10 in water and submitted for fragment analysis. Fragment analysis was performed at the Genomics Core Facility, Huck Institute for the Life Sciences, Penn State University, using fluorescent-labeled primers and the GeneMapper[R] fragment analysis program (LifeTechnologies, Carlsbad, California). PCR products were analyzed on an Applied Biosystems 3730xl DNA Analyzer, using the Applied Biosystems Data Collection Software v 2.0 (Foster City, California). The resulting data was visualized with Applied Biosystems PeakScanner v1.0 (Foster City, California) to determine fragment size, and sorted using Microsatellite Toolkit v3.3.1 (University of California, Davis, California) in Microsoft[R] Excel 2013 (Microsoft, Redmond, Washington). Inheritance ratios were estimated from all 15 microsatellite loci. Goodness-of-fit G tests with William's correction for small sample size (Sokal & Rohlf 1995) and Bonferroni corrections (Rice 1989) were used to compare genotypic ratios in progeny to Mendelian expectations.

CLONING AND SEQUENCING

PCR was repeated using unlabeled primers for each observed allele selected as follows. For those loci that did not exhibit any departures from Mendelian expectations or other issues listed below, 1 parent and 1 progeny was chosen to represent the allele for cloning and subsequent sequencing. For those markers where departures from Mendelian expectation occurred, the family group exhibited a potential null allele or an unexpected band was observed, both parents and 6 progeny were selected and DNA amplified. PCR products for each allele were cloned into the TOPO 2.1 vector (Invitrogen, Life Technologies, Carlsbad, California) and grown on Luria Broth plates treated with 50 [micro]g/mL of kanamycin. After the plates were incubated overnight at 37 [degrees]C, 6 colonies were chosen from each plate for screening. For family group plates exhibiting the potential issues listed previously, an additional 6 colonies were screened. Each colony was grown in a 5 mL Luria Broth containing 50 [micro]g/mL of kanamycin. DNA was extracted from clones using the QIAprep Spin Miniprep Kit (QIAGEN, Hilden, Germany). Cycle sequencing reactions were performed at the Genomics Core Facility, Huck Institute for the Life Sciences, Penn State University, using 3' Big-Dye-labeled dideoxynucleotide triphosphates (v 3.1 dye terminators; Life Technologies, Carlsbad, California) and T3 or T7 universal primers. Reactions were run on an Applied Biosystems 3730xl DNA Analyzer following manufacturer's instructions (Applied Biosystems, Protocol #4303237), using Applied Biosystems Data Collection Software v 2.0 (Foster City, California). Sequencing trace files were then analyzed and aligned using Sequencher (v5.0, Gene Codes Corp., Ann Arbor, Michigan).

Results

In total, 1,128 multiplex PCRs and 94 singleplex PCRs were performed. Approximately 99.5% of all PCRs (multiplex and singleplex) produced results for analysis (Table 3). All of the parental samples and 98.3% of all loci tested on the progeny samples produced interpretable results. There were various characteristics used to improve the interpretation of multiplex marker data. This included wide gaps separating fragments for each marker, the use of alternating fluorescent labels, and the ability to use marker-specific shapes in order to increase allele call accuracy in chromatographs. All these facilitated and allowed for high confidence in making calls for the loci tested. The presence of double peaks was common in several panels, however, did not impede making accurate calls. We also observed a variation in mobility between sample plates resulting in a minute difference in allele size calls. This has the potential to lead to errors when rounding to the nearest whole number, which in turn may cause a 1 bp difference between fragment analysis plates. When a rounding error occurred, it was often consistent for all samples throughout the analyzed plate. In order to correct for this error, rounding rules were adjusted so that allele calls were similar between all plates; i.e. round down even if fragment size is 96.67. This method for normalizing results allowed for accurate comparisons between plates and thus reduced length bias. When running unknowns, internal controls from previous runs were used to help account for these variations and aided in determining the rounding rules.

We observed inconsistencies in 4 of 15 loci. The results of the analysis show that only 2 loci, Ccmic3 and Ccmic25, deviated from expected segregation ratios after applying the Bonferroni correction (Table 4). Fragment analysis revealed that 1 locus, Ccmic7, was monomorphic for all the tested families precluding validation of the primer set using segregation analysis. Sequencing identified evidence of allelic homoplasy in locus Ccmic9. The other loci generated genotypes within families consistent with expected Mendelian segregation ratios (Table 4). Troubleshooting was performed to determine possible causes of departures from Mendelian expectations for Ccmic3 and Ccmic25.

The departures in segregation pattern from the expected ratio, which was observed for the Ccmic3 locus in Families A1 and A7, were initially thought to be caused by the presence of a null allele. Analysis of the progeny revealed 2 improbable Mendelian ratios for both these crosses (A3 expected 1:1, A3 observed 1:2:1; A7 expected 1, A7 observed 1:1; Table 4). Cloning and sequencing revealed the presence of 2 thymine bases at the 5' end of the PCR fragment, suggesting that the cause for departures was due to incomplete adenylation resulting in an extra allele (Fig. 1). If adenylation is incomplete, it may result in 2 products for 1 allele observed as double peaks: a peak for the nonadenylated fragment and an additional peak 1 bp longer corresponding to the adenylated fragment. Incomplete adenylation compromises peak recognition, particularly for heterozygote genotypes with adjacent alleles (Guichoux et al. 2011). Sequencing revealed that either an 11 or 12 dimer repetitive motif occurred at the Ccmic3 locus (Fig. 1). In order to correct this issue, the forward primer was redesigned with the addition of 2 guanine bases and the 6-FAM dye was placed on the reverse primer. These adjustments minimized double peaks, increased resolution, and thereby improved interpretation (Fig. 2). These modifications, however, resulted in a shift in the mobility causing the fragment size to appear 2 bp smaller as compared with fragments prior to modifications. After primer redesign, the interpretation of data generated with Ccmic3 (called Ccmic3*) was improved and provided more accurate results, as confirmed when retested for deviations from Mendelian expectations ratios (Table 4).

Modification to the locus (Ccmic3*) improved assay performance and data interpretation. It could also eliminate potential issues because it is possible for the 74/76 allele described in our restricted sampling to occur in the wild. In a study by Bonizzoni et al. (2002), the authors reported the presence of a 74/78 male and a 78/78 male being present at other matings with a null allele being called (in Table 3 of Bonizzoni et al. 2002). Regardless of whether amplification of the region produced a PCR product, a null allele could have been called because of a potential cross from the presence of a 74/78 male and a 72/76 female. One potential result of this cross is a progeny with a 74/76 allele, the problematic allele observed in our study. If this allele was observed in the study, it would have appeared as a 76/76 allele (not possible based on potential parental genotypes) during fragment analysis resulting in a null call. However, utilizing the redesigned primers would have eliminated that possibility and reinforced the remating hypothesis ([chi square] = 11.923, P = 0.015), which is that female medflies have multiple male partners.

Departures from expected ratios at the Ccmic25 locus were detected for several families, but for 2 different causes. One departure was determined to be caused by the inclusion of an artifactual band of approximately 136 bp in Families A7, B1, and B5 (Table 4). Twelve attempts to isolate the 136 bp fragment through gel excision and/or direct cloning from the PCR product were unsuccessful. All sequences of screened clones corresponded with all the other observed genotypes. The cause of this anomaly has not been determined. It was noted that the shape of the peak of the 136 bp "allele" (Fig. 3a) was distinctly different and not characteristic of the other peak shapes from confirmed 137 bp alleles (Fig. 3b) that we observed and sequenced during panel assignment of medflies collected from South America (unpublished data). There was no significant departure from Mendelian ratios indicated when 136 bp fragment calls were not included in estimates (Table 4).

Evidence of non-Mendelian inheritance patterns was observed at the Ccmic25 locus in Family A3 (Table 4). This family exhibited a transmission ratio distortion in the form of heterozygote excess. This is a common occurrence in inheritance studies (Reece et al. 2004; Karlsson et al. 2007; Li et al. 2007; Guzinski et al. 2008). This could be an incident of segregation distortion, a ubiquitous phenomenon, which is characterized by a deviation from expected Mendelian ratios due to high heterozygosity (Aparicio et al. 2010; Liu et al. 2010). It is possible that this marker is located on a portion of a chromosome affected by a segregation distorter system, a powerful evolutionary force that can affect the frequency of certain genotypes, leading to the observed transmission ratio distortion (Lyttle 1993; Aparicio et al. 2010; Liu et al. 2010). Using markers that exhibit transmission ratio distortion does pose difficulties when mapping chromosomes (Hacket & Broadfoot 2003). However, the impact on assignment testing due to the segregation distortion at one locus should be minimal due to the robust nature of the test (Pritchard, Stanford University, personal communication). The number of loci and degree of genetic differentiation has more impact on the accuracy of assignment testing (Carlsson 2008). Performing assignment tests using and then excluding this marker should be similar unless the segregation distortion is creating large regions of linkage disequilibrium in the data (Pritchard, Stanford University, personal communication).

Although the Ccmic9 locus did not generate segregation ratios that deviate from Mendelian expectations, sequencing revealed a higher level of heterozygosity within this locus than expected based on allele numbers. The progeny from Families A8 and B8 revealed that 2 diplotypes occurred for this locus, 125/125 and 125/139, respectively (Table 4). However, sequencing of the clones revealed 2 distinct genotypes for the 125 bp allele. Additional cloning and sequencing of flies from other families for this locus revealed that 3 distinct genotypes were being represented by the 125 bp haplotype with a high number of indels being observed within the 4 observed genotypes. This is clear evidence of allelic homoplasy in the marker that could confound interpretation of data sets. Substantial difference between rates of indel mutations within the repeat sequence and during recombination could lead to series of alleles evolving essentially independently from other series of the locus, which in turn could represent a separate evolutionary process (Lehmann et al. 1996). The variation seen in this 1 haplotype could be associated to ecological or geographic trends, but additional data are needed to confirm this hypothesis. Sequencing this locus and other loci may provide insight on the application of this method for phylogenetic and phylogeographic studies.

Finally, Ccmic7 was revealed to be monomorphic (Ccmic7 [x.sub.116]) for our sampling (Table 3). Cloning confirmed the sequencing results. The monomorphic nature of Ccmic7 prevented us from determining if this locus was within Mendelian expectations. Testing with additional geographic collections is suggested for Ccmic7 because this marker has historical significance among medfly captures gathered in California as reported by Bonizzoni et al. (2001) and Gasperi et al. (2002).

Discussion

The work in the present study may provide useful information in differentiating wild flies from strains used for sterile insect technique releases, and markers tested herein will be used in the future to assist in documenting the hypothetical consequences of marginal reproduction of wild and partially sterile insects. In our study, we demonstrated that 14 microsatellite loci for this international pest perform according to Mendelian expectations thereby supporting their use for identifying the source population of medfly interceptions or incursions. Several of these microsatellite markers are an important resource in source estimations for fruit fly captures and provide information useful in the management of medfly (Bonizzoni et al. 2000, 2001, 2004; Stratikopoulos et al. 2009; Kartsen 2013). Six of the evaluated loci (i.e., Ccmic3, Ccmic6, Ccmic7, Ccmic9, Ccmic14, and Ccmic15) were developed and used on medflies collected from tropical Africa, the Mediterranean basin and South America (Bonizzoni et al. 2000). The results were consistent with previous studies using alternative methods (Gomulski et al. 1998; Malacrida et al. 1998). Ccmic3, Ccmic25, and Ccmic32 were used in characterizing Australian populations of medfly with fixed alleles being identified in the Ccmic3 and Ccmic32 loci (Bonizzoni et al. 2004). Additionally and very importantly for the diagnostics of medflies in California, at the Ccmic7 locus, a unique genotype (Ccmic7 [x.sub.142]) was reported among medfly captures made in the Los Angeles basin (Bonizzoni et al. 2001; Gasperi et al. 2002). Finally, the Ccmic3 locus has been used to infer paternity comparing wild caught medfly mothers and their offspring (Bonizzoni et al. 2002).

The inclusion of the markers developed by Stratikopoulous et al. (2009) should also provide more resolution. The reported high observed heterozygosity in the selected markers should prove to be informative (Stratikopoulous et al. 2008). Additionally, these chosen markers have the potential to identify other species from the genus Ceratitis (Stratikopoulous et al. 2009). The markers we selected are spread across at least 4 chromosomes. However, several markers were shown to share linkage groups (Stratikopoulous et al. 2008, 2009). In particular, 2 markers, Medflymic67 and Medflymic78, were shown to be separated by 2 centimorgans (Stratikopoulous et al. 2008). However, a recent pilot study we performed showed that all markers for the present study did not exhibit linkage (unpublished data). This indicates the possibility that independent recombination still occurs even between Medflymic67 and Medflymic78 considered within the same linkage group. Alternatively, genomic architecture could vary among different evolutionary lineages among the medfly. Eight of the selected markers were not present on the linkage map and could not be identified to a particular chromosome.

Questions may arise should Ccmic7 or Ccmic9 be included in any future studies. However, their use in previous studies may preclude omitting them. Although the Ccmic7 and Ccmic9 loci were not rejected by the segregation test, our study does not validate these loci for diagnostic use. The Ccmic7 locus was monomorphic in the samples tested precluding a biologically significant interpretation. This can be rectified by performing crosses on flies that exhibit variability at the Ccmic7 locus. The Ccmic9 locus exhibited evidence of a homoplasious allele state that could possibly provide misleading results when used to examine medfly invasions. A high presence of indels in the repeat region of the Ccmic9 has been observed leading to multiple genotypes being identified. This variability is not readily observed when basing calls on fragment size. This could lead to the accidental grouping of unrelated populations, whereas genotyping might reveal a more substantial genetic distance between the populations. Additional genotyping studies are required to test the loci for variability and the relative impact of homoplasy based on more diverse populations than the El Pino strains included in our study.

In light of these results, it is likely that many of the markers examined here will prove useful to researchers performing population studies for medfly. We have identified 2 medfly loci that should be treated with caution in future analysis, with suggestions on how to fully validate them. Although not completely validated, the decisions to include loci that may violate Mendelian segregation ratios or HWE will depend on the intended application, number of markers, and variability in the populations characterized.

Acknowledgments

We are grateful to the staff of the Planta El Pino Moscamed Guatemala for rearing and providing the medfly specimens used in these studies, in particular to Edwin Ramirez and Efren Ibarra for their technical support as well as Felipe Jeronimo and Felix Acajabon for the field collection of wild specimens. We are also grateful to the staff at Mission Lab, particularly to Rosita DeLeon for processing and managing the samples throughout the study and to Fritzie Into, Lisa Ledezma, and Juan D. Vasquez for technical support. We also thank Deborah S. Grove (Director of the Genomics Core Facility) and Ashley Price at The Pennsylvania State University--Huck Institute Nucleic Acid Facility for their assistance in sample genotyping and fragment analysis. Finally, thanks are due to the anonymous reviewers for their critiques. The use or mention of a trademark or proprietary product does not constitute an endorsement, guarantee, or warranty of the product and does not imply its approval to the exclusion of other suitable products by the United States Department of Agriculture, an equal opportunity employer. Funding for this study came from the USDA-APHIS-CPHST, PIC#M7M02.

Data Accessibility

GenBank accession numbers are listed in Table 5. For chromatograph files obtained during fragment analysis, please contact the corresponding author by email. Reference FA162-167 (Parents on these plates), FA179-184, and FA192-194. Reference FA196-197 to see comparison of primer redesign for Ccmic3. DNA from Family crosses may be available, please contact the corresponding author by email. Reference Plate Code: MED024, MED025, MED027.

References Cited

Aparicio JM, Ortego J, Calabuig G, Cordero PJ. 2010. Evidence of subtle departures from Mendelian segregation in a wild lesser kestrel (Falco naumanni) population. Heredity 105: 213-219.

Barr NB. 2009. Pathway analysis of Ceratitis capitata (Diptera: Tephritidae) using mitochondrial DNA. Journal of Economic Entomology 102: 401-411.

Bonizzoni M, Malacrida AR, Guglielmino CR, Gomulski LM, Gasperi G, Zheng L. 2000. Microsatellite polymorphism in the Mediterranean fruit fly, Ceratitis capitata. Insect Molecular Biology 9: 251-261.

Bonizzoni M, Zheng L, Guglielmino CR, Haymer DS, Gasperi G, Gomulski LM, Malacrida AR. 2001. Microsatellite analysis of medfly bioinfestations in California. Molecular Ecology 10: 2515-2524.

Bonizzoni M, Katsoyannos BI, Marguerie R, Guglielmino CR, Gasperi G, Malacrida A Chapman T. 2002. Microsatellite analysis reveals remating by wild Mediterranean fruit fly females, Ceratitis capitata. Molecular Ecology 11: 1915-1921.

Bonizzoni M, Guglielmino CR, Smallridge CJ, Gomulski LM, Malacrida AR, Gasperi G. 2004. On the origins of medfly invasion and expansion in Australia. Molecular Ecology 13: 3845-3855.

Callen DF, Thompson AD, Shen Y, Phillips HA, Richards RI, Mulley JC, Sutherland GR. 1993. Incidence of "null" alleles in the [(AC).sub.n] microsatellite markers. American Journal of Human Genetics 52: 922-927.

Carlsson J. 2008. Effects of microsatellite null alleles on assignment testing. Journal of Heredity 99: 616-623.

Carneiro FS, Lacerda AEB, Lemes MR, Gribel R, Kanashiro M, Sebbenn AM. 2012. Mendelian inheritance, linkage and genotypic disequilibrium in microsatellite loci isolated from Hymenaea courbaril (Leguminosae). Genetic and Molecular Research 11: 1942-1948.

Copeland RS, Wharton RA, Luke Q, De Meyer M. 2002. Indigenous hosts of Ceratitis capitata (Diptera: Tephritidae) in Kenya. Annals of the Entomological Society of America 95: 672-694.

Cox GW. 1999. Alien Species in North America and Hawaii. Island Press, Center for Resource Economics, Washington, District of Columbia.

De Meyer M, Copeland RS, Lux S, Mansell M, Wharton R, White IM, Zenz N. 2002. Annotated check list of host plants for afrotropical fruit flies (Diptera: Tephritidae) of the genus Ceratitis. Zoologische Documentatie Koninklijk Museum voor Midden Afrika 27: 1-92.

De Meyer M, Roberstson MP, Pterson AT, Mansell MW. 2008. Ecological niches and potential geographical distributions of Mediterranean fruit fly (Ceratitis capitata) and Natal fruit fly (Ceratitis rosa). Journal of Biogeography 35: 270-281.

Detwiler JT, Criscione CD. 2011. Testing Mendelian inheritance from field-collected parasites: revealing duplicated loci enables correct inference of reproductive mode and mating system. International Journal for Parasitology 41: 1185-1195.

Gandhi KJK, Herms DA. 2010. Direct and indirect effects of alien insect herbivores on ecological process and interactions in forests of eastern North America. Biological Invasions 12: 389-405.

Gasperi G, Bonizzoni M, Gomulski LM, Murelli V, Torti C, Malacrida AR, Guglielmino CR. 2002. Genetic differentiation, gene flow and the origin of infestations of the medfly, Ceratitis capitata. Genetica 116: 125-135.

Gomulski LM, Bourtzis K, Brogna S, Morandi PA, Bonvicini C, Sebastiani F, Torti C, Guglielmino CR, Savakis C, Gasperi G, Malacrida AR. 1998. Intron size polymorphism of the Ad[h.sub.1] gene parallels the worldwide colonization history of the Mediterranean fruit fly, Ceratitis capitata. Molecular Ecology 7: 1729-1741.

Guichoux E, Lagache L, Wagner S, Chaumeil P, Leger P, Lepais O, Lepoittevin C, Malausa T, Revardel E, Salin F, Petit RJ. 2011. Current trends in microsatellite genotyping. Molecular Ecology Resources 11: 591-611.

Guzinski J, Saint KM, Gardner MG, Donnellan SC, Bull CM. 2008. Permanent genetic resources: development of microsatellite markers and analysis of their inheritance in the Australian reptile tick, Bothriocroton hydrosauri. Molecular Ecology Resources 8: 443-445.

Hackett CA, Broadfoot LB. 2003. Effects of genotyping errors, missing values and segregation distortion in molecular marker data on the construction of linkage maps. Heredity. 90: 33-38.

Horsefall JG. 1983. Impact of introduced pests on man, pp 2-12. In Wilson C [ed.], Exotic Plant Pests and North American Agriculture. Academic Press, New York, New York.

Jakse J, Kindlhofer K, Javornik B. 2001. Assessment of genetic variation and differentiation of hop genotypes by microsatellite and AFLP markers. Genome 44: 773-782.

Jones AG, Stockwell CA, Walker D, Avise JC. 1998. The molecular basis of a microsatellite null allele from the White Sands pupfish. Journal of Heredity 89: 339-342.

Karlsson S, Ma L, Saillant E, Gold, JR. 2007. Tests of Mendelian segregation and linkage-group relationships among 31 microsatellite loci in red drum, Sciaenops ocellatus. Aquaculture International 15: 383-391.

Karsten M, van Vuuren BJ, Barnaud A, Terblanche JS. 2013. Population genetics of Ceratitis capitata in South Africa: Implications for dispersal and pest management. PLoS One 8: e54281.

Kimura M. 1979. Model of effectively neutral mutations in which selective constraint is incorporated. Proceedings of the National Academy of Sciences of the United States of America 76: 3440-3444.

Kimura M; Crow JF. 1964. The number of alleles that can be maintained in a finite population. Genetics 49: 725-738.

Kirk KM, Cardon LR. 2002. The impact of genotyping error on haplotype reconstruction and frequency estimation. European Journal of Human Genetics 10: 616-622.

Lee KE, Seddon JM, Johnston S, FitzGibbon SI, Carrick F, Melzer A, Bercovitch F, Ellis W. 2012. Genetic diversity in natural and introduced island populations of koalas in Queensland. Australian Journal of Zoology 60: 303-310.

Lefevre S, Wagner S, Petit RJ, De LaFontaine G. 2012. Multiplexed microsatellite markers for genetic studies of beech. Molecular Ecology Resources 12: 484-491.

Lehmann T, Hawley WA, Collins FH. 1996. An evaluation of evolutionary constraints on microsatellite loci using null alleles. Genetics 144: 1155-1163.

Li L, Wang HP, Givens C, Czesny S, Brown B. 2007. Isolation and characterization of microsatellites in yellow perch (Perca flavescens). Molecular Ecology Notes 7: 600-603.

Liu X, Guo L, You J, Liu X, He Y, Yuan J, Liu G, Feng Z. 2010. Progress of segregation distortion in genetic mapping of plants. Research Journal of Agronomy 4: 78-83.

Lyttle TW. 1993. Cheaters sometimes prosper: distortion of Mendelian segregation by meiotic drive. Trends in Genetics 9: 205-210.

Malacrida AR, Marinoni F, Torti C, Gomulski LM, Sebastiani F, Bonvicini C, Gasperi G, Guglielmino CR. 1998. Genetic aspects of the worldwide colonization process of Ceratitis capitata. Journal of Heredity 89: 501-507.

Malacrida AR, Gomulski LM, Bonizzoni M, Bertin S, Gasperi G, Guglielmino CR. 2007. Globalization and fruitfly invasion and expansion: the medfly paradigm. Genetica 131: 1-9.

McGoldrick DJ, Hedgecock D, English LJ, Baoprasertkul P, Ward RD. 2000. The transmission of microsatellite alleles in Australian and North American stocks of the Pacific oyster (Crassostrea gigas): selection and null alleles. Journal of Shellfish Research 19: 779-788.

Ohta T, Kimura M. 1971. Linkage disequilibrium between two segregating nucleotide sites under the steady flux of mutations in a finite population. Genetics. 68: 571-580.

Paetkau D, Calvert W, Stirling I, Strobeck C. 1995. Microsatellite analysis of population structure in Canadian polar bears. Molecular Ecology 4: 347-354.

Pritchard JK, Stephens M, Donnelly P. 2000. Inference of population structure using multilocus genotype data. Genetics 155: 945-959.

Rannala B, Mountain JL. 1997. Detecting immigration by using multilocus genotypes. Proceedings of the National Academy of Sciences of the United States of America 94: 9197-9201.

Reece KS, Ribeiro L, Gaffney PM, Carnegie RB, Allen SK. 2004. Microsatellite marker development and analysis in the eastern oyster (Crassostrea virginica): confirmation of null alleles and non-Mendelian segregation ratios. Journal of Heredity 95: 346-352.

Rice WR. 1989. Analyzing tables of statistical tests. Evolution 43: 223-225.

Sokal RR, Rohlf FJ. 1995. Biometry: The Principles and Practice of Statistics in Biological Research, 3rd ed. WH Freeman, New York, New York.

Stratikopoulos EE, Augustinos AA, Petalas YG, Vrahatis MN, Mintzas A, Mathiopoulos KD, Zacharopoulou A. 2008. An integrated genetic and cytogenetic map for the Mediterranean fruit fly, Ceratitis capitata, based on microsatellite and morphological markers. Genetica 133: 147-157.

Stratikopoulos EE, Augustinos AA, Pavlopoulos ID, Economou KPh, Mintzas A, Mathiopoulos, KD, Zacharopoulou A. 2009. Isolation and characterization of microsatellite markers from the Mediterranean fruit fly, Ceratitis capitata: cross-species amplification in other Tephritidae species reveals a varying degree of transferability. Molecular Genetic Genomics 282: 283-306.

Tarazi R, Sebenn AM, Mollinari M, Vencovsky R. 2010. Mendelian inheritance, linkage and linkage disequilibrium in microsatellite loci of Copaifera langsdorffii Desf. Conservation Genetics Resources 2: 201-204.

Ubeda F. 2006. Why Mendelian segregation? Biochemical Society Transactions 34: 566-568.

Vitousek PM, D'Antonio CM, Loope LL, Rejmanek M, Westbrooks R. 1997. Introduced species: a significant component of human-caused global change. New Zealand Journal of Ecology 21: 1-16.

White IM, Elson-Harris MM. 1992. Fruit Flies of Economic Significance: Their Identification and Bionomics. CAB International, Wallingford, United Kingdom.

T. Todd (1,*), P. Rendon (2), and R. Ruiz-Arce (1)

(1) Center for Science and Technology, Mission Laboratory, USDA-APHIS, Moore Air Base, 22675 N. Moorefield Rd, Bldg S6414, Edinburg, TX 78541, USA; E-mail: Terrance.N.Todd@aphis.usda.gov (T. N. T.), Raul.A.Ruiz@aphis.usda.gov (R. R.-A.)

(2) Pedro A. Rendon, IAEA, Technical Cooperation, Latin America Section. 4a. Ave. 12-62 Zona 10, Guatemala, C.A.; E-mail: p.a.rendon-arana@iaea.org (P. R.)

(*) Corresponding author; Email: Terrance.N.Todd@aphis.usda.gov (T. N. T.)

Caption: Fig. 1. Sequence alignment of Ccmic3 with original primer design. Top two sequences are genotypes of 74 bp allele and bottom two sequences are genotypes of the 76 bp allele. One extra thymine residue on the 5' end appeared in 8 of the 8 clones for this allele leading to difficulties in scoring this locus. Redesign of the forward primer by adding the extra guanines provided better resolution in scoring. Lower case sequence represents the Topo 2.1 vector just past the EcoRI in the multiple cloning site.

Caption: Fig. 2. Chromatograph comparing original and redesigned primers for Ccmic3 on sample A1-F1-07, Family A1. Both reactions were run simultaneously on the same fragment analysis plate using the same PCR conditions, DNA concentrations, and dilution factor. a) Chromatograph of progeny exhibiting an allele call of 74/74. Parents are 74/76 and 76/76. The observed 76 bp peak was considered to be weak. Cloning and sequencing confirmed the existence of this 76 bp fragment. b) Chromatograph of the same progeny as in Fig. 2a now exhibiting an allele call of 72/74 after primer modification. Parents are now 72/74 and 74/74. The observed 74 bp peak is more pronounced compared to the previous 76 bp call. The intensity of the 74 bp peak also increased while the other 3 visible peaks decreased. This suggests an increase in adenylation has occurred.

Caption: Fig. 3. Comparing artifactual bands to actual bands to determine allele as observed at the Ccmic25 locus. a) Chromatograph of sample exhibiting an artifactual band can be observed at the 136 bp peak. The geometric shape and configuration is not consistent with those of microsatellites. b) This chromatograph shows the characteristic high peak followed by a low peak expected when making a call around the 137 bp peak. To the left of both peaks are very low broad bands, commonly observed during analysis. In homozygote individuals, these peaks may extend higher and resemble an artifactual band similar to what was observed in Fig. 3a.
Table 1. Mating of Ceratitis capitata pairs performed at Planta El
Pino Moscamed Guatemala. Families were chosen if sex ratio was close to
1:1 with at least 6 males and 6 females being analyzed per mated pair.

Family name  Female origin        Male origin         Progeny analyzed

A1            wild capture       laboratory reared          32
A2            wild capture       laboratory reared          20
A3            wild capture       laboratory reared          30
A7            wild capture       laboratory reared          24
A8            wild capture       laboratory reared          16
B1            laboratory reared  wild capture               12
B3            laboratory reared  wild capture               16
B5            laboratory reared  wild capture               12
B8            laboratory reared  wild capture               12

Table 2. Multiplex PCR panels with respective microsatellite primers
used in Mendelian segregation analysis with Ceratitis capitata. Each
primer shows the primer sequence, fluorescent label used, and the
expected allele size according to original published data.

Panel     Locus             Primers 5' to 3'       Label     Expected
                                                            allele size
                                                             (bp)

1       Medflymic30    TACTGGACAACGGGTTAACAGC       VIC         126-135
                       TTTTATGTTCAACGCTGCGAC
        Medflymic78    ATTTGCCCGTCATTCAAACAAC       6-FAM       153-157
                       ATTTATACACCCAGTCATGCCC
        Medflymic43    TTTTCGAACGGCTGCATC           VIC         167-221
                       TTAGAGGCAAGCCACCAGG
2       Medflymic92    AAATGACACAAAACCGTAACCC       VIC         138-143
                       GCAACCGTTTACTGCTCAATG
        Medflymic67    AAAATCCCCTTGATGCCTG          6-FAM       155-170
                       ACATAAGCGTGTACCTTGTGCC
        Medflymic74    TCAAAGAAACAAAGAGGCGTG        VIC         188-194
3       Ccmic15        GTTCGAAAGTGGGGTATGTACG       VIC          85-109
                       CACAAGAGCCAAAGACGCAT
        Ccmic25        GCACATACACACAACCATTT         6-FAM       142-172
                       CGCCACAACGCAACAAAG
4       Ccmic14        AATTCAGATACACGCTCACAAG       VIC          75-111
                       TCGTATTGCTATGCGCATAT
        Ccmic9         GAAGTGACTCATATTTTTAGGAACGA   6-FAM       107-167
                       TCTTTCTTTCATACTCACTCATTTC
        Ccmic32        ACCACCCAATAACTTCATA          VIC         174-195
                       GCTTTCATCATCCGTTCC
5       Ccmic6         AAGGTAGCCAGCAGTGTCTACG       VIC          70-117
                       ACGAATGGGAGTTATTCATACTGC
        Medflymic81    TTAACTACCCTCGGTGATGGC        6-FAM       130-161
                       TTTGGTTCATATCGACGCTTG
6       Ccmic3a        ggTGCACATGTATTCGTTCTTA       6-FAM        72-96
                       AATTACCTATAAACATGCATACTG
        Ccmic7         TGTAAGTGAGCAAGGGGCAT         VIC         108-136
                       CATCAAAGGCAGAGAACTGCA

(a) Primer redesign. Original primer did not have the "g" guanine bases
as indicated in lowercase.

Table 3. Description and frequencies of microsatellite alleles in
individuals from 9 Ceratitis capitata families sampled for this present
study.

                 No. of      Observed
Locus           alleles   allele sizes (bp)

Medflymic30       2           126
                              130
Medflymic78       2           153
                              155
Medflymic43       4           168
                              180
                              215
                              221
Medflymic92       3           138
                              140
                              143
Medflymic67       3           156
                              168
                              170
Medflymic74       2           188
                              191
Ccmicl5           3            92
                              101
                              103
Ccmic25           3           141
                              146
                              159
Ccmicl4           2            74
                               82
Ccmic9          2(C)          125
                              125
                              125
                              139
Ccmic32           4           174
                177
                180
                196
Ccmic6            4            83
                 85
                 91
                 96
Medflymic81       2           130
                160
Ccmic3e           2            74
                 76
Ccmic3t           2            72
                 74
Ccmic?            1           116

Locus            Fragment description and/or repeat motif

Medflymic30          [(CA).sub.12]
                     [(CA).sub.14]
Medflymic78          [(AC).sub.13]
                     [(AC).sub.14]
Medflymic43          [(AC).sub.10]
                     [(AC).sub.15]ATAC
                     [(AC).sub.30]
                     [(AC).sub.32]
Medflymic92          [(AG).sub.11]TG[(AG).sub.2]TG
                     [(AG).sub.12]TG[(AG).sub.2]TG
                     [(AG).sub.7]GG[(AG).sub.5]TG[(AG).sub.2]TG
Medflymic67          [(GT).sub.4]GGGG[(GT).sub.3] + internal
                     deletion (d)
                     [(GT).sub.9]
                     [(GT).sub.10]
Medflymic74          [(GT).sub.8]-[107.sub.bp]-[(CA).sub.9]
                     [(GT).sub.6]ATGT-[107.sub.bp][(CA).sub.11]
Ccmicl5              [(TG).sub.10]
                     [(TG).sub.15]
                     [(TG).sub.4]TA[(TG).sub.3]A[(GT).sub.7]
Ccmic25              [(TATG).sub.7]
                     [(TATG).sub.8]
                     [(TATG).sub.11]
Ccmicl4              [(CA).sub.6]CC[(CA).sub.3]
                     [(CA).sub.10]CCAA[(CA).sub.2]
Ccmic9               Type 1 - GACA[(GA).sub.9]TA[(GA).sub.6]GT
                     [(GA).sub.2]GGTA[(GA).sub.5]
                     Type 2 - GACA[(GA).sub.10]TA[(GA).sub.6]
                     GT[(GA).sub.2]GGTA[(GA).sub.4]
                     Type 3 - GACA[(GA).sub.10]TA[(GA).sub.5]
                     GT[(GA).sub.2]GGTA[(GA).sub.5]
                     GACA[(GA).sub.6]GG[(GA).sub.3]TAGAAA
                     [(GA).sub.4]GT[(GA).sub.2]GGTA[(GA).sub.5]

Ccmic32              TG[(TTG).sub.7]-[57.sub.bp]-[(TTG).sub.5]
                     ([CTG).sub.3][(TTG).sub.4]
                     TG[(TTG).sub.8]-[57.sub.bp]-[(TTG).sub.5]
                     [(CTG).sub.3][(TTG).sub.4]
                     TG[(TTG).sub.9]-[57.sub.bp]-[(TTG).sub.5]
                     [(CTG).sub.3][(TTG).sub.4]
                     TG[(TTG).sub.8]-[57.sub.bp]-[(TTG).sub.5]TGCTG
                     [(TTG).sub.4][(CTG).sub.3][(TTG).sub.4]
Ccmic6               [(TG).sub.12]
                     [(TG).sub.13]
                     [(TG).sub.16]
                     [(TG).sub.19]
Medflymic81          GC-[0.sub.bp]-TGTA[(TG).sub.5]TATGTA[(TG).sub.3]
                     TATG
                     GC-[29.sub.bp]-TGTA[(TG).sub.4]TA(TG)JA[(TG).sub.5]
Ccmic3e              [(TG).sub.11]
                     [(TG).sub.12]
Ccmic3t              [(TG).sub.11]
                     [(TG).sub.12]
Ccmic?               [(TG).sub.8]

              No. of alleles in  No. of alleles in   Allele frequency
Locus            parents              progeny           in parents

Medflymic30        6                     75              0.167
                  30                    269              0.833
Medflymic78        4                     31              0.111
                  32                    315              0.889
Medflymic43        2                      9              0.056
                  11                    104              0.306
                  22                    214              0.611
                   1                     19              0.028
Medflymic92       18                    163              0.500
                   5                     44              0.139
                  13                    137              0.361
Medflymic67        6                     62              0.167
                  27                    253              0.750
                   3                     29              0.083
Medflymic74       12                    130              0.333
                  24                    194              0.667
Ccmicl5           20                    177              0.556
                   6                     70              0.167
                  10                    101              0.278
Ccmic25           28                    275              0.778
                   1                      9              0.028
                   7                     64              0.194
Ccmicl4           25                    237              0.694
                  11                    109              0.306
Ccmic9            34                    334              0.944
                   2                     12              0.056
Ccmic32            1                     14              0.028
                  12                    107              0.333
                  19                    181              0.528
                   4                     44              0.111
Ccmic6            10                    102              0.278
                   1                      5              0.028
                   8                     70              0.222
                  17                    151              0.472
Medflymic81       24                    250              0.667
                  12                     98              0.333
Ccmic3e            4                     52              0.143
                  24                    180              0.857
Ccmic3t            9                     84              0.250
                  27                    264              0.750
Ccmic?            32                    252              1.000

              Frequency in    Overall allele
Locus          progeny         frequency      [H.sub.E]   [H.sub.0]

Medflymic30       0.218            0.213
                  0.782            0.787       0.278        0.341
Medflymic78       0.090            0.092
                  0.910            0.908       0.198        0.163
Medflymic43       0.026            0.029
                  0.301            0.301
                  0.618            0.618
                  0.055            0.052       0.529        0.523
Medflymic92       0.474            0.476
                  0.128            0.129
                  0.398            0.395       0.600        0.601
Medflymic67       0.180            0.179
                  0.735            0.737
                  0.084            0.084       0.403        0.420
Medflymic74       0.401            0.394
                  0.599            0.606       0.444        0.470
Ccmicl5           0.509            0.513
                  0.201            0.198
                  0.290            0.289       0.586        0.617
Ccmic25           0.790            0.789
                  0.026            0.026
                  0.184            0.185       0.356        0.341
Ccmicl4           0.685            0.686
                  0.315            0.314       0.424        0.432
Ccmic9            0.965            0.963
                  0.035            0.037       0.105        0.067
Ccmic32           0.040            0.039
                  0.309            0.312
                  0.523            0.524
                  0.127            0.126       0.597        0.613
Ccmic6            0.311            0.308
                  0.015            0.016
                  0.213            0.214
                  0.460            0.462       0.650        0.646
Medflymic81       0.718            0.714
                  0.282            0.286       0.444        0.405
Ccmic3e           0.224            0.215
                  0.776            0.785       0.245        0.348
Ccmic3t           0.241            0.242
                  0.759            0.758       0.375        0.366
Ccmic?            1.000            1.000       0.000        0.000

(a) The 156 bp PCR fragment had a non-repetitive deletion just upstream
the repeat when compared to other alleles.
(b) Three different genotypes were observed for 125 bp PCR fragment
characterizing Ccmic9.
(c) Original primer as published by Bonizzoni et al. (2000).
(d) Primer redesign with extra guanine bases and fluorescent label on
reverse primer.

Table 4. The results of the segregation analysis of microsatellite
alleles in individuals from 9 Ceratitis capitata families sampled.

Locus           Multiplex    Female       Male      N
                 panel       alleles    alleles
Family Al
Medflymic30      1           130/130    126/130     32
Medflymic78      1           155/155    155/155     32
Medflymic43      1           215/221    215/215     32
Medflymic92      2           140/143    143/143     31
Medflymic67      2           156/168    168/168     31
Medflymic74      2           188/188    191/191     31
Ccmic15          3            92/103     92/101     32
Ccmic25          3           141/146    141/141     32
Ccmic14          4            74/82      74/82      32
Ccmic9           4           125/125    125/125     32
Ccmic32          4           180/196    177/190     32
Ccmic6           5            83/83      83/96      32
Medflymic81      5           130/160    130/160     32
Ccmic3           6            74/76      76/76      32
Ccmic7           6           116/116    116/116     32
Ccmic3 (*a)      6            72/74      74/74      32
Family A2
Medflymic30      1           126/130    130/130     20
Medflymic78      1           153/155    153/155     20
Medflymic43      1           180/215    168/215     20
Medflymic92      2           138/143    143/143     20
Medflymic67      2           168/170    168/168     20
Medflymic74      2           188/188    191/191     20
Ccmic15          3           103/103     92/101     20
Ccmic25          3           141/159    141/159     20
Ccmic14          4            74/74      74/82      20
Ccmic9           4           125/125    125/125     20
Ccmic32          4           180/196    180/180     20
Ccmic6           5            83/96      83/96      20
Medflymic81      5           130/130    130/160     20
Ccmic3           6            76/76      76/76      12
Ccmic7           6           116/116    116/116     12
Ccmic3(*a)       6            74/74      74/74      20
Family A3
Medflymic30      1           126/130    126/130     29
Medflymic78      1           155/155    155/155     30
Medflymic43      1           215/215    180/180     30
Medflymic92      2           138/138    138/138     30
Medflymic67      2           156/170    156/168     30
Medflymic74      2           191/191    191/191     30
Ccmic15          3            92/103     92/101     30
Ccmic25          3           141/159    141/159     30
Ccmic14          4            74/82      74/74      30
Ccmic9           4           125/125    125/125     30
Ccmic32          4           180/180    177/177     30
Ccmic6           5            91/96      91/96      20
Medflymic81      5           130/130    130/160     30
Ccmic3           6            76/76      74/76      12
Ccmic7           6           116/116    116/116     22
Ccmic3 (*a)      6            74/74      72/74      30
Family A7
Medflymic30      1           126/130    126/130     23
Medflymic78      1           155/155    155/155     23
Medflymic43      1           215/215    180/215     23
Medflymic92      2           138/138    138/143     23
Medflymic67      2           168/168    168/168     23
Medflymic74      2           188/191    188/191     23
Ccmic15          3           103/103     92/101     24
Ccmic25          3           141/141    141/141     24
Ccmic14          4            74/74      74/74      24
Ccmic9           4           125/125    125/125     24
Ccmic32          4           174/196    177/180     24
Ccmic6           5            96/96      91/96      24
Medflymic81      5           130/130    130/130     24
Ccmic3           6            76/76      76/76      24
Ccmic7           6           116/116    116/116     24
Ccmic3 (*a)      6            74/74      72/74      24
Family A8
Medflymic30      1           130/130    130/130     16
Medflymic78      1           155/155    155/155     16
Medflymic43      1           215/215    180/215     16
Medflymic92      2           138/140    138/143     16
Medflymic67      2           156/168    168/168     16
Medflymic74      2           188/191    191/191     16
Ccmic15          3           101/103     92/101     16
Ccmic25          3           141/141    141/141     16
Ccmic14          4            74/74      82/82      16

Locus                Alleles                              Expected
                    of progeny                             ratio
Family Al
Medflymic30       126/130:130/130                         1:1
Medflymic78       155/155                                 1
Medflymic43       215/215:215/221                         1:1
Medflymic92       143/140:143/143                         1:1
Medflymic67       156/168:168/168                         1:1
Medflymic74       188/191                                 1
Ccmic15            92/92:92/101:92/103:101/103            1:1:1:1
Ccmic25           141/141:141/146                         1:1
Ccmic14            74/74:74/82:82/82                      1:2:1
Ccmic9            125/125                                 1
Ccmic32           177/180:177/196:180/180:180/196         1:1:1:1
Ccmic6             83/83:83/96                            1:1
Medflymic81       130/130:130/160:160/160                 1:2:1
Ccmic3             74/74:74/76:76/76                      1:1
Ccmic7            116/116                                 1
Ccmic3 (*a)        72/74:74/74                            1:1
Family A2
Medflymic30       126/130:130/130                         1:1
Medflymic78       153/153:153/155:155/155                 1:2:1
Medflymic43       168/180:168/215:180/215:215/215         1:1:1:1
Medflymic92       138/143:143/143                         1:1
Medflymic67       168/168:168/170                         1:1
Medflymic74       188/191                                 1
Ccmic15            92/103:101/103                         1:1
Ccmic25           141/141:141/159:159/159                 1:2:1
Ccmic14            74/74:74/82                            1:1
Ccmic9            125/125                                 1
Ccmic32           180/180:180/196                         1:1
Ccmic6             83/83:83/96:96/96                      1:2:1
Medflymic81       130/130:130/160                         1:1
Ccmic3             76/76                                  1
Ccmic7            116/116                                 1
Ccmic3(*a)         74/74                                  1
Family A3
Medflymic30       126/126:126/130:130/130                 1:2:1
Medflymic78       155/155                                 1
Medflymic43       180/215                                 1
Medflymic92       138/138                                 1
Medflymic67       156/156:156/168:156/170:168/170         1:1:1:1
Medflymic74       191/191                                 1
Ccmic15            92/92:92/101:92/103:101/103            1:1:1:1
Ccmic25           141/141:141/159:159/159                 1:2:1
Ccmic14            74/74:74:82                            1:1
Ccmic9            125/125                                 1
Ccmic32           177/180                                 1
Ccmic6             91/91:91/96:96/96                      1:2:1
Medflymic81       130/130:130/160                         1:1
Ccmic3             74/76:76/76                            1:1
Ccmic7            116/116                                 1
Ccmic3 (*a)        72/74:74/74                            1:1
Family A7
Medflymic30       126/126:126/130:130/130                 1:2:1
Medflymic78       155/155                                 1
Medflymic43       180/215:215/215                         1:1
Medflymic92       138/138:138/143                         1:1
Medflymic67       168/168                                 1
Medflymic74       188/188:188/191:191/191                 1:2:1
Ccmic15            92/103:101/103                         1:1
Ccmic25           141/141                                (1:2:1) (e) 1
Ccmic14            74/74                                  1
Ccmic9            125/125                                 1
Ccmic32           174/177:174/180:177/196:180/196         1:1:1:1
Ccmic6             91/96:96/96                            1:1
Medflymic81       130/130                                 1
Ccmic3             76/76                                  1
Ccmic7            116/116                                 1
Ccmic3 (*a)        72/74:74/74                            1:1
Family A8
Medflymic30       130/130                                 1
Medflymic78       155/155                                 1
Medflymic43       180/215:215/215                         1:1
Medflymic92       138/138:138/140:138/143:140/143         1:1:1:1
Medflymic67       156/168:168/168                         1:1
Medflymic74       188/191:191/191                         1:1
Ccmic15            92/101:92/103:101/101:101/103          1:1:1:1
Ccmic25           141/141                                 1
Ccmic14            74/82                                  1

Locus                 Observed
                       ratio

Family Al
Medflymic30             11:21
Medflymic78             32
Medflymic43             13:19
Medflymic92             14:17
Medflymic67             16:15
Medflymic74             31
Ccmic15                  9:8:7:8
Ccmic25                 23:9 (b)
Ccmic14                  2:22:8 (b)
Ccmic9                  32
Ccmic32                  8:11:8:5
Ccmic6                  17:15
Medflymic81             12:15:5
Ccmic3                   5:16:11 (d)
Ccmic7                  32
Ccmic3 (*a)             17:15
Family A2
Medflymic30              7:13
Medflymic78              5:11:4
Medflymic43              3:3:6:8
Medflymic92             10:10
Medflymic67             13:7
Medflymic74             20
Ccmic15                 11:9
Ccmic25                  1:13:6
Ccmic14                 10:10
Ccmic9                  20
Ccmic32                  7:13
Ccmic6                   5:11:4
Medflymic81             16:4b
Ccmic3                  12
Ccmic7                  12
Ccmic3(*a)              20
Family A3
Medflymic30              9:15:5
Medflymic78             30
Medflymic43             30
Medflymic92             30
Medflymic67              9:5:9:7
Medflymic74             30
Ccmic15                  9:7:6:8
Ccmic25                  5:24:l (c)
Ccmic14                 15:15
Ccmic9                  30
Ccmic32                 30
Ccmic6                   5:10:5
Medflymic81             16:14
Ccmic3                   9:3
Ccmic7                  22
Ccmic3 (*a)             16:14
Family A7
Medflymic30              6:12:5
Medflymic78             23
Medflymic43             10:13
Medflymic92              7:16
Medflymic67             23
Medflymic74              9:9:5
Ccmic15                  9:15
Ccmic25                 (0:9:15) (f) 24
Ccmic14                 24
Ccmic9                  24
Ccmic32                  4:10:3:7
Ccmic6                  12:12
Medflymic81             24
Ccmic3                   4:20 (c)
Ccmic7                  24
Ccmic3 (*a)              7:17
Family A8
Medflymic30             16
Medflymic78             16
Medflymic43              5:11
Medflymic92              3:4:7:2
Medflymic67              5:11
Medflymic74             11:5
Ccmic15                  4:5:4:3
Ccmic25                 16
Ccmic14                 16

Locus         Multiplex       Female         Male            N
               panel          alleles      alleles

Ccmic9           4             125/139      125/125          16
Ccmic32          4             180/180      177/177          16
Ccmic6           5              91/91        96/96           16
Medflymic81      5             130/130      160/160          16
Ccmic3           6              --/-- (e)    --/-- (e)
Ccmic7           6             116/116      116/116          16
Ccmic3 (*a)      6              72/74        72/74           16
Family B1
Medflymic30      1             130/130      130/130          12
Medflymic78      1             155/155      155/155          12
Medflymic43      1             215/215      215/215          12
Medflymic92      2             138/143      138/140          12
Medflymic67      2             168/168      168/168          12
Medflymic74      2             191/191      188/191          12
Ccmic15          3              92/92        92/92           12
Ccmic25          3             141/159      141/159          12
Ccmic14          4              82/82        74/74           12
Ccmic9           4             125/125      125/125          12
Ccmic32          4             177/177      180/180          12
Ccmic6           5              83/85        83/96           12
Medflymic81      5             130/160      160/160          12
Ccmic3           6              76/76        76/76           12
Ccmic7           6             116/116      116/116          12
Ccmic3 (*a)      6              74/74        74/74           12
Family B3
edflymic30       1             130/130      130/130          16
Medflymic78      1             155/155      153/155          16
Medflymic43      1             168/180      180/215          16
Medflymic92      2             138/143      138/140          16
Medflymic67      2             168/168      156/168          16
Medflymic74      2             188/191      188/188          16
Ccmic15          3              92/92        92/92           16
Ccmic25          3             141/141      141/141          16
Ccmic14          4              74/82        74/74           15
Ccmic9           4             125/125      125/125          15
Ccmic32          4             177/180      177/180          15
Ccmic6           5              91/91        96/96           16
Medflymic81      5             130/130      130/130          16
Ccmic3           6              --/-- (e)    --/-- (e)
Ccmic7           6             116/116      116/116          16
Ccmic3 (*a)      6              72/74        72/74           16
Family B5
Medflymic30      1             130/130      130/130          12
Medflymic78      1             155/155      153/155          12
Medflymic43      1             180/180      180/215          12
Medflymic92      2             140/143      138/138          12
Medflymic67      2             168/168      156/170          12
Medflymic74      2             191/191      188/188          12
Ccmic15          3              92/92       103/103          12
Ccmic25          3             141/141      141/141          12
Ccmic14          4              74/82        74/74           12
Ccmic9           4             125/125      125/125          12
Ccmic32          4             177/180      180/196          12
Ccmic6           5              83/83        91/96           12
Medflymic81      5             130/160      130/160          12
Ccmic3           6              76/76        74/76           12
Ccmic7           6             116/116      116/116          12
Ccmic3 (*a)      6              74/74        72/74           12
Family B8
Medflymic30      1             130/130      130/130          12
Medflymic78      1             155/155      155/155          12
Medflymic43      1             180/215      215/215          12
Medflymic92      2             143/143      138/138          12
Medflymic67      2             168/168      168/168          12
Medflymic74      2             191/191      191/191          12
Ccmic15          3              92/92        92/103          12
Ccmic25          3             141/159      141/141          12
Ccmic14          4              74/74        74/82           12
Ccmic9           4             125/125      125/139          12
Ccmic32          4             177/180      180/180          12
Ccmic6           5              83/96        96/96           12
Medflymic81      5             130/130      130/160          12
Ccmic3           6              76/76        74/76           12
Ccmic7           6             116/116      116/116          12
Ccmic3 (*a)      6              74/74        72/74           12

Locus                                  Alleles of
                                        progeny

Ccmic9                             125/125:125/139
Ccmic32                            177/180
Ccmic6                              91/96
Medflymic81                        130/160
Ccmic3                              --/-- (e)
Ccmic7                             116/116
Ccmic3 (*a)                         72/72:72/74:74/74
Family B1
Medflymic30                        130/130
Medflymic78                        155/155
Medflymic43                        215/215
Medflymic92                        138/138:138/140:138/143:140/143
Medflymic67                        168/168
Medflymic74                        188/191:191/191
Ccmic15                             92/92
Ccmic25                            141/141:141/159:159/159
Ccmic14                             74/82
Ccmic9                             125/125
Ccmic32                            177/180
Ccmic6                              83/83:83/85:83/96:85/96
Medflymic81                        130/160:160/160
Ccmic3                              76/76
Ccmic7                             116/116
Ccmic3 (*a)                         74/74
Family B3
edflymic30                         130/130
Medflymic78                        153/155:155/155
Medflymic43                        168/180:168/215:180/180:180/215
Medflymic92                        138/138:138/140:138/143:140/143
Medflymic67                        156/168:168/168
Medflymic74                        188/188:188/191
Ccmic15                             92/92
Ccmic25                            141/141
Ccmic14                             74/74:74/82
Ccmic9                             125/125
Ccmic32                            177/177:177/180:180/180
Ccmic6                              91/96
Medflymic81                        130/130
Ccmic3                              --/-- (e)
Ccmic7                             116/116
Ccmic3 (*a)                         72/72:72/74:74/74
Family B5
Medflymic30                        130/130
Medflymic78                        153/155:155/155
Medflymic43                        180/180:180/215
Medflymic92                        138/140:138/143
Medflymic67                        156/168:170/168
Medflymic74                        188/191
Ccmic15                             92/103
Ccmic25                            141/141
Ccmic14                             74/74:74/82
Ccmic9                             125/125
Ccmic32                            177/180:177/196:180/180:180/196
Ccmic6                              83/91:83/96
Medflymic81                        130/130:130/160:160/160
Ccmic3                              74/76:76/76
Ccmic7                             116/116
Ccmic3 (*a)                         72/74:74/74
Family B8
Medflymic30                        130/130
Medflymic78                        155/155
Medflymic43                        180/215:215/215
Medflymic92                        138/143
Medflymic67                        168/168
Medflymic74                        191/191
Ccmic15                             92/92:92/103
Ccmic25                            141/141:141/159
Ccmic14                             74/74:74/82
Ccmic9                             125/125:125/139
Ccmic32                            177/180:180/180
Ccmic6                              83/96:96/96
Medflymic81                        130/130:130/160
Ccmic3                              74/76:76/76
Ccmic7                             116/116
Ccmic3 (*a)                        72/74:74/74

Locus                 Expected ratio          Observed ratio

Ccmic9                 1:1                         10:6
Ccmic32                1                           16
Ccmic6                 1                           16
Medflymic81            1                           16
Ccmic3
Ccmic7                 1                           16
Ccmic3 (*a)            1:2:1                        5:10:1
Family B1
Medflymic30            1                           12
Medflymic78            1                           12
Medflymic43            1                           12
Medflymic92            1:1:1:1                      0:4:5:3
Medflymic67            1                           12
Medflymic74            1:1                          3:9
Ccmic15                1                           12
Ccmic25               (1:1:1:1) (f) 1:2:1          (4:2:4:2) (g) 6:4:2
Ccmic14                1                           12
Ccmic9                 1                           12
Ccmic32                1                           12
Ccmic6                 1:1:1:1                      3:4:4:1
Medflymic81            1:1                          6:6
Ccmic3                 1                           12
Ccmic7                 1                           12
Ccmic3 (*a)            1                           12
Family B3
edflymic30             1                           16
Medflymic78            1:1                          5:11
Medflymic43            1:1:1:1                      l:2:10:3b
Medflymic92            1:1:1:1                      3:4:2:7
Medflymic67            1:1                          3:13b
Medflymic74            1:1                         11:5
Ccmic15                1                           16
Ccmic25                1                           16
Ccmic14                1:1                          9:6
Ccmic9                 1                           15
Ccmic32                1:2:1                        1:9:5
Ccmic6                 1                           16
Medflymic81            1                           16
Ccmic3
Ccmic7                 1                           16
Ccmic3 (*a)            1:2:1                        0:ll:5 (b)
Family B5
Medflymic30            1                           12
Medflymic78            1:1                          6:6
Medflymic43            1:1                          6:6
Medflymic92            1:1                          6:6
Medflymic67            1:1                          6:6
Medflymic74            1                           12
Ccmic15                1:1                         12
Ccmic25               (1:2:1) (f) 1                (0:0:12) (g) 12
Ccmic14                1:1                          6:6
Ccmic9                 1                           12
Ccmic32                1:1:1:1                      4:1:3:4
Ccmic6                 1:1                          5:7
Medflymic81            1:2:1                        2:4:6
Ccmic3                 1:1                          7:5
Ccmic7                 1                           12
Ccmic3 (*a)            1:1                          6:6
Family B8
Medflymic30            1                           12
Medflymic78            1                           12
Medflymic43            1:1                          8:4
Medflymic92            1                           12
Medflymic67            1                           12
Medflymic74            1                           12
Ccmic15                1:1                          4:8
Ccmic25               (1:1:1:1)' 1:1               (2:0:5:5)B 7:5
Ccmic14                1:1                          6:6
Ccmic9                 1:1                          6:6
Ccmic32                1:1                          7:5
Ccmic6                 1:1                          6:6
Medflymic81            1:1                          6:6
Ccmic3                 1:1                          6:6
Ccmic7                 1                           12
Ccmic3 (*a)            1:1                          7:5

(a) Primer redesign. Original primer did not have the guanine bases as
indicated in Table 1.
(b) Indicates nominal significant deviation from expected Mendelian
ratio (P < 0.05).
(c) Indicates significant deviation from expected Mendelian ratio after
sequential Bonferroni correction (P < 0.001).
(d) deviation from expected ratio suspected as a null allele later
determined to be caused by incomplete adenylation.
(e) This family group was not tested with original Ccmic3 primers so
no data available.
(f) Original expected ratio when 136 bp artifact was treated as a true
allele.
(g) Observed ratio when including 136 bp signal as true allele.

Table 5. GenBank accession numbers associated with observed alleles

Locus          Observed allele
                sizes (bp)

Medflymic30      126
                 130
Medflymic78      153
                 155
Medflymic43      168
                 180
                 215
                 221
Medflymic92      138
                 140
                 143
Medflymic67      156
                 168
                 170
Medflymic74      188
                 191
Ccmic15           92
                 101
                 103
Ccmic25          141
                 146
                 159
Ccmic14           74
                  82
Ccmic9           125
                 125
                 125
                 139
Ccmic32          174
                 177
                 180
                 196
Ccmic6            83
                  85
                  91
                  96
Medflymic81      130
                 160
Ccmic3            74
                  74
                  76
Ccmic7           116

Locus        Fragment description
               and/or repeat Motif

Medflymic30     [(CA).sub.12]
                [(CA).sub.14]
Medflymic78     [(AC).sub.13]
                [(AC).sub.14]
Medflymic43     [(AC).sub.10]
                [(AC).sub.15]ATAC
                [(AC).sub.30]
                [(AC).sub.32]
Medflymic92     [(AG).sub.11]TG[(AG).sub.2]TG
                [(AG).sub.12]TG[(AG).sub.2]TG
                [(AG).sub.7]GG[(AG).sub.5]TG[(AG).sub.2]TG
Medflymic67     [(GT).sub.4]GGGG[(GT).sub.3] + internal deletion
                [(GT).sub.9]
                [(GT).sub.10]
Medflymic74     [(GT).sub.8]-[107.sub.bp]-[(CA).sub.9]
                [(GT).sub.6]ATGT-[107.sub.bp]-[(CA).sub.n]
Ccmic15         [(TG).sub.10]
                [(TG).sub.15]
                [(TG).sub.4]TA[(TG).sub.3]A[(GT).sub.7]
Ccmic25         [(TATG).sub.7]
                [(TATG).sub.8]
                [(TATG).sub.11]
Ccmic14         [(CA).sub.6]CC[(CA).sub.3]
                [(CA).sub.10]CCAA[(CA).sub.2]
Ccmic9          Type 1 - GACA[(GA).sub.9]TA[(GA).sub.6]GT[(GA).sub.2]
                GGTA[(GA).sub.5]
                Type 2 - GACA[(GA).sub.10]TA[(GA).sub.6]GT[(GA).sub.2]
                GGTA[(GA).sub.4]
                Type 3 - GACA[(GA).sub.10]TA[(GA).sub.5]GT[(GA).sub.2]
                GGTA[(GA).sub.5]
                GACA[(GA).sub.6]GG[(GA).sub.3]TAGAAA[(GA).sub.4]
                GT[(GA).sub.2]GGTA[(GA).sub.5]
Ccmic32         TG[(TTG).sub.7]-[57.sub.bp]-[(TTG).sub.5][(CTG).sub.3]
                [(TTG).sub.4]
                TG[(TTG).sub.8]-[57.sub.bp]-[(TTG).sub.5][(CTG).sub.3]
                [(TTG).sub.4]
                TG[(TTG).sub.9]-[57.sub.bp]-[(TTG).sub.5][(CTG).sub.3]
                [(TTG).sub.4]
                TG[(TTG).sub.8]-[57.sub.bp]-[(TTG).sub.5]
                TGCTG[(TTG).sub.4][(CTG).sub.3][(TTG).sub.4]
Ccmic6          [(TG).sub.12]
                [(TG).sub.13]
                [(TG).sub.16]
                [(TG).sub.19]
Medflymic81     GC-[0.sub.bp]-TGTA[(TG).sub.5]TATGTA[(TG).sub.3]TATG
                GC-[29.sub.bp]-TGTA[(TG).sub.4]TA[(TG).sub.2]
                TA[(TG).sub.5]
Ccmic3          [(TG).sub.11] In Topo 2.1 w/ 2 Adenine bases
                [(TG).sub.11] In Topo 2.1 w/ 3 Adenine bases
                [(TG).sub.12]
Ccmic7          [(TG).sub.8]

Locus         Accession
               Number

Medflymic30   KM410072
              KM410073
Medflymic78   KM410083
              KM410084
Medflymic43   KM410074
              KM410075
              KM410076
              KM410077
Medflymic92   KM410045
              KM410046
              KM410047
Medflymic67   KM410078
              KM410079
              KM410080
Medflymic74   KM410081
              KM410082
Ccmic15       KM410063
              KM410064
              KM410062
Ccmic25       KM410065
              KM410066
              KM410067
Ccmic14       KM410060
              KM410061
Ccmic9        KM410056
              KM410057
              KM410058
              KM410059
Ccmic32       KM410068
              KM410069
              KM410070
              KM410071
Ccmic6        KM410051
              KM410052
              KM410053
              KM410054
Medflymic81   KM410085
              KM410086
Ccmic3        KM410048
              KM410049
              KM410050
Ccmic7        KM410055
COPYRIGHT 2017 Florida Entomological Society
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

 
Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research
Author:Todd, T.; Rendon, P.; Ruiz-Arce, R.
Publication:Florida Entomologist
Article Type:Report
Date:Mar 1, 2017
Words:11652
Previous Article:Attraction of Bactrocera cucurbitae and Bactrocera dorsalis (Diptera: Tephritidae) to beer waste and other protein sources laced with ammonium...
Next Article:Actual and potential distribution of five regulated avocado pests across Mexico, using the maximum entropy algorithm.
Topics:

Terms of use | Privacy policy | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters