Printer Friendly

Influence of resveratrol on rheumatoid fibroblast-like synoviocytes analysed with gene chip transcription.

ARTICLE INFO

Keywords:

Rheumatoid arthritis

Resveratrol

Fibroblast-like synoviocytes

Gene chip transcription analysis

Proliferation

Apoptosis

ABSTRACT

Rheumatoid arthritis (RA) is a chronic, systemic autoimmune disease that primarily attacks joints and is therefore a common cause of chronic disability and articular destruction. The hyperplastic growth of RA-fibroblast-like synoviocytes (FLSs) and their resistance against apoptosis are considered pathological hallmarks of RA. The natural antioxidant resveratrol is known for its antiproliferative and pro-apoptotic properties. This study investigated the effect of resveratrol on RA-FLS. RA-FLS were isolated from the synovium of 10 RA patients undergoing synovectomy or joint replacement surgery. RA-FLS were first stressed by pre-incubation with interleukin lbeta (IL-1[alpha]) and then treated with 100 [micro]M resveratrol for 24h. In order to evaluate the influence of resveratrol on the transcription of genes, a Gene Chip Human Gene 1.0 ST Array was applied. In addition, the effect of dexamethasone on proliferation and apoptosis of RA-FLS was compared with that of resveratrol. Gene array analysis showed highly significant effects of resveratrol on the expression of genes involved in mitosis, cell cycle, chromosome segregation and apoptosis. qRT-PCR, caspase-3/7 and proliferation assays confirmed the results of gene array analysis. In comparison, dexamethasone showed little to no effect on reducing cell proliferation and apoptosis. Our in vitro findings point towards resveratrol as a promising new therapeutic approach for local intra-articular application against RA, and further clinical studies will be necessary.

[c] 2012 Elsevier GmbH. All rights reserved.

Introduction

Rheumatoid arthritis (RA) is a chronic, systemic autoimmune disease that primarily attacks joints and is therefore a common cause of chronic disability due to articular destruction. Synovial hyperplasia, a characteristic of RA, is caused by the infiltration of inflammatory cells attributed to the proliferation of fibroblast-like synoviocytes (FLSs), as well as the resistance of RA-FLS against apoptosis (Firestein 2003).

The main goals of RA-treatment are to ameliorate symptoms of the disease (i.e. diminish pain) and to decrease both inflammation and joint destruction (Gelderman et al. 2007). Corticosteroids (e.g. dexamethasone) are among the drugs currently being used for the local infiltration of RA joints (sometimes also used for systemic medication) (Ostergaard and Halberg 1998; Grijalva et al. 2010). However, glucocorticoids are known to have many short and long-term complications, such as infection, osteonecrosis and osteoporosis (Grijalva et al. 2010; Yang et al. 2009).

Some antioxidants have the ability to modulate the expression of pro-inflammatory signals. In the treatment of RA, they offer very promising results, but extensive investigations in various preclinical and clinical settings are still necessary to prove their usefulness (Khanna et al. 2007). The antioxidant resveratrol (trans-3,4',5-trihydroxystilbene) has become the subject of intense research, due to its role in promoting longevity and cancer prevention (Gatz and Wiesmuller 2008). It is a pholyphenolic phytoalexin produced by plants in response to stress and has a wide range of pharmacological activities (Baur et al. 2006). Resveratrol has been reported to have anti-inflammatory (Csaki et al. 2008), antiproliferative (Csaki et al. 2008; Casagrande and Darbon 2001), pro-apoptotic (Byun et al. 2008; Li et al. 2011) and anticarcinogenic (Baur and Sinclair 2006) effects on different human cells.

As demonstrated by a large number of recent reports, resveratrol can mediate a wide range of biological activities with no obvious toxicity (Bishayee et al. 2010; Johnson et al. 2011). Williams et al. reported a total lack of systemic toxicity as well as genotoxicity and reproductive toxicity after a chronic administration of up to 700 mg/kg/day of resveratrol over a period of three months in rats (Williams et al. 2009). Johnson et al. determined the No Observed Adverse Effect Level (NOAEL) for resveratrol at 200 mg/kg/day in rats and 600 mg/kg/day in dogs (Johnson et al. 2011). Several in vivo studies have documented the overall safety of resveratrol in rodents (Bishayee et al. 2010).

The aim of our study is to increase the understanding of the antiproliferative and pro-apoptotic potency of resveratrol by identifying genes that underlie biological processes involved. In addition, we compared the effect of dexamethasone on proliferation and apoptosis with that of resveratrol.

Methods

Harvest of the synovial tissue and expansion of RA-FLS

RA-FLS were isolated from synovium of 10 RA patients (average age: 64.5 years, range: 52-77 years, 3 male and 7 female) undergoing synovectomy or joint replacement. Individual participants in this study provided written informed consent, and the study protocol was approved by the local ethics committee (nr. of ethics proposal: 19-111ex07/08; Ethical Committee of the Medical University of Graz, Austria).

Synovial membrane tissue was cut into 1 mm slices and rinsed several times with 1 x PBS. The synovial tissue was digested with 0.2% collagenase B (Roche Diagnostics, GER) in high glucose Dulbecco's-modified Eagle's medium (DMEM-HG; GIBCO Invitrogen, Darmstadt, GER) containing 10% foetal bovine serum (FBS; GIBCO, lnvitrogen), 1% L-glutamine (GIBCO Invitrogen), 100 units/ml penicillin (GIBCO Invitrogen), 100 [micro]g/m1 streptomycin (GIBCO Invitrogen) and 0.25 [micro]g amphotericin B (PM Laboratory, Pasching, AUT). After overnight incubation at 37[degrees]C, the cell suspension was filtered with a nylon membrane (Cell Strainer 40 [micro]m; BD Biosciences, Franklin Lakes, USA) and plated in T75 culture flasks (TPP, Trasadingen, SUI). Cells were cultured in growth medium at 37[degrees]C in a humidified atmosphere with 5% [CO.sub.2] for expansion. Each biological sample was cultured separately, and the biological replicates were obtained from different cultures and different patients. The medium was replaced every third day, and cells were passaged after reaching 70-90% confluence. Cells were cultured from three to a maximum of five passages in order to establish homogeneity.

Characterization of FLS using FACS analysis

1 x [10.sup.6] cells were counterstained with 1 [micro]g/ml of propidium iodide (PI, Molecular Probes, Invitrogen), and nonviable cells were excluded from living cells. Commercial monoclonal antibodies CD44PE, CD14FITC, CD90APC and CD68PE (BD Biosciences, San Jose, CA, USA) were applied for characterization, and each experiment contained isotype-matched control antibodies. The multicolour flow cytometric analysis was performed on a BD LSR II System (BD Biosciences). Data were acquired using BD FACS DivaTm software (BD Biosciences). The daily consistency of measurements was checked with Cytometer Setup and Tracking beads (BD Biosciences). To exclude debris, a forward scatter (FSC) versus side scatter (SSC) gate was used and analysed on a linear scale. FLS were defined by their phenotype ([CD90.sup.+], [CD44.sup.+], [CD68.sup.-], [CD14.sup.-] ) (Rosengren et al. 2007) and analysed on a logarithmic scale.

Cell viability and proliferation assay

For the cell viability/cell proliferation assay, RA-FLS were seeded at a density of 1 x [10.sup.4] cells/100 [micro]l DMEM-HG growth medium in luminescence-compatible 96 well microtiter plates (Brand, Wertheim, GER). The cells were allowed to grow overnight at 37[degrees]C in humidified atmosphere with 5% [CO.sub.2]. To simulate an inflammatory surrounding, cells were pre-stimulated with 10 ng/m1 IL-1[alpha] (13642; Sigma-Aldrich, Vienna, AUT) for 1 h before they were treated either with one of the three resveratrol (R5010; Sigma-Aldrich, Vienna, AUT) concentrations (50, 100 or 200 [micro]M) (Byun et al. 2008), or one of the three dexamethasone (D4902; Sigma-Aldrich, AUT) concentrations (0.5, 25 or 100 [micro]M) for 24 and 48 h. The ViaLight[R] Cell Proliferation Kit (Lonza, Verviers, BEL), which uses bioluminescent detection of cellular ATP as a measure of viability, was performed following the manufacturer's instructions in triplicates using a luminometer (LUM1star, BMG Labtech, Offenburg, GER).

To check the results of the proliferation assay, a "Wound Healing" in vitro model was performed. Human RA-FLS were plated in 12 well microtiter plates (TPP, Trasadingen, SUI) with DMEM-HG medium at 37[degrees]C in a humidified atmosphere with 5% [CO.sub.2]. When adherent cells reached 90% confluence, the monolayer was wounded with a sterile 200 [micro]L pipette tip, rinsed and pre-treated with 10 ng/ml 11-113 for 1 h. Subsequently, RA-FLS were incubated in media containing different concentrations of resveratrol (50, 100 or 200 [micro]M) or 100 [micro]M dexamethasone for 48 h. Over this period of time, the resettlement and viability of synovial cells were monitored photographically after 0, 24 and 48 h with an Olympus 1X71 microscope (Olympus, Hamburg, GER) and Olympus C-5060 digital camera. All pictures are shown at 100x magnification.

Apo-ONE[R] Homogeneous Caspase-3/7 Assay

RA-FLS were seeded at a density of 1 x [10.sup.4] cells in 96 well, pretreated with 10 ng/ml IL-1[alpha] for 1 h, and then treated with either 100 tiM resveratrol, 200 [micro]M resveratrol, or 25 [micro]M dexamethasone (Hossain et al. 2008) for 6, 24, 48, and 72 h. The samples of the Apo-ONE[R] Homogeneous Caspase-3/7 Assay (Promega, Mannheim, GER) were prepared according to the manufacturer's protocol and measured in quadruplicates (n = 4).

Gene Chip Human Gene 1.0 ST Array

To determine the transcriptional profile of resveratrol, three biological replicates were processed on Affymetrix Gene Chip Human 1.0 ST (n =3). RA-FLS were pre-treated with 10 ng/ml IL-1[alpha] for 1 h. Subsequently, the RA-FLS were incubated in a medium containing 100 [micro]M resveratrol for 24 h. Total RNA was extracted using RNeasy Kit (Qiagen, Hilden, GER) and quality controlled using the 2100 Bioanalyzer (Agilent Technologies, Vienna, AUT). Using the Gene Chip Whole Transcript Sense Target Labeling Kit (Affymetrix Inc., Santa Clara, CA, USA), 100 ng of total RNA were used to generate double-stranded cDNA. In accordance with the Affymetrix protocol, biotinylated cRNA targets were cleaned up and fragmented. Samples were hybridized overnight into arrays, which represent about 28,869 well-annotated human genes. After hybridization, the arrays were washed and stained with phycoerythrin-conjugated streptavidin and biotinylated antibody against streptavidin on the Gene Chip Fluidic station 450. Finally, the arrays were scanned with the Gene Chip Scanner 3000 (Affymetrix Inc.). Quality control of microarray data was performed using Affymetrix Expression Console. All data is MIAME compliant, and the raw data has been deposited in GEO (accession number: GSE31685), a MIAME-compliant database.

Quantitative real-time polymerase chain reaction (qRT-PCR)

qRT-PCR was performed to verify the Gene Chip array of resveratrol-treated RA-FLS. The relative expression of CDK1, CDK2, CCNB1, GTSE1, ITPR1, c-MYC, SRGAP3, HIST2H3D, HIST] H3J, TOP2A, CCNA2 and RHOJ was determined. The housekeeping gene GAPDH was used. The influence of dexamethasone was tested on the same selection of genes.

The RA-FLS were pre-treated (n = 7) in 1 x 6 well plates with 10 ng/ml IL-1[alpha] for 1 hand co-stimulated with 100 [micro]M resveratrol or with 50 [micro]M dexamethasone for 2411. Total RNA was obtained from resveratrol/dexamethasone treated RA-FLS and control cells using the RNeasy Mini Kit (Qiagen, Hilden, GER), as per the manufacturer's instructions. Total RNA was reverse transcribed using the High Capacity RNA-to-cDNA Master Mix (Applied Biosystems, Brunn am Gebirge, AUT). The designed primers for qRT-PCR are shown in Table 1 (purchased at Mwg-Biotech, Ebersberg, GER). Syber Mastermix was purchased from Roche (Light Cycler, Vienna, AUT). Quantitative gene expression was performed in duplicates on Light Cycler, and the data were normalized to GAPDH expression.

Table 1 Designed primer for qRT-PCR.

No  Oligo name         Sequence (written       Lengh  RefSeq
                       5'-3')

1   SYBR_RHOJ_fw       CAGAGGAATACCTGCCCACT       20  NM.020663

2   SYBR_RHOJ_rev      GAGGCAGGGTTTACGACAGA       20

3   SYBR_MYC_fw        TGCTCCATGAGGAGACACC        19  NM .002467

4   SYBR_JWYC_rev      GGATAGTCCTTCCGAGTGGAG      21

5   SYBR_T0P2A_fw      ATATTTTGCTCCGCCCAGA        19  NM.001067

6   SYBR_TOP2A_rev     TTGTTCTCCGCAGCATTAAC       20

7   SYBR_CCNA2_fw      CTGCACCCAGAAAACCATTG       20  NM.001237

8   SYBR_CCNA2_rev     AACCAGTCCACGAGGATAGC       20

9   SYBR_HIST2H3A_fw   TGCCCCGTACTAAGCACACT       20  NM.001005464

10  SYBR_HIST2H3A_rev  GCAGGTCCCTCTTAAAGTCC       20

11  SYBR_HISTlH3J_fw   AAGCAGACAGCTCGCAACTC       20  NM.O03535

12  SYBR_HIST1H3J_rev  GAAACGAAGCTCGGTTTTGA       20

13  SYBR_CCNBl_fw      TTTCGCCTGAGCCTATTTTG       20  NM .031966

14  SYBR_CCNBl_rev     TGACTGCTTGCTCTTCCTCA       20

15  SYBR_CDKI_fw       GGGTTCCTAGTACTGCAATTCG     20  NM.001786

16  SYBR.CDKl.rev      CAATCCCCTGTAGGATTTGG       20

17  SYBR_CDK2_fw       TGGTCCCGCTTAACAAAATC       20  NM.001798

18  SYBR_CDK2_rev      TGATGAGGCGAAGACCAATG       20

19  SYBR_SRGAP3_fw     AGCGCTTCTCCTCCAAAATC       20  NM.014850

20  SYBR_SRGAP3_rev    AGGCCAATCTCCTGCTCTT        20

21  SYBR_GTSEl_fw      CCCACTCTGCTCATGCTTT        19  NM.016426

22  SYBR_CTSE1_rev     GCAGGTTTGTCAGGGAGAAC       20

23  SYBR_ITPRl_fw      CCTGGTTGATGATCGTTGTG       20  NM .00109995
                                                      2
24  SYBR_ITPRl_rev     CGTGGTGCAGTTTCTTGACT       20

25  SYBR_GAPDH_fw      TGAAGCTCGGAGTCAACC         18  NM.002046.3

26  SYBR_CAPDH_rev     TTGATTTTGGAGGGATCTCG       20

CCNA2, cyclin A2; CCNB1, cyclin B1; CDK1, cyclin-dependent
kinase 1; CDK2, cyclin-dependent kinase 2; GAPDH,
glyceraldehyde-3-phosphate dehydrogenase; GTSE1, G-2 and
S-phase expressed 1; HIST, histone cluster; ITPR1, inositol
1,4,5-triphosphate receptor, type 1; MYC, myelocytomatosis
viral oncogene homolog; RHOJ, ras homolog gene family,
member J; SRGAP3, SLIT-ROBO Rho GIPase activating
protein 3; TOP2A, topoisomerase (DNA) Il alpha 170 kDa.


Statistical analysis

All values from the proliferation and the Apo-ONE[R] Homogeneous Caspase-3/7 Assay are expressed as mean values [+ or -] standard error of the mean (SEM). Student's unpaired t-test was used to evaluate the differences between the differentiated groups and their respective controls. Graphic data were prepared with Sigmaplot[R] data analysis and graphing software (Systat Software, San Jose, CA, USA). Data normalization and statistical analysis for the Gene Chip array were performed using Genomics Suite software (Partek, St. Louis, MO, USA). To find differentially expressed genes, a 1-way analysis of variance (ANOVA) was used. p-Values were filtered to less than or equal to 0.05, and deregulation of genes was filtered by a factor of fold change more than +1.5 (i.e. upregulation) or less than--1.5 (i.e. downregulation). Differentially expressed genes were categorized according to the biological processes and pathways in which they are involved and the molecular functions they code for by using the PANTHER database (http://www.pantherdb.org).

Results

Phenotypical characteristics

Fluorescence-activated cell sorting (FACS) analysis was performed for surface antigen expression of FLS by their phenotype. For each experiment, 10,000 events were analysed, and 93 [+ or -]6.2% viable cells were gated on forward scatter (FSC) versus side scatter (SSC). Fig. 1 shows representative examples of three independent FACS experiments. In the analysis, the negative staining for CD68 (0.45 [+ or -]0.49%; 1A) and CD14 (0.1 [+ or -] 0.14%; 1C), verified the absence of synovial macrophages, while positive staining for CD44 (99.7 [+ or -]0.14%; 1B) and CD90 (90.2 [+ or -] 6.73%; 1A) verified the presence of FLS in our in vitro culture. CD90 is specifically expressed on FLS in the synovial membrane, and CD44 is highly expressed on both cultured FLS and synovial macrophages (Rosengren et al. 2007). Since macrophages have already been excluded, it can be assumed that a pure FLS culture is expanded. Experimental results are expressed as mean values [+ or -] SEM.

Effect of resveratrol on the migration and viability of RA-FIS

In the proliferation assay, RA-FLS treated with resveratrol showed a highly significant reduction in cell proliferation. After 24h of incubation, the 50, 100 and 200 p.M resveratrol samples caused decreases in cell proliferation of 24 [+ or -] 2% (p < 0.001), 56 [+ or -] 2.5%(p < 0.001) and 72 [+ or -] 0.7%(p <0.001), respectively (Fig. 2A). Increasing the incubation duration to 48h did not reduce cell proliferation any further (data not shown). In contrast, after 24h of incubation, dexamethasone at concentrations of 0.5, 25 and 100 [micro]M showed a decrease in RA-FLS of 6[+ or -]1.6%, 11[+ or -]1.5% and 17+2%, respectively (Fig. 2B), which is an insignificant antiproliferative effect. Increasing the incubation duration to 48 h did not further reduce cell proliferation (data not shown).

Fig. 2C offers a photographic documentation of the inhibitory effect of resveratrol and dexamethasone on cell proliferation in wounded RA-FLS monolayers. The first column shows the IL-1[beta] pre-stimulated cells at different time points serving as control. At the beginning of the experiment (hour 0), a clear-cut surface can be seen. Afterwards, the wound becomes overgrown by RA-FLS. After 48 h of incubation time, no wound can be detected. The second column demonstrates the "Wound Healing" assay with 100 [micro]M dexamethasone treatment. The cut that was present at the beginning is hardly visible after 48 h of incubation time, even though such a high concentration of dexamethasone was used. This correlates with our ViaLight assay (Fig. 2B). The last column illustrates the antiproliferative effect of 100[micro]M resveratrol (data of other concentrations are not shown). Time point 0 shows the clear cut. After 24 h of incubation, a few RA-FLS grew into the wound, and the lesion is still clearly visible after 48 h of incubation time.

[FIGURE 2 MITTED]

Apo-ONE[R] Homogeneous Caspase-3/7 Assay

The caspase-3/7 activity was measured in cultured RA-FLS at concentrations of 100 [micro]M resveratrol, 200 [micro]M resveratrol and 25[micro]M dexamethasone at four different time points (6, 24, 48, and 72 h). Resveratrol caused a significant increase in the caspase-3/7 activity, which was dependent on the dose and incubation time. The dose of 100 [micro]M resveratrol caused a significant increase of caspase-3/7 activity after 48h (p < 0.001) and 72h (p < 0.001). A significant increase of the caspase-3/7 activity at a concentration of 200[micro]M resveratrol was also detected after 48 h (p < 0.001 ) and 72 h (p <0.001). Dexamethasone treatment, in contrast, showed no significant increase in the caspase-3/7 activity over time (Fig. 3A). Fig. 3B provides all mean values and the standard deviations for the caspase-3/7 assay.

Gene Chip Human 1.0 ST Array

The Affymetrix Gene Chip Human 1.0 ST Array allowed us to analyse the influence of resveratrol on 28,869 well-annotated human genes. Subsequently, the Partek Genomic Suite software was used to extract the data on the genes whose expression was significantly influenced by resveratrol. This information was imported into the PANTHER database. PANTHER analysis assigned the influenced genes to specific biological processes. A greater part was active in cell division and was significantly downregu-lated by resveratrol treatment in RA-FLS. These biological processes include mitosis (p <0.001), cell cycle (p <0.001), chromosomal segregation (p <0.001) and cytokinesis (p <0.001). Furthermore, the process of meiosis is significantly downregulated (p < 0.001), as well as the DNA replication (p < 0.001) and the p-53 pathway (p < 0.001). In contrast, resveratrol upregulated the platelet derived growth factor (PDGF) signalling pathway. Table 2 offers detailed information (including p-value and fold change) about specific significantly regulated genes dedicated to DNA replication, p-53 - and PDGF signalling pathway. Resveratrol significantly influenced the transcription of genes that are involved in DNA replication (down-regulation of HIST2H3D, HIST1H3J, CDK1 and TOP2A; Table 2). In addition, the transcription of genes influencing the p53 pathway was downregulated (CDK1, CDK2, CCNB1 and GTSE; Table 2). On the other hand, the transcriptions of the PDFG signalling pathway-influencing genes were upregulated (ITPR1, c-MYC and SRGAP3; Table 2). Two genes, cyclin A2 (CCNA2) and ras homolog gene family member J (RHOJ), are also listed. These two genes, which both participate in the apoptotic process, were down regulated by resveratrol.

Table 2

Significant transcriptionally influenced genes selected by
PANTHER which are involved in DNA replication, p-53
pathway and PDGF signalling pathway.

* Pathways    [dagger]  Up/down  * Fold        #
                 Genes           change  p-Value

DMA           HIST2H3D     Down    1.66   0.0018
replication

              HIST1H3J     Down    1.89    0.005

                  CDK1     Down    3.18    0.029

                 TOP2A     Down    3.58    0.026

p-53 pathway      CDK1     Down    3.18    0.029

                  CDK2     Down    1.70    0.026

                 CCNB1     Down    4.43    0.049

                 CTSE1     Down    2.68    0.016

PDGF             ITPR1       Up    1.96    0.031
signalling

pathway          c-MYC       Up    1.53     0.02

                SRCAP3       UP    1.64    0.013

Unclassified     CCNA2     Down    4.18    0.032

                  RHOJ     Down    3.62    0.014

* Significantly influenced pathways.


[dagger] Significantly expressed genes in the influenced pathway.

[degrees] Fold change between 1L-1[beta] pre-treated
RA-FLS and RA-FLS subsequently treated with resveratrol.
Values above 1.5 show upregulation in described
genes: values below--1.5 shows downregulation in
described genes.

# p-Values were filtered to less than or equal to 0.05
showing the significance of the fold change. A small
p-value indicates the fold change observed in the
experiments is significant and potentially important.


As an exploratory data analysis, we chose the principal component analysis (PCA) to identify the major effects of resveratrol treatment. The PCA in Partek Genomic Suite software is unique in two important ways: data do not have to be prefiltered, and the graphics used by PCA are true three-dimensional graphic representations. Samples that are close together are similar across the whole genome, whereas samples that are far apart are dissimilar across the whole genome (Downey 2006). In Fig. 4A, a PCA visualizes the variance in IL-1[beta] pre-stimulated RA-FLS control (red) and RA-FLS with 100 [micro]M resveratrol treatment (blue). The two groups are distinct from each other, and each group is closely bounded. Fig. 4B shows a hierarchical clustering of three different biological samples (synoviocytes (S)4, S2 and S41). The control and treatment of each sample are located close together. Synoviocytes S2 and S41 are closer related in their expression profile than S4.

Quantitative real-time PCR (qRT-PCR)

The qRT-PCR was performed to verify the results of the Gene Chip array. Fig. 5 provides additional information for Table 2 by comparing the fold changes from qRT-PCR with those from Gene Chip array. The qRT-PCR confirms the Gene Chip array of resveratrol-treated RA-FLS. Both methods show a downregulation of DNA replication and p53 pathway-involved genes HIST2H3D, HIST1H3J, CDK1, TOP2, CDK1, CDK2, CCNB1 and GTSE, as well as CCNA2 and RHOJ. ITPR1, c-MYCand SRGAP3, which are all involved in the PDGF signalling pathway, were also upregulated using qRT-PCR. Examining the influence of dexamethasone treatment on selected genes, a different regulation can be identified, except in the cases of ITPR1, c-MYC and SRGAP3.

Discussion

Several published studies have shown that oxidative stress fosters the development of RA (Kawaguchi et al. 2011; Desai et al. 2010) and some publications have pointed to the possible therapeutic approach of resveratrol in RA (Byun et al. 2008; Nakayama et al. 2012).

Elmali et al. (2007) have already shown that resveratrol administered intra-articular once daily (concentration of 10 [micro]mol/kg) in experimental OA in rabbits is effective in reducing the severity of cartilage lesion and is also associated with milder synovial hyperplasia, not harming soft tissue, cartilage or bone. By offering cellular and genetic evidence of the antiproliferative and pro-apoptotic effects of resveratrol in FLS, our in vitro study supports the conclusion that resveratrol can have a protective effect on human RA-joints.

Effects of resveratrol on proliferation

As a consequence of their altered morphology and cellular activation, RA-FLS exhibit a distinct, independent growth pattern with regards to proliferation, along with an aggressive and invasive behaviour (Pap et al. 2000; Fassbender 1983; Lafyatis et al. 1989).

Our proliferation assay showed that resveratrol causes significant reduction in cell proliferation (see results for detailed data), while dexamethasone showed no significant antiproliferative effect on RA-FLS related to dose or incubation time. The selection of resveratrol concentrations was based on a dose-effect curve, in which 100[micro]M was the IC50 concentration obtained. In addition, the concentrations used here were consistent with those used by Byun and his study group (Byun et al. 2008). The following genes related to cell proliferation and cell cycle were downregulated by resveratrol:

* CDK1 and CDK2 are Ser/Thr kinases. CDK1 is essential for G1 /S and G2/M phase transitions (http://www.ncbi.nlm.nih.gov/gene/983), while CDK2 activity is restricted to the Cl-S phase and therefore essential for cell cycle G1 /S phase transition (http://www.ncbi.nlm.nih.govigene/1017). Resveratrol, downregulating the expression of both genes, is known to cause an accumulation of cells at the sub-G1 and S phases of the cell cycle, and inhibits cell proliferation depending on time and dose in LNCaP prostate cancer cell lines (Jones et al. 2005). Moreover, the downregulation of CDK2 after resveratrol treatment in incubated embryonic cardiomyoblasts may explain the accumulation of cell populations in the G1 phase (Leong et al. 2007). Dexamethasone, on the other hand, increased the expression of CDK1 and CDK2 in our qRT-PCR assay. These data do not support the reduced levels of CDK1 kinase in dexamethasone-treated rat pituitary tumour cells (Delidow et al. 2002) or the decreased activity of CDK2 in lung cancer cells which have been reported (Greenberg et al. 2002).

* CCNA2 belongs to the highly conserved cyclin family, which function as regulators of CDK kinases. This cyclin binds and activates CDK1 or CDK2 kinases and thus promotes both cell cycle G1/S and G2/M transitions (http://www.ncbi.nlm.nih.gov/gene/890). CCNA2 is downregulated by resveratrol and upregulated by dexamethasone.

* Cunha et al. (2010) identified genes associated with local aggressiveness and metastatic behaviour in soft tissues tumour. According to them, TOP2A, a gene involved in increasing metabolism, cell migration, cell cycle, cell proliferation, and malignant transformation (Chiang and Massague 2008) may be related to metastatic potential. This is very interesting with respect to the ability of RA-FLS to spread RA to unaffected joints (Lefevre et al. 2009). To evaluate the connection between the spreading of RA-FLS and TOP2A, a further study is necessary. In our study, TOP2A is downregulated by resveratrol, but upregulated by dexamethasone. This emphasizes the antiproliferative effect of resveratrol.

* CCNB1 encodes a regulatory protein that is involved in mitosis (http://www.ncbi.nlm.nillgov/gene/891). In our study. CCNB1 is downregulated in the presence of resveratrol, but upregulated by dexamethasone.

* RHOJ contributes to cell proliferation, motility and the establishment of cellular polarity. It is also involved in pathophysiological processes, such as cell transformation and metastasis (http://www.ncbi.nlm.nih.govigene/57381). RHOJ is significantly downregulated by resveratrol, but upregulated in the presence of clexamethasone.

All these data indicate that resveratrol has a cell cycle suppressing and anti proliferative effect on RA-FLS. Dexamethasone, in contrast, does not decrease proliferation and cell-cycle-associated genes in RA-FLS.

Pro-apoptotic effects of resveratrol

Byun et al. (2008) demonstrated for the first time that resveratrol caused extensive apoptotic death in RA-FLS by converging on the mitochondrial-signalling pathway. They showed that resveratrol-induced apoptosis in RA-FLS accompanies the release of cytochrome c and AIF, together with the activation of caspase-9 and -3. Resveratrol also inhibited acute myeloid leukemia (AML) cell proliferation and activated caspase-3, thus inducing apoptotic cell death in AML cells (Estrov et al. 2003). In addition, Huang et al. (1999) reported that resveratrol suppresses cell transformation and induces apoptosis in a p53-dependent manner, and other studies have indicated that resveratrol prevents the death programme induced in K562 cells by oxidative stress and other related stimuli (MacCarrone et al. 1999).

In our study, resveratrol activated caspase-3/7, which has a pro-apoptotic effect in cultured RA-FLS. Dexamethasone, on the other hand, showed no increase of caspase-3/7 activity at the concentrations and incubation times we used. Furthermore, it showed no pro-apoptotic effect in cultured RA-FLS (Fig. 3).

Caspase-3/7 Assay

                       6h         24h          48h         72 h

Ctrl vs Res    92[+ or -]  91[+ or -]  106[+ or -]  162[+ or -]
100 [micro]M        5.4%        5.6%          8.9%       45.4%

Ctrl vs Res    90[+ or -]  91[+ or -]  113[+ or -]  156[+ or -]
200 [micro]M        8.3%        5.7%         16.3%       52.8%

Ctrl vs Dex    91[+ or -]  91[+ or -]   94[+ or -]  101[+ or -]
25 [micro]M         5.9%        5.7%          7.2%        3.7%

Fig. 3. Caspase 3/7 Assay from 5 RA patients: (A) 100 pM resveratrol
caused a significant increase of caspase-3/7 activity after 48h
(p <0.001) and reached its peak after 72 h (p <0.001). 200 [micro] M
resveratrol also showed a significant increase after 48 h (p
<0.001). and the maximum was reached after 72 h (p <0.001).
Dexamethasone caused no significant increase in caspase-3/7
activity with the concentrations and incubation times used.
Values are expressed as normalized to control cultures with
11-113 stimulation only and (B) All mean values and standard
deviations for the caspase-3/7 assay are shown.


The following genes are related to apoptosis and downregulatecl by resveratrol:

* GTSE1 is only expressed in the S phase and G2 phase of the cell cycle, where it co-localizes with cytoplasmic tubulin and microtubules. In response to DNA damage, the encoded protein accumulates in the nucleus and binds the tumour suppressor protein p53 (http://www.ncbi.nlm.nih.gov/gene/51512) (which plays a key role in regulating cell hyperplasia, repairing DNA and inducing apoptosis (Tang et al. 2011)), thereby shuttling it out of the nucleus and repressing its ability to induce apoptosis ( http://www.ncbi.nlm.nih.govigene/51512). GTSE1 is significantly downregulated (all fold changes can be seen in Fig. 5) by resveratrol. This implies a pro-apoptotic effect of resveratrol. GTSE1 is upregulated in the presence of dexamethasone, while resveratrol has the opposite effect. No data about dexamethasone-influenced GTSE1 expression can be found in the current literature.

MWFold Change

     MWold
     Change

               RHOJ  C.MYC  TOP2A  CCNA2  HIST2H3A  HIST1H3J  CCNB1

Res  Gene     -3.62   1.53  -3.58  -4.18     -1.68     -1.89  -4.43
     Chip

     qRT-PCR  -3.64   1.63  -3.41  -4.35     -0.51     -2.68  -3.16

Dex  qRT-PCR   2.77   7.11   3.85  11.25      4.46      3.37   3.69

     MWold
     Change

              CDK1   CDK2  SRGAP3  GTSE1  ITPR1

Res  Gene     3.18   -1.7    1.64  -2.68   1.96
     Chip

     qRT-PCR  3.79  -1.79    3.04  -6.08   4.11

Dex  qRT-PCR  2.15   1.67    1.81   3.37   2.03

Fig. 5. qRT-PCR validation of selected gene expressions
in RA-FLS. (A) qRT-PCR confirms the regulation of gene
expression obtained by Gene Chip array after resveratrol
treatment. The outcome of dexamethasone is different to
resveratrol treatment, except that the expression of
ITPRI c-MYC and SRGAP3 exhibit an upregulation as well
and (B) Additional mean values of fold changes to
Fig. 5A.


* c-MYC is a multifunctional, nuclear phosphor-protein that is involved in cell cycle progression, apoptosis and cellular transformation (Amati et al. 1993). It is expressed in dividing synovial cells from patients with RA (Qu et al. 1994) and is thought to be involved in cellular activation and proliferation. A study by Evan et al. (1992) reports that Rat-1 fibroblasts constitutively expressing c-MYC easily induced apoptosis based on the level of c-MYC expression. While these studies complicate the role of c-MYC, there is further evidence that c-MYC is closely related to apoptosis. For example, Kimura et al. (1995) show that c-MYCabrupt upregulation rapidly drives a considerable number of HL-60 cells into the apoptotic pathway. Another study group reported that over-expression of c-MYC was associated with a high incidence of apoptosis in rodent fibroblast tumours (Wyllie et al. 1987). A further study suggests that c-MYC antisense oligodeoxynucleotides might be a therapeutic tool in RA and clarifies that cell death by c-MYC antisense oligodeoxynucleotides is induced through the caspase cascade, similar to Fas-induced apoptosis (Hashiramoto et al. 1999). In our study, c-MYC is upregulated by resveratrol and therefore offers evidence that resveratrol may have a pro-aptotic effect. Dexamethasone also caused an upregulation of c-MYC. This is in agreement with reported results, in which c-MYC mRNA was upregulated by dexamethasone at almost every stage of differentiation in primary osteoblast cultures (Gabet et al. 2011).

SRGAP3, which is also involved in cell cycle progression and apoptosis (http://pantherdb.org), is further upregulated in the presence of resveratrol and dexamethasone. These data emphasize the high pro-apoptotic potency of resveratrol, and dexamethasone also showed a pro-apoptotic tendency.

Based on our gene chip transcription, no specific cartilage-protective effect could be shown. Alongside the research of Byun et al. (2008) our study provides the basis for further examinations of resveratrol on RA in human beings.

In conclusion, our results suggest that the pro-apoptotic and antiproliferative effects of the stilbene resveratrol (3,4',5-trihydroxy-trans-stilbene) make it potentially useful as a local treatment of RA-FLS in terms of their behaviour of rapid proliferation and defective apoptosis.

Further investigations in well-designed clinical trials are required to establish resveratrol as a supplement to currently used drugs for local intra-articular RA treatment. Evaluation of the correct time-dependant dosage of intra-articular injected resveratrol will be a challenge in future experiments for the application of in vitro experiments on human subjects.

Acknowledgements

This research is supported by the Jubilee Fund of the Austrian National Bank (OENB 12953). The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. All authors hereby declare that they have no conflicts of interest. The authors would like to thank Heike Kaltenegger and Elisabeth Wolf, for their excellent technical assistance with cell cultures, Alexandra Novak for technical assistance with five-colour flow cytometric analysis, and Karin Wagner for her assistance in gene array analysis. The authors would also like to thank Alexander Avian for his assistance with statistics during this study and Michael Phillips for language editing.

* Corresponding author. Tel.: +43 31638581407: fax: +43 31638514806.

E-mail address: maggiebreisach@hotmail.com (M. Fritsch-Breisach).

0944-7113/$--see front matter [c] 2012 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.phymed.2012.09.020

References

Amati. B., Littlewood, T.D., Evan, GA., Land, H., 1993. The c-Myc protein induces cell cycle progression and apoptosis through dimerization with Max. The EMBO Journal 12, 5083-5087.

Baur, J.A., Pearson, K.J., Price, NI.. Jamieson. H.A., Lerin, C., et al., 2006. Resveratrol improves health and survival of mice on a high-calorie diet. Nature 444. 337-342.

Baur. J.A., Sinclair, D.A., 2006. Therapeutic potential of resveratrol: the in vivo evidence. Nature Reviews Drug Discovery 5, 493-506.

Bishayee, A., Darvesh, A.S., Politis, T., McGory, R..2010. Resveratrol and liver disease: from bench to bedside and community. Liver International 30(8), 1103-1114.

Byun, H.S., Song, J.K., Kim, Y.R., Piao, L, Won, M., et al., 2008. Caspase-8 has an essential role in resveratrol-induced apoptosis of rheumatoid fibroblast-like synoviocytes. Rheumatology 47, 301-308.

Casagrande. F., Darbon, J.M., 2001. Effects of structurally related flavonoids on cell cycle progression of human melanoma cells: regulation of cyclin-dependent kinases CDK2 and CDK1. Biochemical Pharmacology 61. 1205-1215.

Chiang, A.C., Massague, J., 2008. Molecular basis of metastasis. New England Journal of Medicine 359, 2814-2823.

Csaki, C., Keshishzadeh, N., Fischer, K., Shakibaei, M., 2008. Regulation of inflammation signalling by resveratrol in human chondrocytes in vitro. Biochemical Pharmacology 75, 677-687.

Cunha, I.W., Carvalho, K.C., Martins, W.K.. Marques, S.M., Muto, N.H., et al., 2010. Identification of genes associated with local aggressiveness and metastatic behavior in soft tissue tumors. Translational Oncology 3, 23-32.

Delidow, B.C.. Wang, M.. Bhamidipaty, S.V., Black, LD., 2002. Glucocorticoid inhibition of 235-1 rat pituitary tumor cell cycle progression. Endocrine 17, 119-127.

Desai, P.B., Manjunath, S., Kadi, S., Chetana, K., Vanishree, J., 2010. Oxidative stress and enzymatic antioxidant status in rheumatoid arthritis: a case control study. European Review for Medical and Pharmacological Sciences 14.959-967.

Downey, T., 2006. Analysis of a multifactor microarray study using partek genomics solution. Methods in Enzymology 411, 256-270.

Elmali, N., Baysal, 0., Harma, A., Esenkaya, I., Mizrak, B., 2007. Effects of resveratrol in inflammatory arthritis. Inflammation 30, 1-6.

Estrov, Z., Shishodia, S., Faderl, S., Harris, D., Van, Q, et al., 2003. Resveratrol blocks interleukin-1 beta-induced activation of the nuclear transcription factor NF-kappaB, inhibits proliferation, causes S-phase arrest, and induces apoptosis of acute myeloid leukemia cells. Blood 102, 987-995.

Evan, GI, Wyllie, A.H., Gilbert, C.S., Littlewood. T.D., Land, H., et al., 1992. Induction of apoptosis in fibroblasts by c-myc protein. Cell 69, 119-128.

Fassbender, H.G., 1983. Histomorphological basis of articular cartilage destruction in rheumatoid arthritis. Collagen and Related Research 3,141-155.

Firestein, G.S., 2003. Evolving concepts of rheumatoid arthritis. Nature 423.356-361.

Gabet, Y., Noh, T., Lee, C., Frenkel, B., 2011. Developmentally regulated inhibition of cell cycle progression by glucocorticoids through repression of cyclin a transcription in primary osteoblast cultures. Journal of Cellular Physiology 226, 991-998.

Gatz, S.A., Wiesmuller, L, 2008. Take a break - resveratrol in action on DNA. Carcinogenesis 29, 321-332.

Gelderman, K.A., Hultqvist, M., Olsson, LM., Bauer, K., Pizzolla. A., et al., 2007. Rheumatoid arthritis: the role of reactive oxygen species in disease development and therapeutic strategies. Antioxidants and Redox Signalling 9, 1541-1567.

Greenberg, A.K., Hu, J., Basu, S., Hay, J., Reibman, J., Yie, T.A., et al., 2002. Glucocorticoids inhibit lung cancer cell growth through both the extracellular signal-related kinase pathway and cell cycle regulators. American Journal of Respiratory Cell and Molecular Biology 27, 320-328.

Grijalva, C.G., Kaltenbach, L, Arbogast, P.G., Mitchel Jr., E.F., Griffin, M.R., 2010. Initiation of rheumatoid arthritis treatments and the risk of serious infections. Rheumatology 49. 82-90.

Hashiramoto, A., Sano, H., Maekawa, T., Kawahito, Y., Kimura, S., Kusaka, Y., Wilder, R.L. Kato, H., Kondo, M., Nakajima, H., 1999. C-myc antisense oligodeoxynu-cleotides can induce apoptosis and down-regulate Fas expression in rheumatoid synoviocytes. Arthritis and Rheumatism 42, 954-962.

Hossain, MA, Park, J., Choi, S.H., Kim, G., 2008. Dexamethasone induces apoptosis in proliferative canine tendon cells and chondrocytes. Veterinary and Comparative Orthopaedics and Traumatology 21, 337-342.

Huang, C., Ma, W.Y., Goranson, A., Dong, Z., 1999. Resveratrol suppresses cell transformation and induces apoptosis through a p53-dependent pathway. Carcinogenesis 20, 237-242.

Johnson, W.D., Morrissey, R.L, Usborne, A.L, Ka petanovic, I., Crowell, J.A., Muzzio, M., McCormick, D.L., 2011. Subchronic oral toxicity and cardiovascular safety pharmacology studies of resveratrol, a naturally occurring polyphenol with cancer preventive activity. Food and Chemical Toxicology 49(12), 3319-3327.

Jones, S.B., DePrimo, S.E., Whitfield, M.L, Brooks, J.D., 2005. Resveratrol-induced gene expression profiles in human prostate cancer cells. Cancer Epidemiology, Biomarkers and Prevention 14, 596-604.

Kawaguchi. IC., Matsumoto, T., Kumazawa, Y., 2011. Effects of antioxidant polyphe-nols on TNF-alpha-related diseases. Current Topics in Medicinal Chemistry 11, 1767-1779.

Khanna, D., Sethi, G., Ahn, K.S., Pandey, M.K., Kunnumakkara, A.B., et al.. 2007. Natural products as a gold mine for arthritis treatment. Current Opinion in Pharmacology 7, 344-351.

Kimura, S., Maekawa, T., Hirakawa, K., Murakami. A., et al., 1995. Alterations of c-myc expression by antisense oligodeoxynucleotides enhance the induction of apoptosis in HL-60 cells. Cancer Research 55, 1379-1384.

Lafyatis, R., Remmers, E.F., Roberts, A.B., Yocum, D.E., Sporn, M.B., Wilder, R.L. 1989. Anchorage-independent growth of synoviocytes from arthritic and normal joints. Stimulation by exogenous platelet-derived growth factor and inhibition by transforming growth factor-beta and retinoids. Journal of Clinical Investigation 83, 1267-1276.

Lefevre, S., Knedla, A., Tennie, C., Kampmann, A., et al., 2009. Synovial fibroblasts spread rheumatoid arthritis to unaffected joints. Nature Materials 15, 1414-1420.

Leong, C.W., Wong, C.11., Lao, S.C., Leong, E.C., Lao, I.F., et al., 2007. Effect of resveratrol on proliferation and differentiation of embryonic cardiomyoblasts. Biochemical and Biophysical Research Communications 360, 173-180.

Li, G., He, S., Chang, L, Lu, H., Zhang, H., Zhang, H.. Chiu, J.. 2011. GADD45cx and annexin Al are involved in the apoptosis of HL-60 induced by resveratrol. Phy-tomedicine 15, 704-709.

MacCarrone, M., Lorenzon, T., Guerrieri, P., Agro, A.F., 1999. Resveratrol prevents apoptosis in 1<562 cells by inhibiting lipoxygenase and cyclooxygenase activity. European Journal of Biochemistry 265, 27-34.

Nakayama, H., Yaguchi, T., Yoshiya, S., Nishizaki, T., 2012. Resveratrol induces apoptosis MH7A human rheumatoid arthritis synovial cells in a sirtuin 1-dependent manner. Rheumatology International 32, 151-157.

NCBI National Center for Biotechnology Information: Genes and Mapped Phenotypes. http://www.ncbi.nlm.nih.gov/gene/890

NCBI National Center for Biotechnology Information: Genes and Mapped Phenotypes. http://www.ncbi.nlm.nih.gov/gene/891

NCBI National Center for Biotechnology Information: Genes and Mapped Phenotypes. http://www.ncbi.nlm.nih.gov/gene/983

NCBI National Center for Biotechnology Information: Genes and Mapped Phenotypes. http://www.ncbi.nlm.nih.gov/gene/l017

NCBI National Center for Biotechnology Information: Genes and Mapped Phenotypes. http://www.ncbi.nlm.nih.gov/gene/51512

NCBI National Center for Biotechnology Information: Genes and Mapped Phenotypes. http://www.ncbi.nlm.nih.gov/gene/57381

Ostergaard, M., Halberg, P., 1998. Intra-articular corticosteroids in arthritic disease: a guide to treatment. BioDrugs 9, 95-103.

PANTHER Classification System: Genes and Orthologs. http://pantherdb.org./genesigene.do?acc=HUMANIENSEMBL=ENSG000001962201UniProtKB=043295

Pap, T., Muller-Ladner, U., Gay, R.E., Gay, S., 2000. Fibroblast biology, role of synovial fibroblasts in the pathogenesis of rheumatoid arthritis. Arthritis Research 2, 361-367.

Qu, Z., Garcia, C.H., O'Rourke. L.M., Planck, S.R., et al., 1994. Local proliferation of fibroblast-like synoviocytes contributes to synovial hyperplasia. Results of proliferating cell nuclear antigen/cycl in, c-myc, and nucleolar organizer region staining. Arthritis and Rheumatism 37, 212-220.

Rosengren, S., Boyle. D.L. Firestein, G.S., 2007. Acquisition, culture, and phenotyping of synovial fibroblasts. Methods in Molecular Medicine 135, 365-375.

Tang. B.X., You. X., Zhao, LD., Li, Y., Zhang, X., et al., 2011. p53 in fibroblast-like syn-oviocytes can regulate T helper cell functions in patients with active rheumatoid arthritis. Chinese Medical journal 124, 364-368.

Williams, L.D., Burdock, G.A., Edwards, J.A., Beck, M., Bausch, J., 2009. Safety studies conducted on high-purity trans-resveratrol in experimental animals. Food and Chemical Toxicology 47(9), 2170-2182.

Wyllie, A.H., Rose, K.A., Morris, R.G., Steel, C.M., Foster, E.. Spandidos, D.A., 1987. Rodent fibroblast tumours expressing human myc and ras genes: growth, metastasis and endogenous oncogene expression. British Journal of Cancer 56, 251-259.

Yang, L., Boyd, K.. Kaste, S.C., Kamdem Kamdem, L., Rahija, R.J., et al., 2009. A mouse model for glucocorticoid-induced osteonecrosis: effect of a steroid holiday. Journal of Orthopaedic Research 27, 169-175.

Mathias Glehr (a), Margherita Fritsch-Breisach (a),*, Birgit Lohberger (a), Sonja Maria Walzer (b), Florentine Moazedi-Fuerst (c), Beate Rinner (d), Gerald Gruber (a), Winfried Graninger (c), Andreas Leithner (a), Reinhard Windhager (b)

(a.) Department of Orthopaedic Surgery, Medical University of Graz, Auenbruggerplatz 5, A-8036 Graz, Austria

(b.) Department of Orthopaedic Surgery, Medical University of Vienna, Wahringer Gurtel 18-20, A-1090 Wien, Austria

(c.) Department of Rheumatology, Medical University of Graz, Auenbruggerplatz 15, A-8036 Graz, Austria

(d.) Center of Medical Research, Medical University of Graz, Stiftingtalstrasse 24, A-8010 Graz, Austria
COPYRIGHT 2013 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2013 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Glehr, Mathias; Fritsch-Breisach, Margherita; Lohberger, Birgit; Walzer, Sonja Maria; Moazedi-Fuerst
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Article Type:Report
Geographic Code:4EUAU
Date:Feb 15, 2013
Words:7010
Previous Article:Ginkgo biloba leaves extract (EGb 761) attenuates lipopolysaccharide-induced acute lung injury via inhibition of oxidative stress and...
Next Article:In vitro and in vivo anti-inflammatory effects of 4-methoxy-5-hydroxycanthin-6-one, a natural alkaloid from Picrasma quassioides.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters