Printer Friendly

Infection-stimulated Anemia Results Primarily from Interferon Gamma-dependent, Signal Transducer and Activator of Transcription 1-independent Red Cell Loss.

Byline: Zheng. Wang, Dong-Xia. Zhang, Qi. Zhao

Background: Although the onset of anemia during infectious disease is commonly correlated with production of inflammatory cytokines, the mechanisms by which cytokines induce anemia are poorly defined. This study focused on the mechanism research. Methods: Different types of mice were infected perorally with Toxoplasma gondii strain ME49. At the indicated times, samples from each mouse were harvested, processed, and analyzed individually. Blood samples were analyzed using a Coulter Counter and red blood cell (RBC) survival was measured by biotinylation. Levels of tumor necrosis factor-a (TNF-a), inducible nitric oxide synthase (iNOS), and inducible protein 10 (IP-10) mRNA in liver tissue were measured by real-time polymerase chain reaction. Results: T. gondii-infected mice exhibited anemia due to a decrease in both erythropoiesis and survival time of RBC in the circulation (P < 0.02). In addition, infection-stimulated anemia was associated with fecal occult, supporting previous literature that hemorrhage is a consequence of T. gondii infection in mice. Infection-induced anemia was abolished in interferon gamma (IFNa) and IFNa receptor deficient mice (P < 0.05) but was still evident in mice lacking TNF-a, iNOS, phagocyte NADPH oxidase or IP-10 (P < 0.02). Neither signal transducer and activator of transcription 1 (STAT1) deficient mice nor 129S6 controls exhibited decreased erythropoiesis, but rather suffered from an anemia resulting solely from increased loss of circulating RBC. Conclusions: Infection-stimulated decrease in erythropoiesis and losses of RBC have distinct mechanistic bases. These results show that during T. gondii infection, IFNa is responsible for an anemia that results from both a decrease in erythropoiesis and a STAT1 independent loss of circulating RBC.

Introduction

Anemia accompanies a variety of chronic illnesses including inflammatory disorders, neoplasia, and infection. [sup][1] In some infection diseases such as Mycoplasma pneumoniae , anemia correlates with increased risk of early death. [sup][2] Correlative clinical reports, supported by in-vitro studies, suggest a significant role for the inflammatory cytokines interferon gamma (IFNa) and tumor necrosis factor-a (TNF-a) in the onset of anemia. [sup][3],[4] However, direct in-vivo studies of the causes of anemia during infectious disease have not been performed, and the underlying mechanisms remain poorly defined.

Interferon gamma critically mediates host resistance to numerous infections. Deficiencies in the production of IFNa or the IFNa receptor (IFNa-R) result in impaired resistance to bacterial, [sup][5] viral, [sup][6] and parasitic infections. [sup][7] IFNa initiates protection from infection by inducing the expression of genes that enhance immunity and exert antimicrobial functions. [sup][8] In addition to its well-recognized protective effects, pathological effects have also been attributed to IFNa production during viral, [sup][6] helminth, [sup][9] and parasitic [sup][10],[11] infections. Specifically, production of IFNa has been correlated to the onset of anemia during both autoimmune and infectious disease. [sup][1] In vitro evidence has suggested an inhibitory role of IFNa in the maturation of erythroid progenitors. [sup][12],[13] However, direct in-vivo mechanisms for IFNa-induced anemia during infection remain to be fully elucidated.

The binding of IFNa to cellular receptors stimulates recruitment and activation of members of the Janus kinase and signal transducer and activator of transcription (STAT) family. Phosphorylation of STAT1 stimulates the transcription of most IFNa-inducible genes. [sup][14] Specifically, STAT1 is involved in the transcriptional regulation of IFNa-inducible genes phagocyte NADPH oxidase (Phox), inducible nitric oxide synthase (iNOS) and inducible protein 10 (IP-10), [sup][15],[16],[17] all of which are involved in host resistance to infection. These antimicrobial genes also are implicated in the induction of pathology during a variety of infections. [sup][18],[19]

Toxoplasma gondii is an obligate intracellular, protozoan parasite that causes significant disease in immunocompromised patients and upon transplacental transmission to the developing fetus. Host defense against T. gondii infection has been extensively studied in murine models, where it has been found that protection is mediated by a robust type 1 immune response characterized by the production of large quantities of IFNa. [sup][20] In this setting, however, IFNa also functions pathologically. Liesenfeld et al . demonstrated that intestinal pathology accompanying acute T. gondii infection was abrogated by suppression of IFNa. [sup][11] In addition, we demonstrated that mice infected with T. gondii exhibit anemia that is characterized by decreased hematocrits and is dependent upon production of IFNa. [sup][21] Mice lacking hemostatic function (i.e., fibrin[ogen][sup]−/− or warfarin-treated mice) displayed exacerbated IFNa-induced anemia, suggesting that hemorrhage is responsible for the anemia. However, previous literature suggests that IFNa may also suppress erythropoiesis during infection. Therefore, in this study, we further characterize the IFNa-dependent anemia during T. gondii infection in mice. We demonstrate that IFNa production during T. gondii infection both decreases red blood cell (RBC) production as evidenced by reduced numbers of circulating reticulocytes, and simultaneously increases the loss of circulating RBC. However, analyses of erythropoiesis and RBC loss in fibrin (ogen)[sup]−/− , IFNa[sup]−/− , IFNa-R[sup]−/− , and STAT1[sup]−/− mice revealed that infection-stimulated anemia primarily results from IFNa-dependent, STAT1-independent RBC loss. These findings will lead to a better understanding of the pathways that result in IFNa-mediated protection versus IFNa-mediated pathology, and should thereby enable the development of therapies that alleviate pathology while maintaining protection.

Methods

Mice

Six to ten weeks old male mice were used for all experiments. C57BL/6, 129S6, STAT1[sup]−/− , IFNa[sup]−/− , IFN-aR[sup]−/− , TNF[sup]−/− , and NOS2[sup]−/− mice were purchased from The Jackson Laboratory (Bar Harbor, ME, USA). Phox[sup]−/− /iNOS[sup]−/− mice and fibrin(ogen)[sup]−/− mice were generously provided by Li Chen (Xinan Hospital, Chongqing). Animals were housed in a specific pathogen-free facility and cared for according to the General Hospital of Chinese People's Liberation Army and Yuhuangding Hospital Animal Care and Use Committee guidelines. Five to ten mice were used for each group in our study.

Infections

Toxoplasma gondii strain ME49 was originally provided by Li Chen (Xinan Hospital, Chongqing) and maintained by serial passage in C57BL/6 mice. For experimental infections, mice were infected perorally with indicated numbers of cysts in 0.1 ml diluted brain suspension obtained from infected animals, as previously described. [sup][21] Sham-infected mice received similarly diluted brain suspensions from uninfected animals. At the indicated times, samples from each mouse were harvested, processed, and analyzed individually. Where indicated, mice were treated with polyclonal anti-IP-10 (100 [micro]g, i.p. every other day) antibody.

Blood parameters

Blood samples from anticoagulated mice (500 U heparin, intravenously) were obtained by cardiac puncture immediately following euthanasia by carbon dioxide narcosis. For the determination of hematocrits and total number of circulating RBCs, blood was diluted 20-fold in 5 mm EDTA and analyzed using a Coulter Counter (Beckman Coulter, USA). Fecal occult blood was identified using a Hemoccult kit (Beckman Coulter). IFNa protein levels in sera were measured by sandwich ELISA (BD Biosciences, USA).

To quantify numbers of circulating reticulocytes, 5 [micro]l of blood was stained with 500 [micro]l thiazole orange solution (Retic-Count, BD Biosciences) for 1 h at room temperature, centrifuged at 800x g for 5 min, and resuspended in 1% formaldehyde. [sup][22] The percentage of thiazole orange-stained RBC (i.e., reticulocytes) was determined by flow cytometry, using forward and side scatter to gate on RBC. The total number of reticulocytes was then calculated by multiplying the percentage of reticulocytes by the total number of RBC as determined by Coulter Counter.

Red blood cell survival was measured by biotinylating all circulating cells in vivo , and then monitoring the loss of biotinylated RBC over time. [sup][23] In vivo biotinylation was performed the day prior to infection by retro-orbital injection of 1.2 mg biotin, dissolved in 10% dimethyl sulfoxide, given in a split dose 2 h apart. Mice were then euthanized on the indicated days, and 5 [micro]l blood was stained with streptavidin conjugated with phycoerythrin (BD Pharmingen) and TER119 mAb conjugated with fluorescein isothiocyanate. The percentage of streptavidin-positive TER119-positive cells in each sample was identified by flow cytometry and multiplied by the total number of RBC determined by Coulter Counter to obtain total numbers of biotinylated RBC.

Real-time polymerase chain reaction

Levels of TNF-a, iNOS, and IP-10 mRNA in liver tissue were measured by real-time polymerase chain reaction (PCR) (PerkinElmer). Real-time PCR primer and probe sequences for TNF-a and iNOS were described by Smiley laboratory. [sup][21] Primer combinations for IP-10 are as follows; IP-10-forward CTGCCGTCATTTTCTGCCTC, IP-10-reverse CACTGGCCCGTCATCGATAT, IP-10-probe CGCAAGGACGGTCCGCTGC.

Statistics

The data about hematocrit drop, RBC production and RBC loss were analyzed by one-way analysis of variance (ANOVA). Student's t -test was used for other data analysis. Both Student's t -test and one-way ANOVA were performed using the computer program Prism 5.0 (GraphPad Software Inc. San Diego, USA).

Results

Production of red blood cell is impaired during infection but does not fully account for Toxoplasma gondii -induced anemia

Infection of C57BL/6 mice with T. gondii induced robust IFNa production [Figure 1]a that correlated kinetically with decreased hematocrits [Figure 1]b and numbers of circulating RBC [Figure 1]c. To further delineate the mechanisms underlying this anemia, we quantified RBC production throughout the course of T. gondii infection. After their release from bone marrow as erythroblasts, RBC retain RNA for 24-48 h. During this period, RBC was referred to as reticulocytes and can be enumerated using flow cytometric assays employing RNA-binding dyes. Using such an assay, we found that numbers of reticulocytes in infected mice were comparable to those of sham-infected mice up through day 6. At day 8, post infection reticulocyte numbers decreased significantly, but rebounded by day 10 and then remained elevated until the anemia resolved [Figure 1]d. These results indicate that RBC production only briefly decreases during T. gondii infection, and fully recovers prior to the peak of anemia at day 10.{Figure 1}

Increased red blood cell loss and hemorrhage accompany Toxoplasma gondii infection

Based on data in [Figure 1]d, decreased production of RBC can only account for at most a deficit of 0.8 x 10 [sup]9 RBC. Since T. gondii -infected mice have approximately 3.55 x 10 [sup]9 fewer circulating RBC than sham control mice on day 10 of infection [Figure 1]c, an alternative mechanism to decreased erythropoiesis must account for the 2.75 x 10 [sup]9 decrease in total RBC in infected mice. Therefore, we investigated the possibility that anemia results also from RBC loss. To estimate the rate of RBC loss, we pulse-labeled RBC with biotin in vivo [sup][23] and measured the number of biotin-labeled RBC remaining at various time points throughout T. gondii infection. [Figure 1]e indicates that sham-infected mice lost circulating biotinylated RBC at an average rate of 2.1% per day. In contrast, T. gondii -infected mice lost circulating biotinylated RBC at an average of 11.4% per day between days 6 and 10 of infection accounting for a total of 2.4 x 10 [sup]9 RBC. After that time, the rate of loss returned to that observed in sham-infected controls. Thus, T. gondii -infected mice display a significant increase in RBC loss during the same period at which they display anemia.

To evaluate whether the loss of RBC resulted from T. gondii -induced hemorrhage, we obtained fecal samples from infected animals at various days of infection and analyzed for the presence of occult blood. We detected fecal occult blood on days 8 and 10 post infection [Figure 1]f indicative of an intestinal hemorrhage in infected animals. Together, our findings of brief decline in erythropoiesis, increased RBC loss and the presence of fecal occult blood in infected mice strongly suggest that hemorrhage accounts for a majority of the RBC lost during T. gondii -infection.

Fibrin-deficiency exacerbates Toxoplasma gondii induced hemorrhage without impacting red blood cell production

Fibrin is a product of the coagulation cascade that aids clotting thereby suppressing blood loss. To determine whether the exacerbated hematocrit drop in fibrin(ogen)[sup]−/− mice results from decreased RBC production or increased RBC loss, both parameters were measured in fibrin(ogen)[sup]−/− and littermate control mice on day 8 post infection [Figure 2]. As previously reported, the hematocrits of fibrin(ogen)[sup]−/− mice infected with T. gondii were significantly decreased as compared with infected littermate controls [Figure 2]a. The number of reticulocytes in fibrin(ogen)[sup]−/− animals did not differ significantly from controls [Figure 2]b, however; the loss of circulating biotinylated RBC was significantly greater in fibrin(ogen)[sup]−/− mice compared with control mice [Figure 2]c. Taken together, these data indicate an important role for RBC loss in the T. gondii -induced hematocrit reduction in fibrin(ogen)[sup]−/− mice, supporting our conclusion that decreases in hematocrit primarily reflect hemorrhage caused by infection.{Figure 2}

Anemia that accompanies Toxoplasma gondii infection is dependent upon interferon gamma and interferon gamma receptor, but is tumor necrosis factor, inducible nitric oxide synthase, phagocyte NADPH oxidase and inducible protein 10 independent

Mice lacking the capacity to produce IFNa fail to exhibit the T. gondii -induced hematocrit reduction [Figure 3]a. Consistent with those findings, mice unable to respond to IFNa due to a genetic deficiency of IFNa-R also do not demonstrate the T. gondii -induced hematocrit reduction [Figure 3]a. While infection of WT mice caused a significant decrease in reticulocyte numbers, infection of IFNa[sup]−/− or IFNa-R[sup]−/− mice did not alter reticulocyte numbers as compared with sham controls [Figure 3]b. Furthermore, there was no significant evidence of hemorrhage in infected IFNa[sup]−/− or IFNa-R[sup]−/− mice as measured through loss of biotinylated RBC or fecal occult blood [Figure 3]c and d. These data demonstrate that both the decreased erythropoiesis and the increased RBC loss components of T. gondii -induced anemia are dependent upon the production of IFNa and subsequent signaling through the IFNa-R.{Figure 3}

Interferon gamma has been implicated in the induction of the inflammatory cytokine TNF-a, resulting in pathology during malaria infection. [sup][24] Also, previous literature has suggested a synergistic role for IFNa and TNF-a in eliciting an immune response to T. gondii [sup][25],[26],[27] and in the suppression of hematopoietic progenitor cell growth in vitro . [sup][28] Following confirmation of TNF-a mRNA induction during infection with T. gondii [Figure 4]a, we asked whether TNF-a plays a role in T. gondii -induced anemia. Hematocrit levels and numbers of biotinylated RBC were significantly decreased in TNF-a[sup]−/− mice infected with T. gondii as compared with sham controls [Figure 4]b, indicating that T. gondii -induced anemia is TNF-a-independent.{Figure 4}

Having ruled out a role for TNF-a in the reduction of hematocrit levels during T. gondii infection, we focused on IFNa-dependent effector molecules upregulated during T. gondii infection. Both iNOS and Phox are IFNa inducible genes involved in the regulation of the immune response and intestinal pathology during infection with Francisella tularensis . [sup][29] The products of these genes generate reactive nitrogen and oxygen species, which could be responsible for tissue and endothelial damage leading to vascular leakage and subsequent hemorrhage. Induction of iNOS mRNA on D8 of infection was significantly abrogated in IFNa[sup]−/− mice compared with C57BL/6 infected mice [Figure 4]c, indicating that iNOS is inducible by IFNa during T. gondii infection. To determine whether hemorrhage during T. gondii infection was a consequence of host cell damage due to reactive oxygen, we evaluated hematocrit levels in both iNOS[sup]−/− and Phox/iNOS double knock-out animals. Hematocrit levels decreased significantly in both iNOS[sup]−/− and Phox[sup]−/− /iNOS[sup]−/− mice on day 8 postinfection compared with sham-infected controls [Figure 4]d, and the extent of this decrease was comparable to that seen in WT mice. In addition to iNOS and Phox, IFNa stimulates production also of IP-10, which has been implicated in downstream effector functions resulting in immunopathology during Crohn's disease. [sup][30] Similarly to iNOS mRNA, induction of IP-10 mRNA during T. gondii infection is reduced in IFNa[sup]−/− mice compared with WT controls [Figure 4]c. Nevertheless, wild type B6 mice treated with anti-IP-10 displayed a significant hematocrit decrease on day 8 of infection [Figure 4]d. Thus, while the T. gondii -induced anemia is IFNa- and IFNa-R-dependent [Figure 3], these data demonstrate that anemia is independent of TNF-a, iNOS, Phox and IP-10 gene products [Figure 4].

Toxoplasma gondii -induced, interferon gamma-dependent hemorrhage is signal transducer and activator of transcription 1 independent

Identification of the signaling cascades involved in IFNa-mediated anemia during T. gondii infection may provide critical insight into the downstream effector molecules regulating infection-associated hemorrhage. IFNa induces gene expression primarily through STAT1-dependent pathways. [sup][31],[32] To evaluate the role of STAT1 in T. gondii -stimulated anemia, we infected STAT1[sup]−/− mice and measured blood parameters on day 8 postinfection. Unexpectedly, hematocrit levels in STAT1[sup]−/− mice were significantly lower than those of sham controls [Figure 5]a, and comparable to genetically matched 129S6 mice infected with T. gondii . Reticulocyte production did not decrease as a result of infection in STAT1[sup]−/− mice or their 1296 controls [Figure 5]b, but there was a significant loss of biotinylated RBC in both strains compared with sham-infected mice [Figure 5]c. Based on these results, we conclude that the IFNa-induced hemorrhage in T. gondii infected animals is mediated through a STAT1-independent mechanism.{Figure 5}

Discussion

Anemia accompanies a variety of infectious diseases including malaria, [sup][24] trypanosomiasis, [sup][33] mononucleosis [sup][34] and secondary infections during HIV. [sup][2],[35] Clinical studies have implicated important roles from inflammatory cytokines in the anemia's associated with infectious disease. In this study, an in vivo model was used to evaluate roles for the inflammatory cytokine, IFNa, in the onset of anemia due to infectious disease. Specifically, this study identifies a STAT1-independent IFNa-induced pathology during infection with the protozoan parasite T. gondii .

Infection-induced anemia could potentially result from decreased RBC production, RBC loss due to hemorrhage or destruction, as described in disseminated intravascular coagulation (DIC), or pathogen-associated hemolysis. In the present study, we show that T. gondii -induced anemia results from both decreased erythropoiesis and increased loss of circulating RBC [Figure 1]. We believe hypochromic microcytic anemia is the only morphological features for hemorrhagic anemia, and red cell loss caused by infection is the only reason during this process. Results of mean corpuscular volume mean corpuscular hemoglobin support our idea (data not shown). Anemia resulting from decreased erythropoiesis has been described in murine malaria, in part resulting from effects of increased TNF-a levels on RBC precursor cells in the bone marrow of infected mice. [sup][36] Additionally, decrease numbers of erythroid progenitor cells have been previously observed in CBA mice infected with the virulent RH strain of T. gondii . [sup][37] Together, these reports support our conclusion that a decrease in erythropoiesis during T. gondii infection is in part responsible for the induced anemia. Nevertheless, the decrease in RBC production accounts for only a small portion of the total number of RBC lost during T. gondii infection, indicating that an additional mechanism must contribute to this anemia. The possibility that anemia during T. gondii infection is not solely due to a reduction of erythropoiesis is supported by similar data during malaria infections. [sup][38]

Another candidate for the cause of infection-induced anemia includes the destruction of RBC in circulation. [sup][39] During T. gondii infection, RBC destruction does not appear to be a mechanism for anemia, as there are no detectable spherocytes or schistocytes, hallmarks of such destruction, [sup][39] in peripheral blood smears from infected mice (data not shown). Alternatively, hemophagocytosis accompanies certain infections and can result in decreased erythrocyte numbers due to their phagocytosis by activated macrophages. [sup][34] However, it is unclear why loss of fibrin would predispose to increased hemophagocytosis or lysis, whereas it is obvious that it predisposes to hemorrhage [Figure 2]. Indeed, hemorrhage, as measured through loss of biotinylated RBC and positive hemoccult, accounts for the majority of RBC loss during T. gondii -induced anemia [Figure 1].

Hemorrhagic pathology, including bleeding from the respiratory and gastrointestinal organs, has been described during both bacterial and viral infections. During dengue hemorrhagic fever, hemorrhage is a result of vasculopathy and coagulopathy due to an imbalance between coagulation and fibrinolysis. [sup][40] Activation of the coagulation system can result in increased fibrin deposition in the vasculature causing DIC and a subsequent depletion of RBC due to thrombosis and bleeding as described in viral hemorrhagic fevers. [sup][41] Dengue-virus induced hemorrhage is correlated to platelet abnormalities and DIC. [sup][40] Though we have not formally ruled out DIC as a possible cause of T. gondii induced anemia, exacerbation of anemia in fibrin (ogen)[sup]−/− animals suggests that excessive coagulation is a not a primary cause of anemia. Nevertheless, our data indicated that RBC loss and hemorrhage are primary causes of IFNa-dependent anemia in T. gondii -infected mice.

Previous research has implicated several IFNa-IPs in pathology associated with inflammation. Treating mice with nitric oxide inhibitors prevented intestinal necrosis during T. gondii infection. [sup][25] Additionally, IP-10 has been implicated in the induction of liver, kidney, and intestinal pathology during Crohn's disease. [sup][30] However, we were unable to identify a role for nitric oxide, or IP-10 in the induction of anemia during T. gondii infection. Additionally, no role for TNF-a was identified in T. gondii induced anemia. Though anemia during Trypanosoma cruzi is not accompanied by a decrease in reticulocyte numbers, similar to our findings, chemical inhibition of nitric oxide or treatment with anti-TNF did not rescue mice from anemia even though these treatments resulted in increased numbers of reticulocytes and suppressed decreases in bone marrow erythroblast numbers during infection. [sup][33] Our results suggest that divergent mechanisms may exist for IFNa-induced protection compared with IFNa-induced hemorrhagic immunopathology during T. gondii infection.

Identification of the signaling cascades involved in IFNa-mediated anemia during T. gondii infection may provide insight into the downstream effector molecules regulating hemorrhage. Recent studies established that IFNa production is STAT1 independent [sup][14],[42] during T. gondii infection. This led us to assess roles for STAT1 as a downstream signaling molecule involved in IFNa-induced hemorrhage during T. gondii infection. Based on previous literature describing the induction of pathological IFNa effector mechanisms through STAT1, we anticipated that this signaling mechanism also would be required in induction of IFNa-dependent pathology during T. gondii infection. Surprisingly, in this setting, T. gondii infection stimulated anemia in a STAT1-independent fashion. These data suggest that both the induction of IFNa and the subsequent activation of an IFNa-induced effector mechanism resulting in hemorrhage is a STAT1-independent pathway. Recent in vitro studies with macrophages have identified MCP-1, MIP-1a and [sz], as STAT1-independent, IFNa-inducible genes., [sup][43],[44] However, infections of CCL2, CCR2 or CCR5 deficient mice did not indicate a role for these chemokines in T. gondii -induced anemia (data not shown). Future in vivo studies will continue to investigate potential IFNa-dependent, STAT1-independent effector molecules that are responsible for T. gondii induced hemorrhagic anemia. Understanding the pathways that result in IFNa-mediated protection versus IFNa-mediated pathology will provide valuable information to prevent immune pathology while, not compromising the protective effects of the immune response.

Acknowledgments

We are indebted to the employees of The Genernal Hospital of People's Liberation Army and Yuhuangding Hospital Animal Breeding and Maintenance Facilities for dedicated care of the mice used in these studies.

References

1. Means RT Jr, Krantz SB. Progress in understanding the pathogenesis of the anemia of chronic disease. Blood 1992;80:1639-47.

2. Gu L, Chen X, Li H, Qu J, Miao M, Zhou F, et al. A case of lethal hemolytic anemia associated with severe pneumonia caused by Mycoplasma pneumoniae . Chin Med J (Engl) 2014;127:3839.

3. Papadaki HA, Kritikos HD, Valatas V, Boumpas DT, Eliopoulos GD. Anemia of chronic disease in rheumatoid arthritis is associated with increased apoptosis of bone marrow erythroid cells: Improvement following anti-tumor necrosis factor-alpha antibody therapy. Blood 2002;100:474-82.

4. Means RT Jr. The anaemia of infection. Baillieres Best Pract Res Clin Haematol 2000;13:151-62.

5. MacMicking JD, Taylor GA, McKinney JD. Immune control of tuberculosis by IFN-gamma-inducible LRG-47. Science 2003;302:654-9.

6. Ostler T, Davidson W, Ehl S. Virus clearance and immunopathology by CD8(+) T cells during infection with respiratory syncytial virus are mediated by IFN-gamma. Eur J Immunol 2002;32:2117-23.

7. Denkers EY, Gazzinelli RT. Regulation and function of T-cell-mediated immunity during Toxoplasma gondii infection. Clin Microbiol Rev 1998;11:569-88.

8. Schroder K, Hertzog PJ, Ravasi T, Hume DA. Interferon-gamma: An overview of signals, mechanisms and functions. J Leukoc Biol 2004;75:163-89.

9. Rutitzky LI, Ozkaynak E, Rottman JB, Stadecker MJ. Disruption of the ICOS-B7RP-1 costimulatory pathway leads to enhanced hepatic immunopathology and increased gamma interferon production by CD4 T cells in murine schistosomiasis. Infect Immun 2003;71:4040-4.

10. Blass SL, Pure E, Hunter CA. A role for CD44 in the production of IFN-gamma and immunopathology during infection with Toxoplasma gondii . J Immunol 2001;166:5726-32.

11. Liesenfeld O, Kosek J, Remington JS, Suzuki Y. Association of CD4+ T cell-dependent, interferon-gamma-mediated necrosis of the small intestine with genetic susceptibility of mice to peroral infection with Toxoplasma gondii . J Exp Med 1996;184:597-607.

12. Raefsky EL, Platanias LC, Zoumbos NC, Young NS. Studies of interferon as a regulator of hematopoietic cell proliferation. J Immunol 1985;135:2507-12.

13. Zoumbos NC, Djeu JY, Young NS. Interferon is the suppressor of hematopoiesis generated by stimulated lymphocytes in vitro . J Immunol 1984;133:769-74.

14. Gavrilescu LC, Butcher BA, Del Rio L, Taylor GA, Denkers EY. STAT1 is essential for antimicrobial effector function but dispensable for gamma interferon production during Toxoplasma gondii infection. Infect Immun 2004;72:1257-64.

15. Kumatori A, Yang D, Suzuki S, Nakamura M. Cooperation of STAT-1 and IRF-1 in interferon-gamma-induced transcription of the gp91(phox) gene. J Biol Chem 2002;277:9103-11.

16. Delgado M. Inhibition of interferon (IFN) gamma-induced Jak-STAT1 activation in microglia by vasoactive intestinal peptide: Inhibitory effect on CD40, IFN-induced protein-10, and inducible nitric-oxide synthase expression. J Biol Chem 2003;278:27620-9.

17. Majumder S, Zhou LZ, Chaturvedi P, Babcock G, Aras S, Ransohoff RM. p48/STAT-1alpha-containing complexes play a predominant role in induction of IFN-gamma-inducible protein, 10 kDa (IP-10) by IFN-gamma alone or in synergy with TNF-alpha. J Immunol 1998;161:4736-44.

18. Klein RS, Izikson L, Means T, Gibson HD, Lin E, Sobel RA, et al. IFN-inducible protein 10/CXC chemokine ligand 10-independent induction of experimental autoimmune encephalomyelitis. J Immunol 2004;172:550-9.

19. Gao XP, Standiford TJ, Rahman A, Newstead M, Holland SM, Dinauer MC, et al. Role of NADPH oxidase in the mechanism of lung neutrophil sequestration and microvessel injury induced by Gram-negative sepsis: Studies in p47phox-/- and gp91phox-/- mice. J Immunol 2002;168:3974-82.

20. Suzuki Y, Orellana MA, Schreiber RD, Remington JS. Interferon-gamma: The major mediator of resistance against Toxoplasma gondii . Science 1988;240:516-8.

21. Johnson LL, Berggren KN, Szaba FM, Chen W, Smiley ST. Fibrin-mediated protection against infection-stimulated immunopathology. J Exp Med 2003;197:801-6.

22. Van Hove L, Goossens W, Van Duppen V, Verwilghen RL. Reticulocyte count using thiazole orange. A flow cytometry method. Clin Lab Haematol 1990;12:287-99.

23. Hoffmann-Fezer G, Maschke H, Zeitler HJ, Gais P, Heger W, Ellwart J, et al. Direct in vivo biotinylation of erythrocytes as an assay for red cell survival studies. Ann Hematol 1991;63:214-7.

24. Artavanis-Tsakonas K, Tongren JE, Riley EM. The war between the malaria parasite and the immune system: Immunity, immunoregulation and immunopathology. Clin Exp Immunol 2003;133:145-52.

25. Liesenfeld O, Kang H, Park D, Nguyen TA, Parkhe CV, Watanabe H, et al. TNF-alpha, nitric oxide and IFN-gamma are all critical for development of necrosis in the small intestine and early mortality in genetically susceptible mice infected perorally with Toxoplasma gondii . Parasite Immunol 1999;21:365-76.

26. Chang HR, Grau GE, Pechere JC. Role of TNF and IL-1 in infections with Toxoplasma gondii . Immunology 1990;69:33-7.

27. Daubener W, Remscheid C, Nockemann S, Pilz K, Seghrouchni S, Mackenzie C, et al. Anti-parasitic effector mechanisms in human brain tumor cells: Role of interferon-gamma and tumor necrosis factor-alpha. Eur J Immunol 1996;26:487-92.

28. Broxmeyer HE, Williams DE, Lu L, Cooper S, Anderson SL, Beyer GS, et al. The suppressive influences of human tumor necrosis factors on bone marrow hematopoietic progenitor cells from normal donors and patients with leukemia: Synergism of tumor necrosis factor and interferon-gamma. J Immunol 1986;136:4487-95.

29. Lindgren H, Stenmark S, Chen W, Tarnvik A, Sjostedt A. Distinct roles of reactive nitrogen and oxygen species to control infection with the facultative intracellular bacterium Francisella tularensis . Infect Immun 2004;72:7172-82.

30. Singh UP, Singh S, Iqbal N, Weaver CT, McGhee JR, Lillard JW Jr. IFN-gamma-inducible chemokines enhance adaptive immunity and colitis. J Interferon Cytokine Res 2003;23:591-600.

31. Darnell JE Jr, Kerr IM, Stark GR. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 1994;264:1415-21.

32. Platanias LC, Fish EN. Signaling pathways activated by interferons. Exp Hematol 1999;27:1583-92.

33. Malvezi AD, Cecchini R, de Souza F, Tadokoro CE, Rizzo LV, Pinge-Filho P. Involvement of nitric oxide (NO) and TNF-alpha in the oxidative stress associated with anemia in experimental Trypanosoma cruzi infection. FEMS Immunol Med Microbiol 2004;41:69-77.

34. Fisman DN. Hemophagocytic syndromes and infection. Emerg Infect Dis 2000;6:601-8.

35. Sullivan P. Associations of anemia, treatments for anemia, and survival in patients with human immunodeficiency virus infection. J Infect Dis 2002;185 Suppl 2:S138-42.

36. Miller KL, Silverman PH, Kullgren B, Mahlmann LJ. Tumor necrosis factor alpha and the anemia associated with murine malaria. Infect Immun 1989;57:1542-6.

37. Petakov M, Stojanovic N, Jovcic G, Bugarski D, Todorovic V, Djurkovic-Djakovic O. Hematopoiesis during acute Toxoplasma gondii infection in mice. Haematologia (Budap) 2002;32:439-55.

38. Jakeman GN, Saul A, Hogarth WL, Collins WE. Anaemia of acute malaria infections in non-immune patients primarily results from destruction of uninfected erythrocytes. Parasitology 1999;119 (Pt 2):127-33.

39. Mabiala Babela JR, Ollandzobo LC, Nika ER, Moyen G. Post-malaria immune hemolytic anemia: 11 cases. Med Mal Infect 2014;44:441-3.

40. Lei HY, Yeh TM, Liu HS, Lin YS, Chen SH, Liu CC. Immunopathogenesis of dengue virus infection. J Biomed Sci 2001;8:377-88.

41. Wiersinga WJ, Leopold SJ, Cranendonk DR, van der Poll T. Host innate immune responses to sepsis. Virulence 2014;5:36-44.

42. Lieberman LA, Banica M, Reiner SL, Hunter CA. STAT1 plays a critical role in the regulation of antimicrobial effector mechanisms, but not in the development of Th1-type responses during toxoplasmosis. J Immunol 2004;172:457-63.

43. Ramana CV, Gil MP, Schreiber RD, Stark GR. Stat1-dependent and-independent pathways in IFN-gamma-dependent signaling. Trends Immunol 2002;23:96-101.

44. Lin W, Lin Y. Interferon-a inhibits central nervous system myelination through both STAT1-dependent and STAT1-independent pathways. J Neurosci Res 2010;88:2569-77.
COPYRIGHT 2015 Medknow Publications and Media Pvt. Ltd.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Original Article
Author:Wang, Zheng; Zhang, Dong-Xia; Zhao, Qi
Publication:Chinese Medical Journal
Article Type:Report
Geographic Code:9CHIN
Date:Jul 1, 2015
Words:5195
Previous Article:MiR-27a Promotes Hepatocellular Carcinoma Cell Proliferation Through Suppression of its Target Gene Peroxisome Proliferator-activated Receptor a.
Next Article:Phloroglucinol Protects the Urinary Bladder Via Inhibition of Oxidative Stress and Inflammation in a Rat Model of Cyclophosphamide-induced...
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |