Printer Friendly

Incidence of viruses in grapevines in the Brazilian Northeast and partial molecular characterization of local virus isolates/Incidencia de virus em videiras no Nordeste brasileiro e caracterizacao molecular parcial de isolados virais locais.

INTRODUCAO

O processo infeccioso causado pelos virus em videiras (Vitis spp.) resulta em quedas de rendimento e da qualidade da producao e reducao da vida util do vinhedo, refletindo na rentabilidade da cultura. Ja foram relatadas, no mundo, cerca de 60 especies virais na cultura da videira; algumas apresentam relevancia e induzem expressivo impacto economico em muitas regioes e paises, outras nao se destacam (MARTELLI, 2012). No Brasil, Grapevine leafroll-associated virus (GLRaV-1, -2, -3, -5 e -6), Grapevine virus A, B e D (GVA, GVB e GVD), Grapevine rupestris stem pitting-associated virus (GRSPaV), Grapevine fleck virus (GFkV) e Grapevine fanleaf virus (GFLV) ja foram detectados em videira (LIMA & FAJARDO, 2012). Recentemente, CATARINO et al. (2013) identificaram GLRaV-4 e Grapevine rupestris vein feathering virus (GRVFV) em amostras de videiras comercialmente introduzidas no Brasil.

A propagacao vegetativa da videira facilita a disseminacao e favorece a ocorrencia de doencas complexas pelo acumulo de diferentes especies e estirpes virais em uma mesma planta (MARTELLI, 2012). No Nordeste brasileiro, encontram-se areas produtoras de uva, destacando-se dois polos: o do Vale do Sao Francisco, com cerca de 10.000ha, que inclui vinhedos situados nos Estados de Pernambuco e Bahia e o da Zona da Mata, com cerca de 600ha, que abrange municipios de Pernambuco e da Paraiba, ambos com grande potencial de expansao da producao (PROTAS & CAMARGO, 2011).

Em areas tropicais, a exemplo do Nordeste do Brasil, onde a videira e cultivada com pequeno periodo de repouso para permitir mais de uma safra por ano, a temperatura normalmente e elevada e os sintomas caracteristicos das viroses tendem a estar ausentes ou sao pouco evidentes. Estes fatos dificultam a avaliacao visual de campo da ocorrencia e da influencia dessas doencas nos parreirais, indicando maior necessidade de se aplicar testes diagnosticos com elevada sensibilidade e especificidade para se conhecer a sanidade do material. Alem das condicoes ambientais, os sintomas de infeccao viral em videira podem variar em funcao do estadio fenologico e da condicao nutricional da planta e, tambem, da combinacao envolvendo a cultivar e/ou especie da hospedeira com a estirpe e/ou especie viral (LIMA & FAJARDO, 2012). Assim, muitos virus podem passar despercebidos por nao induzirem sintomas visualmente perceptiveis ou facilmente distinguiveis.

A disponibilidade de informacao sobre a incidencia de virus em vinhedos no Brasil ainda e escassa, sobretudo em regioes viticolas do Nordeste do Pais. KUHN et al. (2000) identificaram algumas viroses em amostras de vinhedos comerciais do Vale do Sao Francisco, porem, em alguns casos, sem identificar as especies virais envolvidas na infeccao. Em relacao a ocorrencia de viroses em videiras na Zona da Mata de Pernambuco e da Paraiba, nao ha nenhuma informacao disponivel. Os objetivos deste trabalho foram determinar a incidencia de viroses em duas regioes viticolas localizadas no Nordeste brasileiro, alem de caracterizar alguns isolados virais dessas regioes.

MATERIAL E METODOS

O levantamento de virus foi realizado em vinhedos comerciais de duas regioes viticolas, Zona da Mata (municipios de Sao Vicente Ferrer-PE e Natuba-PB) e Vale do Sao Francisco (municipios de Petrolina-PE, Lagoa Grande-PE e Casa Nova-BA), entre setembro de 2012 e marco de 2013. Na Zona da Mata, foram coletadas 50 amostras de videiras com 4 a 40 anos, da cv. 'Isabel' (V labrusca), plantadas em pe franco ou sobre os porta-enxertos IAC (313, 572), em seis propriedades. No Vale do Sao Francisco, foram coletadas 51 amostras de videiras (V vinifera) com 2 a 11 anos, das cvs. 'Christmas Rose', Sugraone, 'Crimson Seedless', 'Red Globe', 'Sable', Italia, Thompson Seedless, Midnight Beauty, Shiraz, Tempranillo, Barbera, Cabernet Sauvignon, Petite Shiraz e Ruby Cabernet, enxertadas sobre os portaenxertos IAC (313, 572, 766), Harmony, P1103, SO4 e Richter, em dez propriedades. As amostras foram avaliadas quanto a presenca de Foveavirus: GRSPaV; Vitivirus: GVA, GVB; Closterovirus: GLRaV-2; Ampelovirus: GLRaV-3, GLRaV-4; Maculavirus: GFkV; Marafivirus: GRVFV e Nepovirus: GFLV por RT-PCR em tempo real (TaqMan).

A extracao de RNA total, a partir de 100 mg de fragmentos do lenho de ramos maduros de videiras, foi realizada triturando-se o tecido vegetal em nitrogenio liquido, e seguindo o protocolo definido no metodo de adsorcao em silica (ROTT & JELKMANN, 2001). Videira comprovadamente sadia foi utilizada como controle negativo e, como controle positivo das reacoes, foi utilizado RNA extraido de videiras mantidas em casa de vegetacao, infectadas com isolados das especies virais avaliadas.

Os oligonucleotideos e as sondas utilizados nas reacoes de RT-PCR em tempo real foram desenhados com base em trabalhos publicados: GRSPaV, GVA, GVB (OSMAN & ROWHANI, 2008); GLRaV-2, GLRaV-3, GLRaV-4 (OSMAN et al., 2007); GFkV e GFLV (DUBIELA et al., 2013). Para o GRVFV, estes reagentes foram definidos neste trabalho para a amplificacao de fragmentos de 104 pb, referentes a porcao genomica correspondente a proteina capsidial (CP) do GRVFV: oligonucleotideos 104F (5'AAGAAGCTGACGGATCCTTTCCGC3'), 104R (5'ACGCAGTGGAGGGTGACAGGATTG3') e sonda 104P(5' CGAAATCACCCAGCTGGAGGT GGTTCTCATGCC3').

Todas as sondas foram marcadas na extremidade 5' com os fluoroforos 6-FAM ou VIC para permitir a deteccao simultanea de dois virus na mesma amostra e com TAMRA, fluoroforo que funciona como bloqueador, na extremidade 3'. As condicoes das reacoes de RT-PCR em tempo real foram descritas previamente (DUBIELA et al., 2013), consistindo em ensaios do tipo presenca/ausencia, utilizando-se o kit TaqMan Master Mix One-Step RT-PCR e o termociclador StepOnePlus Real-time PCR System (Applied Biosystems). Os dados das reacoes foram analisados quantitativamente e graficamente, utilizando-se o StepOne Software v2.3 (Applied Biosystems), pela determinacao do Cq (ciclo quantitativo). Valores de Cq abaixo de 35 representam resultados positivos, sendo que, quanto maior a concentracao viral na amostra, menor sera o valor do Cq.

A caracterizacao molecular parcial foi desenvolvida por meio da analise da sequencia de nucleotideos de tres importantes especies virais (GVA, GVB e GLRaV-3), cujos isolados foram detectados no levantamento. Os oligonucleotideos para a amplificacao por RT-PCR convencional foram definidos com base em trabalhos anteriores ou definidos neste trabalho: GVA-v1 (F) (5'ATGGCACACTACGCCAAGAGGG3') e C1197 (R) para GVA (FAJARDO et al., 2003); GVB6445 (F) e GVB-7038 (R) para GVB (NICKEL et al., 2002) e LR3-8504 (F) e LR3-9445 (R) para GLRaV-3 (FAJARDO et al., 2007). A sintese do cDNA e as reacoes de PCR foram conduzidas conforme metodologia descrita por FAJARDO et al. (2003). Os produtos da RT-PCR foram analisados em geis de agarose 1,2%, preparados em tampao TBE pH 8,0, corados com brometo de etideo e visualizados em transiluminador de luz UV. As bandas observadas, correspondentes a fragmentos de tamanhos esperados, foram recortadas dos geis e eluidas com a utilizacao do kit Wizard SV Gel and PCR Clean-Up System (Promega).

Os fragmentos de DNA eluidos foram ligados aos vetores pGEM-T Easy (Promega) ou pCR2.1 (Invitrogen). A seguir, as ligacoes foram utilizadas na transformacao de celulas competentes de Escherichia coli DH5a por meio de choque termico. O DNA plasmidial das colonias bacterianas transformadas foi extraido utilizando-se o kit Wizard Plus SV Minipreps DNA Purification System (Promega). A confirmacao da presenca dos fragmentos virais clonados nos plasmideos recombinantes foi realizada por digestao com a enzima de restricao EcoRI (SAMBROOK & RUSSEL, 2001). Procedeuse ao sequenciamento automatico de nucleotideos de dois clones por isolado viral caracterizado. As sequencias de nucleotideos obtidas foram traduzidas com auxilio de recurso disponibilizado pelo ExPASy Bioinformatics Resource Portal <http://web.expasy. org/translate/>. Os alinhamentos multiplos das sequencias de nucleotideos (nt) e de aminoacidos deduzidos (aad) e a geracao das matrizes de identidades (de nt e aad) foram realizados com auxilio dos programas Clustal X 1.8 (THOMPSON et al., 1997) e BioEdit 7.1.11. Nas analises, foram incluidas as sequencias completas da proteina capsidial (CP) do isolado caracterizado e outros isolados, da mesma especie viral (GVA, GVB ou GLRaV-3) caracterizados no Brasil, alem das sequencias do gene CP do isolado-tipo de cada especie viral, disponiveis no banco de dados GenBank.

RESULTADOS E DISCUSSAO

Foram realizadas analises de RT-PCR em tempo real em 101 amostras de videiras. Os resultados indicam a frequente ocorrencia de infeccoes multiplas na Zona da Mata (ZM) e no Vale do Sao Francisco (VSF), com incidencias de 0%, 2% e 98% (ZM) e 3,9%, 19,7% e 76,4% (VSF) nas amostras, respectivamente, sadias, infectadas com um virus e infectadas com mais de um virus. Em geral, os virus avaliados encontravam-se amplamente disseminados nas duas regioes amostradas, ZM e VSF, respectivamente, GRSPaV, 80% e 35%; GVA, 100% e 61%; GVB, 2% e 4%; GLRaV-2, 12% e 2%; GLRaV-3, 62% e 37%; GLRaV-4, 90% e 61%; GFkV, 32% e 59%; GRVFV, 0% e 47% e GFLV, 0% em ambas regioes. Estes resultados expandem o conhecimento sobre a incidencia e a distribuicao de virus em videiras no Brasil, fornecendo relevante informacao para o desenvolvimento de estrategias de controle e manejo destas doencas, com enfase na importancia da utilizacao de material propagativo de videira livre de virus na implantacao de novos vinhedos.

Em diversos paises viticolas, ja foram realizados levantamentos de virus em videiras, por exemplo, na Argentina (VOLPE et al., 2010), no Chile (FIORE et al., 2011), na China (LIU et al., 2013) e nos Estados Unidos (SHARMA et al., 2011). Nestes levantamentos e em outros, a incidencia de virus e bastante variavel, dependendo da especie viral, da cultivar de videira e da regiao amostrada, entretanto, invariavelmente, atingem expressivos indices, situacao semelhante a verificada no levantamento conduzido neste trabalho.

Os sintomas normalmente associados a infeccao viral em videira sao: perda continua e gradual do vigor da planta, producao reduzida, coloracao (avermelhamento ou amarelecimento) anormal das folhas, folhas com aparencia atipica (bordos enrolados, textura rugosa e bolhas na superficie do limbo foliar), brotacao, engrossamento e amadurecimento irregulares dos ramos, presenca de caneluras no lenho (ranhuras sob a casca do tronco) e casca do tronco com aparencia alterada (espessa e com rachaduras), alem do amadurecimento irregular da uva, que possui menor teor de acucares. Sintomas como os relatados foram verificados em muitas das videiras amostradas, indicativos da presenca de tres importantes viroses: o enrolamento da folha (GLRaV-2, GLRaV-3, GLRaV-4), o lenho rugoso da videira (GVA, GVB, GRSPaV) e a mancha das nervuras (GFkV) e outros virus associados a essa virose (GRVFV). O unico virus nao detectado no levantamento foi o GFLV, que, normalmente, apresenta baixa incidencia no Brasil (LIMA & FAJARDO, 2012).

Nem sempre a videira infectada por virus exibira sintomas perceptiveis, pois a infeccao pode ser latente em algumas cultivares comerciais; entretanto, mesmo nestes casos, a presenca do virus podera causar prejuizos. Embora os danos provocados por virus nao tenham sido avaliados nos vinhedos amostrados, provavelmente, eles existissem, conforme determinado por outros autores. BASSO et al. (2010) observaram que uvas colhidas de videiras infectadas por virus apresentaram reducao de solidos soluveis totais de cerca de 3,0 graus Brix, quando comparadas as uvas colhidas de plantas sadias.

GLRaV-3, GLRaV-4, GVA e GVB sao transmitidos de maneira semipersistente por cochonilhas, enquanto o GFLV e transmitido por nematoides e GRSPaV, GLRaV-2, GFkV e GRVFV ainda nao tem vetores conhecidos. Todos estes virus sao transmitidos por meio da enxertia de material propagativo infectado (MARTELLI, 2012). Em determinados casos, os meios de transmissao podem explicar as incidencias obtidas, em outros casos, nao ha correlacao. Por exemplo, foi constatada alta incidencia do GRSPaV, entretanto, este virus nao possui vetor conhecido, assim, e provavel que sua disseminacao tenha se dado pelo uso de material propagativo infectado na formacao dos vinhedos amostrados.

A tecnica de diagnose, RT-PCR em tempo real, empregada neste trabalho, e extremamente sensivel e capaz de superar limitacoes apresentadas por outras tecnicas convencionais de deteccao viral. Tais limitacoes, comumente observadas em videiras, decorrem da distribuicao desuniforme do virus na hospedeira e das expressivas variacoes do titulo viral, tanto ao longo do ciclo da planta, quanto nos diferentes tipos de tecidos vegetais (DUBIELA et al., 2013).

O emprego dos oligonucleotideos GVA-v1/ C1197 permitiu a amplificacao de fragmentos de DNA com 625bp contendo o gene da CP do GVA. O gene completo da proteina capsidial do GVA, isolado IT-BA, com 597 nucleotideos (198 aminoacidos deduzidos, aad), foi amplificado por RT-PCR a partir da amostra no 91 da cv. 'Italia' de Casa Nova-BA. A sequencia de nucleotideos deste isolado (acesso GenBank KF667501) apresentou identidade entre 89,6-91,2% quando comparada a outros isolados brasileiros do mesmo virus (AF494187 do RS e AY340581 de SP) e com o isolado-tipo do GVA (NC_003604). A identidade de aad entre os isolados de GVA analisados foi de 94,9% a 98,9% (Tabela 1). De modo geral, os criterios para a definicao de especies virais nas familias Betaflexiviridae e Closteroviridae estabelecem que a sequencia de aminoacidos deduzidos das principais ORFs apresente diferenca superior a 10%, sendo a sequencia do gene da proteina capsidial amplamente utilizada na taxonomia (KING et al., 2012).

O gene completo da proteina capsidial do GVB, isolado IS-SVF, com 594 nucleotideos (197 aad), foi amplificado por RT-PCR a partir da amostra no. 15 da cv. 'Isabel' de Sao Vicente Ferrer-PE. A sequencia de nucleotideos deste isolado (acesso GenBank KF040332) apresentou identidade entre 92,7-99,8% com os isolados brasileiros do mesmo virus (KF040331 e AY340583 de SP, KF040333 e AF438410 do RS) e de 81,3-82,7%, quando comparado com os isolados AY340582, de SP, e com o isolado-tipo do GVB (NC_003602). A identidade de aad entre todos os isolados de GVB analisados variou de 95,4% a 100% (Tabela 2). Variabilidade entre isolados de GVA e GVB ja havia sido verificada (MOREIRA et al., 2004a; MOREIRA et al., 2004b; NICKEL et al., 2002; FAJARDO et al., 2003), entretanto, sem considerar isolados provenientes do Nordeste brasileiro, identificados posteriormente.

O gene completo da proteina capsidial do GLRaV-3, isolado RC-PE, com 942 nucleotideos e 313 aminoacidos deduzidos, foi amplificado por RTPCR a partir da amostra n[degrees] 101 da cv. 'Ruby Cabernet' de Petrolina-PE. A sequencia de nucleotideos deste isolado (acesso GenBank KJ704369) apresentou identidade entre 99,2-99,7%, com os isolados brasileiros do mesmo virus (DQ680141, DQ680142, DQ062152 de PE) e com o isolado-tipo do GLRaV-3 (NC_004667) e 92,9-93,4%, quando comparado com os outros isolados brasileiros Pet-4 (AY753208 de PE) e IS2 (HM059034 do RS). A identidade de aad entre todos os isolados de GLRaV-3 analisados foi de 94,9% a 100% (Tabela 3). Variabilidade entre isolados de GLRaV-3 ja havia sido verificada (FAJARDO et al., 2007), inclusive considerando alguns isolados provenientes do Nordeste brasileiro.

Apesar das variacoes mais acentuadas terem sido verificadas nas sequencias de nucleotideos, as sequencias de aminoacidos deduzidos das proteinas capsidiais tendem a apresentar menor variacao entre os isolados de regioes geograficas distintas (Tabelas 1, 2 e 3). A proteina capsidial e uma proteina estrutural, assim, fatores evolutivos poderiam restringir as variacoes que seriam deleterias para as tres especies virais. Alteracoes nas proteinas capsidiais poderiam, por exemplo, resultar na perda da capacidade de interacao com vetores ou fatores da planta hospedeira e o fato do GVA, GVB e GLRaV-3 terem como unica hospedeira natural a videira, poderia restringir ainda mais essas alteracoes (MOREIRA et al., 2004b).

A videira e uma planta exotica no Brasil. Assim, as especies virais encontradas infectando, localmente, esta hospedeira, foram originalmente introduzidas com a planta, em um passado distante, ou introduzidas via importacao de mudas, em processo mais recente. A viticultura brasileira e resultado da introducao de cultivares de copa e de porta-enxerto oriundas dos Estados Unidos (cultivares e hibridos de Vitis labrusca, por ex., cv. 'Isabel') e de paises europeus, como Franca e Italia (principalmente cultivares de V. vinifera). Tambem, ao longo do tempo, ocorreu grande redistribuicao de material propagativo e mudas de videiras entre regioes geograficas do Brasil, podendo isto ter contribuido para a redistribuicao dos patogenos virais incidentes (MOREIRA et al., 2004b; PROTAS & CAMARGO, 2011). Assim sendo, os virus constatados nas duas regioes amostradas no Nordeste brasileiro teriam chegado ate estas regioes pelas vias mencionadas. Em relacao a variabilidade genetica dos tres virus estudados, foi possivel verificar elevados niveis de identidade de aminoacidos deduzidos (94,5% a 100%) com outros isolados, previamente caracterizados no Brasil, enfatizando a validade das informacoes sobre possiveis origens comuns dos materiais propagativos infectados de videira.

A compreensao da diversidade genetica da populacao viral e a determinacao da incidencia das especies virais em uma regiao podem viabilizar a diagnose focada em testes diagnosticos "universais", capazes de detectar um maior numero de isolados e estirpes de uma especie viral, favorecendo a implementacao de determinadas praticas de manejo e controle de viroses, alem de possibilitarem a realizacao de estudos epidemiologicos.

CONCLUSAO

A determinacao da incidencia de virus em duas regioes viticolas situadas no Nordeste brasileiro; a identificacao, caracterizacao e estudo da variabilidade genetica de tres isolados virais locais e a robustez demonstrada pelo teste RT-PCR em tempo real para a deteccao dos isolados locais, em conjunto, aprofundam o conhecimento de viroses nas regioes estudadas e contribuem para o desenvolvimento de ferramentas de diagnostico viral mais especificas e sensiveis.

http://dx.doi.org/10.1590/0103-8478cr20140587

AGRADECIMENTOS

Ao Marcos F. Vanni (Embrapa Uva e Vinho), Maria Angelica G. Barbosa (Embrapa Semiarido), Selma C. C. H. Tavares (Embrapa Solos) e Genira P. Andrade (UFRPE), pela colaboracao em diferentes etapas deste trabalho.

REFERENCIAS

BASSO, M.F. et al. Fisiologia foliar e qualidade enologica da uva em videiras infectadas por virus. Tropical Plant Pathology, v.35, p.351-359, 2010. Disponivel em: <http://dx.doi.org/10.1590/ S1982-56762010000600003>. Acesso em: 22 set. 2014. doi: 10.1590/S1982-56762010000600003.

CATARINO, A.M. et al. Detection and partial molecular characterization of isolates of Grapevine leafroll-associated virus 4 and Grapevine rupestris vein feathering virus. Tropical Plant Pathology, v.38, supl., p.840, 2013.

DUBIELA, C.R. et al. Simultaneous detection of Brazilian isolates of grapevine viruses by TaqMan real-time RT-PCR. Tropical Plant Pathology, v.38, p.158-165, 2013. Disponivel em: <http:// dx.doi.org/10.1590/S1982-56762013000200011>. Acesso em: 22 set. 2014. doi: 10.1590/S1982-56762013000200011.

FAJARDO, T.V.M. et al. Deteccao de um isolado de Grapevine virus A e caracterizacao do gene da proteina capsidial. Fitopatologia Brasileira, v.28, p.521-527, 2003. Disponivel em: <http://dx.doi.org/10.1590/S0100-41582003000500009>. Acesso em: 22 set. 2014. doi: 10.1590/S0100-41582003000500009.

FAJARDO, T.V.M. et al. Variability of the coat protein gene of Grapevine leafroll-associated virus 3 in Brazil. Fitopatologia Brasileira, v.32, p.335-340, 2007. Disponivel em: <http://dx.doi. org/10.1590/S0100-41582007000400008>. Acesso em: 22 set. 2014. doi: 10.1590/S0100-41582007000400008.

FIORE, N. et al. Grapevine viruses in the Atacama region of Chile. Journal of Phytopathology, v.159, p.743-750, 2011. Disponivel em: <http://dx.doi.org/10.1111/j.1439-0434.2011.01834.x>. Acesso em: 22 set. 2014. doi: 10.1111/j.1439-0434.2011.01834.x.

KING, A.M.Q. et al. (Eds). Virus taxonomy: ninth report of the International Committee on Taxonomy of Viruses. San Diego: Elsevier Academic, 2012. 1327p.

KUHN, G.B. et al. Viroses da videira identificadas na Regiao do Submedio Sao Francisco no polo viticola Petrolina/Juazeiro. Fitopatologia Brasileira, v.25, supl., p.442, 2000.

LIMA, M.F.; FAJARDO, T.V.M. Doencas causadas por virus. In: LIMA, M.F.; MOREIRA, F.R.B. Uva de mesa--Fitossanidade. Serie Frutas do Brasil 14. 2.ed. Brasilia: Embrapa, 2012. p.43-58.

LIU, M.H. et al. Occurrence of grapevine leafroll-associated viruses in China. Plant Disease, v.97, p.1339-1345, 2013. Disponivel em: <http://dx.doi.org/10.1094/PDIS-01-13-0048-RE>. Acesso em: 22 set. 2014. doi: 10.1094/PDIS-01-13-0048-RE.

MARTELLI, G.P. Grapevine virology highlights 2010-2012. In: CONGRESS OF THE INTERNATIONAL COUNCIL FOR THE STUDY OF VIRUS AND VIRUS-LIKE DISEASES OF THE GRAPEVINE, 17., 2012, Davis, USA. Proceedings... Davis: ICVG, 2012. p.13-31.

MOREIRA, A.E. et al. Caracterizacao do gene da proteina capsidial de dois isolados, patologicamente distintos e sorologicamente semelhantes, do Grapevine virus B em videiras no Estado de Sao Paulo. Fitopatologia Brasileira, v.29, p.75-80, 2004a. Disponivel em: <http://dx.doi.org/10.1590/S010041582004000100011>. Acesso em: 22 set. 2014. doi: 10.1590/ S0100-41582004000100011.

MOREIRA, A.E. et al. Caracterizacao do gene da proteina capsidial do Grapevine virus A em videiras afetadas pela acanaladura do lenho de Kober no Estado de Sao Paulo. Fitopatologia Brasileira, v.29, p.205-208, 2004b. Disponivel em: <http://dx.doi. org/10.1590/S0100-41582004000200015>. Acesso em: 22 set. 2014. doi: 10.1590/S0100-41582004000200015.

NICKEL, O. et al. Detection and coat protein gene characterization of an isolate of Grapevine virus B from corky bark-affected grapevines in Southern Brazil. Fitopatologia Brasileira, v.27, p.279-284, 2002. Disponivel em: <http://dx.doi.org/10.1590/ S0100-41582002000300007>. Acesso em: 22 set. 2014. doi: 10.1590/S0100-41582002000300007.

OSMAN, F. et al. Real-time RT-PCR (TaqMan) assays for the detection of Grapevine leafroll associated viruses 1-5 and 9. Journal Virological Methods, v. 141, p.22-29, 2007. Disponivel em: <http://dx.doi.org/10.1016/j.jviromet.2006.11.035>. Acesso em: 22 set. 2014. doi: 10.1016/j.jviromet.2006.11.035.

OSMAN, F.; ROWHANI, A. Real-time RT-PCR (TaqMan) assays for the detection of viruses associated with Rugose wood complex of grapevine. Journal of Virological Methods, v.154, p.69-75, 2008. Disponivel em: <http://dx.doi.org/10.1016/j. jviromet.2008.09.005>. Acesso em: 22 set. 2014. doi: 10.1016/j. jviromet.2008.09.005.

PROTAS, J.F.S.; CAMARGO, U.A. Vitivinicultura Brasileira: Panorama Setorial de 2010. Brasilia: SEBRAE; Bento Goncalves: IBRAVIN: Embrapa Uva e Vinho, 2011. 110p.

ROTT, M.E.; JELKMANN, W. Characterization and detection of several filamentous viruses of cherry: Adaptation of an alternative cloning method (DOP-PCR) and modification of an RNA extraction protocol. European Journal of Plant Pathology, v.107, p.411-420, 2001. Disponivel em: <http://dx.doi. org/10.1023/A:1011264400482>. Acesso em: 22 set. 2014. doi: 10.1023/A:1011264400482.

SAMBROOK, J.; RUSSELL, D. Molecular cloning: a laboratory manual. 3.ed. New York: CSHL, 2001. 999p.

SHARMA, A.M. et al. Occurrence of grapevine leafroll-associated virus complex in Napa Valley. PLoS One, v.6, p.e26227, 2011. Disponivel em: <http://dx.doi.org/10.1371/ journal.pone.0026227>. Acesso em: 22 set. 2014. doi: 10.1371/ journal.pone.0026227.

THOMPSON, J.D. et al. The Clustal X windows interface: flexible strategies for multiple sequence alignment aided by quality tools. Nucleic Acids Research, v.24, p.4876-4882, 1997.

VOLPE, M.L. et al. Incidence of Grapevine leafroll associated viruses -1, -2, and -3 in Mendoza vineyards. Tropical Plant Pathology, v.35, p.377-380, 2010. Disponivel em: <http://dx.doi. org/10.1590/S 1982-56762010000600007>. Acesso em: 22 set. 2014. doi: 10.1590/S1982-56762010000600007.

Aricleia de Moraes Catarino (I) Thor Vinicius Martins Fajardo (II) * Gilvan Pio-Ribeiro (I) Marcelo Eiras (III) Osmar Nickel (II)

(I) Departamento de Agronomia, Universidade Federal Rural de Pernambuco (UFRPE), Recife, PE, Brasil.

(II) Embrapa Uva e Vinho, CP 130, 95700-000, Bento Goncalves, RS, Brasil. E-mail: thor.fajardo@embrapa.br. * Autor para correspondencia.

(III) Instituto Biologico, Centro de Pesquisa e Desenvolvimento de Sanidade Vegetal, Sao Paulo, SP, Brasil.

Recebido 17.04.14 Aprovado 13.08.14 Devolvido pelo autor 09.10.14 CR-2014-0587.R2
Tabela 1--Identidade (%) das sequencias de nucleotideos (abaixo
da diagonal) e de aminoacidos deduzidos (acima da
diagonal) do gene completo (597 pb, 198 aad) da
proteina capsidial entre diferentes isolados brasileiros
de Grapevine virus A.

Isolados       IT-BA   "GVA-RS"   "GVA-SP"   Is 151

IT-BA          --      95,4       98,9       96,9
"GVA-RS"       89,6    --         94,9       95,4
"GVA-SP"       91,2    89,3       --         96,4
Is151          89,7    90,8       91,9       --

Nome do isolado (codigo de nucleotideos / codigo de aad do
isolado no GenBank, Pais, Estado): IT-BA (KF667501 /
AGX27424, Brasil, BA), "GVA-RS" (AF494187 / AAM14605,
Brasil, RS), "GVA-SP" (AY340581/ AAQ19964, Brasil, SP),
isolado-tipo do GVA: Is151 (NC_003604 / NP_619665, Italia).
Em negrito, informacao do isolado caracterizado neste trabalho.

Tabela 2--Identidade (%) das sequencias de nucleotideos (abaixo
da diagonal) e de aminoacidos deduzidos (acima da diagonal) do
gene completo (594 pb, 197 aad) da proteina capsidial entre
diferentes isolados brasileiros de Grapevine virus B.

Isolados           IS-SVF   CO     CS     BR1    Common   Italia

IS-SVF             --       100    100    100    97,5     96,4
CO                 99,8     --     100    100    97,5     96,4
CS                 99,8     100    --     100    97,5     96,4
BR1                99,8     100    100    --     97,5     96,4
Common             82,7     82,5   82,5   82,5   --       95,4
Italia             92,7     92,6   92,6   92,6   83,7     --
"GVB-italiano"     81,3     81,2   81,3   81,3   98,6     82,5

Isolados           "GVB-italiano"

IS-SVF             97,5
CO                 97,5
CS                 97,5
BR1                97,5
Common             98,9
Italia             95,4
"GVB-italiano"     ---

Nome do isolado (codigo de nucleotideos /codigo de aad do isolado
no GenBank, Pais, Estado): IS/SVF (KF040332 /AGO86377, Brasil,
PE), CO (KF040331 /AGO86376, Brasil, SP), CS (KF040333 /
AGO86378, Brasil, RS), BR1 (AF438410 /AAL40797, Brasil, RS),
Common (AY340582/AAQ19965, Brasil, SP), Italia (AY340583/
AAQ19966, Brasil, SP), isolado/tipo do GVB: "GVB/italiano"
(NC_003602 /NP_619657, Italia). Em negrito, informacao do isolado
caracterizado neste trabalho.

Tabela 3--Identidade (%) das sequencias de nucleotideos (abaixo
da diagonal) e de aminoacidos deduzidos (acima da diagonal) do
gene completo (942 pb, 313 aad) da proteina capsidial entre
diferentes isolados brasileiros de Grapevine leafroll-associated
virus 3.

Isolados      RC-PE   Pet-1   Pet-2   Pet-3   Pet-4   IS2    NY1

RC-PE         --      100     99,6    99,6    95,8    94,9   99,0
Pet-1         99,7    --      99,6    99,6    95,8    94,8   99,0
Pet-2         99,6    99,8    --      99,3    95,5    94,5   98,7
Pet-3         99,5    99,7    99,6    --      95,5    94,5   98,7
Pet-4         93,4    93,4    93,3    93,2    --      96,4   94,8
IS2           92,9    92,8    92,7    92,6    97,7    --     93,9
NY1           99,2    99,4    99,3    99,2    92,8    92,3   --

Nome do isolado (codigo de nucleotideos /codigo de aad do isolado
no GenBank, Pais, Estado): RC/PE (KJ704369 /AID53088, Brasil,
PE), Pet/1 (DQ680141 /ABG76780, Brasil, PE), Pet/2 (DQ680142 /
ABG76781, Brasil, PE), Pet/3 (DQ062152 /AAY62364, Brasil, PE),
Pet/4 (AY753208 /AAV27299, Brasil, PE), IS2 (HM059034 /ADG57581,
Brasil, RS), isolado/tipo do GLRaV/3: NY1 (NC_004667 /NP_813801,
EUA). Em negrito, informacao do isolado caracterizado neste
trabalho.
COPYRIGHT 2015 Universidade Federal de Santa Maria
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:defensa fitosanitaria; texto en portugues
Author:Catarino, Aricleia de Moraes; Fajardo, Thor Vinicius Martins; Pio-Ribeiro, Gilvan; Eiras, Marcelo; N
Publication:Ciencia Rural
Date:Mar 1, 2015
Words:4307
Previous Article:Accuracy and response times of variable rate machines for agricultural defensive application/Acuracia e tempos de resposta de maquinas para aplicacao...
Next Article:Relative humidity during cold storage on Postharvest quality of 'Niagara Rosada' table grapes/Umidade relativa durante o armazenamento refrigerado...
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters