Printer Friendly

In Vivo Selection of a Unique Tandem Repeat Mediated Azole Resistance Mechanism ([TR.sub.120]) in Aspergillus fumigatus cyp51A, Denmark.

Azole antifungal drug resistance in Aspergillus fumigatus is a concern for patients with aspergillosis because of increased risk for disease and death (1). Two routes of acquiring azole resistance have been identified: 1) in vivo, as a consequence of long-term azole treatment; and 2) ex vivo, in the environment, resulting from the use of azole fungicides in crop protection. The underlying mechanisms are primarily linked to structural changes or upregulation of the azole target lanosterol 14 a-demethylase encoded by cyp51A (1). Most environmentally induced resistance mechanisms involve tandem repeats (TRs) in the promoter region of cyp51A coupled with nonsynonymous mutations, TR34/L98H and TR46/Y121F/ T289A (1). However, in vivo resistance development has primarily been associated with nonsynonymous mutations in cyp51A-inducing amino acid substitutions of hot spots (e.g., G54, G138, M220, and G448) or non-cyp51Amediated mechanisms, but not a tandem repeat (1). We describe a clinical case of infection with azole-resistant A. fumigatus that acquired a 120-bp tandem repeat (TR120) resistance mechanism during long-term azole treatment. The finding was substantiated by whole-genome sequencing (WGS).

The Study

In 2013, a 69-year-old man who was a former smoker with chronic obstructive pulmonary disease (COPD) and severe airflow obstruction sought care at the University Hospital in Arhus, Denmark, because of gradually worsening dyspnea, cough, and expectoration. Previously, in 2011, imaging (Figure 1, panel A) and 2 thoracoscopies had been conducted because of suspicion of malignant mesothelioma. Further histopathologic examination and cultures revealed inflammation but no malignancy or mold infection. Subsequently, in 2012, a fistula between pleura and skin led to a persistent air-containing pleural cavity in the right side (Figure 1, panel B). In 2014, a fungus ball in the pleural cavity was found (Figure 1, panel C). Aspergillus IgG titer was 1:25,600 (reference range [less than or equal to]1:200), and azole-susceptible A. fumigatus was cultured from sputum (P-1, May 2014). Voriconazole (200 mg 2x/d) was given, alternating with posaconazole (300 mg/d) for 2 years until clinical failure, and 2 azole-resistant A. fumigatus isolates were cultured from a new sputum sample (P-2 and P-3, June 2016). Despite amphotericin B inhalations followed by liposomal amphotericin B (3 mg/kg 1x/d), the patient died because of severe hemoptysis 1 year later in 2017.

Three A. fumigatus patient isolates (P-1, P-2, and P-3) were available for confirmatory species verification, reference susceptibility testing defined by the European Committee on Antimicrobial Susceptibility Testing using protocol for molds (E.Def 9.3), cyp51A Sanger sequencing (using wild-type reference sequence AF338659), and genotyping using the short tandem-repeat Aspergillus fumigatus (STRAf assay (2,3) (Table). We included 4 A. fumigatus isolates representing relevant cyp51A profiles as control strains (SSI-3614 [wild-type], SSI-7828 [[TR.sub.34]/L98H], SSI-5717 [[TR.sub.46]/Y121F/T289A], and SSI-5197 [F46Y/M172V/ E427K]). We detected 3 common Cyp51A variants (F46Y, M172V, and E427K) in the susceptible patient isolate P-1 (GenBank accession no. MG972984). Pan-azole resistance was observed for P-2 and P-3, and both shared cyp51A profiles with P-1 but also harbored a TR120 mechanism (GenBank accession no. MG972983) in the promoter region (Table). All patient isolates had identical STRAf genotypes suggesting that they were isogenic (Table 1) (4). Furthermore, the STRAfprofile was unique among A. fumigatus isolates genotyped in Denmark (Appendix Figure, https://wwwnc.cdc.gov/EID/article/25/3/18-0297-App1.pdf).

We performed WGS for P-1, P-3, and all control strains to investigate relatedness and other potential mechanisms conferring azole resistance. We subjected total DNA ([approximately equal to] 10 ng/pL) to WGS (NextSeq 550; Illumina, https://www.illumina.com) by using Nextera DNA library preparation kit (Illumina) and following the manufacturer's instructions. We used NASP (5) to detect single-nucleotide polymorphisms (SNPs) after removal of duplicated regions in the A. fumigatus strain Af293 chromosomes (http://www.aspergillusgenome.org, genome version s03-m05-r09) using NUCmer (6). We inferred relatedness by using FastTree version 2.1.5 (7) and a 77.69% core genome (Table; Figure 2). To increase resolution, we conducted a subanalysis for P-1 and P-3 (core genome 79.71%), which identified 41 SNP differences; 6 of the SNPs were nonsynonymous in genes with no previous reported association to azole resistance (Appendix Table 1), and 35 were either synonymous or in noncoding regions (Appendix Table 2).

Conclusions

WGS revealed 41 SNP differences between the susceptible and the resistant patient A. fumigatus isolates that evolved during 2 years, similar to a previously described case of inhost microevolution of A. fumigatus (4). This finding substantiated an isogenic relationship between P-1 and P-3 and demonstrated that the [TR.sub.120] resistance mechanism emerged from P-1, probably during long-term azole therapy. Furthermore, WGS results supported the conclusion that the [TR.sub.120] was the sole mechanism of azole resistance in the azole-resistant patient isolates.

To our knowledge, the [TR.sub.120] is a novel azole-resistance mechanism in A. fumigatus, and the in vivo selection of a tandem repeat in the promoter of cyp51A is unique. The de novo acquisition of a TR has not previously been shown in vitro or in the environment (i.e., no isolates with L98H or Y121F+T289A combined with wild-type promoters have been reported). However, triplication of an existing [TR.sub.34] on tebuconazole exposure was selected in vitro, and a novel variant, [TR.sub.46.sup.3], found in clinical and environmental samples, has been derived from sexual mating between [TR.sub.46] parents (8,9).

Azole resistance involving TRs in the promoter region has been associated exclusively with environmental fungicide selection pressure in A. fumigatus and other plant pathogens. Furthermore, although asexual propagation of A. fumigatus with [TR.sub.34]/L98H or [TR.sub.46]/Y121F/T289A resistance mechanisms is widespread in the environment, the extent of de novo selection of [TR.sub.34]/L98H and [TR.sub.46]/Y121F/ T289A is unclear (10). One hypothesis describes both environmental resistance mechanisms as being derived from single events of sexual reproduction (in environmental habitats) combining the TR with a cyp51A mutant. In addition, sexual reproduction might have led to a high genetic diversity among environmental azole-resistant A. fumigatus, which otherwise might have indicated multiple origins (10). Our finding might challenge the perception that TR azole-resistance mechanisms are exclusive to the environment and might warrant the question of whether [TR.sub.34]/ L98H and TR46/Y121F/T289A derive from single events.

Hypothetically, the patient might initially have inhaled isogenic isolates with and without [TR.sub.120], the resistant one being undetected. However, a patient being co-infected de novo by a susceptible and an isogenic resistant strain has not been previously reported and is considered highly unlikely.

Long-term and subtherapeutic antifungal treatment might facilitate selection of resistance (ll). Therapeutic drug monitoring was performed once in this patient but without information if the sample was taken according to guidelines as a trough level (lowest level after dosage). Thus, despite a concentration of 4.3 mg/L (within the recommended trough range), potential subtherapeutic levels during the 200 mg 2x/d dosing scheme cannot be ruled out. The F46Y/M172V/E427K substitutions in Cyp51A, found in both susceptible and resistant isolates, have been suggested to play no role or only a minor role in reduced azole susceptibilities (12,13). TRs in the promoter region of cyp51A have previously been linked to increased cyp51A gene expression and MICs because of duplicated srbA transcription factor binding motifs (SRE1 and SRE2), leading to increased expression of cyp51A (14,15). Taken together, our data suggest that [TR.sub.120] alone is an important driver of pan-azole resistance at a level comparable to that known to be mediated by the [TR.sub.34]/L98H mechanism.

Our WGS results might obviate the desire for in vitro experiments testing the [TR.sub.120] mechanism in laboratory-engineered mutants. Further dissection of the WGS data can help elucidate potential genetic drivers of TR acquisition and add further knowledge as to whether the [TR.sub.34]/L98H and [TR.sub.46]/Y121F/T289A resistance genotypes derived from a single origin. This report adds another piece to the complex picture of emerging azole-resistant A. fumigatus and might serve to stimulate further research.

Acknowledgments

We thank the entire Mycology Laboratory at Statens Serum Institut for their invaluable work in culturing, identification, and antimicrobial susceptibility testing. We acknowledge the staff responsible for the WGS workflow for their expedited service. We also thank laboratory technicians involved in PCR and DNA analyses, including Nissrine Abou-Chakra, for their invaluable aid and expertise in molecular biology.

Dr. Hare is a molecular biologist at the Mycology Laboratory at Statens Serum Institut, Copenhagen, Denmark, where he completed his PhD on antifungal drug resistance in 2016.

Besides antifungal resistance, his main research interests are molecular fungal diagnostics.

References

(1.) Meis JF, Chowdhary A, Rhodes JL, Fisher MC, Verweij PE. Clinical implications of globally emerging azole resistance in Aspergillus fumigatus. Philos Trans R Soc Lond B Biol Sci. 2016;371:20150460.

(2.) Subcommittee on Antifungal Susceptibility Testing of the ESCMID European Committee for Antimicrobial Susceptibility Testing. EUCAST technical note on the method for the determination of broth dilution minimum inhibitory concentrations of antifungal agents for conidia-forming moulds. Clin Microbiol Infect. 2008;14:982-4. http://dx.doi.org/10.1111/j.1469-0691.2008.02086.x

(3.) de Valk HA, Meis JF, Curfs IM, Muehlethaler K, Mouton JW, Klaassen CHW. Use of a novel panel of nine short tandem repeats for exact and high-resolution fingerprinting of Aspergillus fumigatus isolates. J Clin Microbiol. 2005;43:4112-20. http://dx.doi.org/10.1128/JCM.43.8.4112-4120.2005

(4.) Ballard E, Melchers WJG, Zoll J, Brown AJP, Verweij PE, Warris A. In-host microevolution of Aspergillus fumigatus: a phenotypic and genotypic analysis. Fungal Genet Biol. 2018; 113:1-13. http://dx.doi.org/10.1016Zj.fgb.2018.02.003

(5.) Sahl JW, Lemmer D, Travis J, Schupp JM, Gillece JD, Aziz M, et al. NASP: an accurate, rapid method for the identification of SNPs in WGS datasets that supports flexible input and output formats. Microb Genom. 2016;2:e000074. http://dx.doi. org/10.1099/mgen.0.000074

(6.) Delcher AL, Salzberg SL, Phillippy AM. Using MUMmer to identify similar regions in large sequence sets. Curr Protoc Bioinformatics 2003;00:10.3.1-10.3.18.

(7.) Price MN, Dehal PS, Arkin AP. FastTree 2--approximately maximum-likelihood trees for large alignments. PLoS One. 2010;5:e9490. http://dx.doi.org/10.1371/journal.pone.0009490

(8.) Snelders E, Camps SMT, Karawajczyk A, Schaftenaar G, Kema GHJ, van der Lee HA, et al. Triazole fungicides can induce crossresistance to medical triazoles in Aspergillus fumigatus. PLoS One. 2012;7:e31801. http://dx.doi.org/10.1371/journal.pone.0031801

(9.) Zhang J, Snelders E, Zwaan BJ, Schoustra SE, Meis JF, van Dijk K, et al. A novel environmental azole resistance mutation in Aspergillus fumigatus and a possible role of sexual reproduction in its emergence. MBio. 2017;8:e00791-17.

(10.) Abdolrasouli A, Rhodes J, Beale MA, Hagen F, Rogers TR, Chowdhary A, et al. Genomic context of azole resistance mutations in Aspergillus fumigatus determined using whole-genome s equencing. MBio. 2015;6:e00536.

(11.) Verweij PE, Zhang J, Debets AJM, Meis JF, van de Veerdonk FL, Schoustra SE, et al. In-host adaptation and acquired triazole resistance in Aspergillus fumigatus: a dilemma for clinical management. Lancet Infect Dis. 2016;16:e251-60. http://dx.doi.org/10.1016/S1473-3099(16)30138-4

(12.) Snelders E, Karawajczyk A, Schaftenaar G, Verweij PE, Melchers WJG. Azole resistance profile of amino acid changes in Aspergillus fumigatus CYP51A based on protein homology modeling. Antimicrob Agents Chemother. 2010;54:2425-30. http://dx.doi.org/10.1128/AAC.01599-09

(13.) Garcia-Rubio R, Alcazar-Fuoli L, Monteiro MC, Monzon S, Cuesta I, Pelaez T, et al. Insight into the significance of Aspergillus fumigatus cyp51A polymorphisms. Antimicrob Agents Chemother. 2018;62:e00241-18. http://dx.doi.org/10.1128/AAC.00241-18

(14.) Snelders E, Camps SMT, Karawajczyk A, Rijs AJMM, Zoll J, Verweij PE, et al. Genotype-phenotype complexity of the TR46/ Y121F/T289A cyp51A azole resistance mechanism in Aspergillus fumigatus. Fungal Genet Biol. 2015;82:129-35. http://dx.doi.org/10.1016/jTgb.2015.06.001

(15.) Gsaller F, Hortschansky P, Furukawa T, Carr PD, Rash B, Capilla J, et al. Sterol biosynthesis and azole tolerance is governed by the opposing actions of SrbA and the CCAAT binding complex. PLoS Pathog. 2016;12:e1005775. http://dx.doi.org/10.1371/ journal.ppat.1005775

Address for correspondence: Maiken C. Arendrup, Statens Serum Institut, Building 43-317, Artillerivej 5, 2300, Copenhagen S, Denmark; email: maca@ssi.dk; Rasmus K. Hare, Statens Serum Institut, Building 43-315, Artillerivej 5, 2300, Copenhagen S, Denmark; email: rmj@ssi.dk

Author affiliations: Statens Serum Institut, Copenhagen, Denmark (R.K. Hare, K.M.T. Astvad, M. Stegger, P.S. Andersen, M.C. Arendrup); Aarhus University Hospital, Aarhus, Denmark (J.B. Gertsen, K.B. Degn, A. Lokke, L. Kristensen); Rigshospitalet, Copenhagen (M.C. Arendrup); University of Copenhagen, Copenhagen (M.C. Arendrup)

DOI: https://doi.org/10.3201/eid2503.180297

Caption: Figure 1. Sequential thoracic computed tomography scan images illustrating the gradual progression from pleural thickening to cavity formation and development of an aspergilloma in a patient with Aspergillus fumigatus infection, Denmark, 2013. A) 2011, B) 2012, C) 2014, D) 2016.

Caption: Figure 2. Unrooted phylogenetic tree based on whole-genome sequencing of 2 patient isolates (P-1 and P-3) and 5 reference strains to highlight relatedness between Aspergillus fumigatus isolates, Denmark, 2018. We inferred relatedness by using FastTree version 2.1 (7) based on a 77.69% core genome. Whole-genome sequencing identified 41 single- nucleotide polymorphism (SNP) differences between P-1 and P-3. We observed subtle differences (<5,000 SNPs) between unrelated patient isolate SSI-5197 and P-1/P-3, whereas >100,000 SNPs differed from P-1/P-3 to the other control strains and Af293. WT, wild- type. Scale bar indicates nucleotide substitutions per site.
Table. Aspergillus fumigatus strain characteristics, antimicrobial
susceptibility, and molecular data, Denmark, 2013 *

                   EUCAST-based
              susceptibility MICs,
                    mg/L
                                     Sanger sequencing: Cyp51A
Isolate no.   VRZ   ITZ     POS         profile ([section]

P-1            1    0.5    0.125         F46Y/M172V/E427K
P-2            4     16     0.5    [TR.sub.120]/F46Y/M172V/E427K
P-3            4    >16     0.5    [TR.sub.120]/F46Y/M172V/E427K
SSI-5197       1     1     0.125         F46Y/M172V/E427K
SSI-7413      0.5   0.25   0.125                WT
Af293 (13)     1    0.5    0.06    F46Y/M172V/N248T/D255E/E427K
SSI-5946       4    >16     0.5          [TR.sub.34]/L98H
SSI-5717      >4    0.5    0.25       [TR.sub.46]/Y121F/T289A

              STRAf assay genotyping data: ([dagger])
Isolate no.          2A-2B-2C-3A-3B-3C-4A-4B-4C

P-1                    10-13-10-17-13-8-7-5-6
P-2                    10-13-10-17-13-8-7-5-6
P-3                    10-13-10-17-13-8-7-5-6
SSI-5197              10-15-10-28-13-11-7-5-6
SSI-7413              21-25-19-28-12-6-20-10-8
Af293 (13)           26-18-18-46-21-23-11-10-8
SSI-5946              20-21-12-84-10-7-8-9-10
SSI-5717              26-21-16-32-9-10-8-14-10

              WGS data: ([double dagger])
                    SNP differences
Isolate no.        compared with P-1

P-1                        0
P-2                       NA
P-3                       41
SSI-5197                 4,968
SSI-7413                105,900
Af293 (13)              102,727
SSI-5946                108,901
SSI-5717                108,882

* ITZ, itraconazole; NA, not available; POS, posaconazole; SNP,
single-nucleotide polymorphism; STRAf, short tandem repeat Aspergillus
fumigatus; VRZ, voriconazole (isavuconazole MICs were equivalent, data
not shown); WGS, whole-genome sequencing; WT, wild-type.

([dagger]) STRAf genotyping was performed as previously described (3).
Underlined STRAf markers are shared with P-1.

([double dagger]) Reference genome coverage ranged from 88.5% to
90.93%. Sequencing depth based on all assembled contigs >1,000 bp
ranged from 57.2x to 80.7x; 71.1 x for P-1; and 66.3x for P-3.

([section]) [TR.sub.34]: GAATCACGCGGTCCGGATGTGTGCTGAGCCGAAT, TR46:
AGTTGTCTAGAATCACGCGGTCCGGATGTGTGCTGAGCCGAATGAA. [TR.sub.120]:
TTCTCCTCTAGAAAAAACTCATGAGTGAATAATCGCAGCACCACTCCAGAGTTGTCTAGAATCACGCGGT-
CCGGATGTGTGCTGAGCCGAATGAAAGTTGCCTAATTACTAAGGTGTAGT. GenBank accession
numbers are MG972983 with TR120 and MG972984 without TR120.
COPYRIGHT 2019 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2019 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:DISPATCHES
Author:Hare, Rasmus K.; Gertsen, Jan B.; Astvad, Karen M.T.; Degn, Kristine B.; Lokke, Anders; Stegger, Mar
Publication:Emerging Infectious Diseases
Article Type:Report
Date:Mar 1, 2019
Words:2564
Previous Article:Acute Flaccid Myelitis Associated with Enterovirus D68 in Children, Argentina, 2016.
Next Article:Listeria monocytogenes Associated with Pasteurized Chocolate Milk, Ontario, Canada.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters