Printer Friendly

Impact of geographical isolation on genetic differentiation in an insular population of the carpet shell Ruditapes decussatus in the Mediterranean Basin.

ABSTRACT Genetic variation was investigated using allozymes, cytochrome c oxidase subunit I, internal transcribed spacer region 1, and microsatellite markers in mainland and insular populations of the carpet shell Riuiitapes decussatus from the western and eastern Mediterranean Basin. Five morphometric parameters and weight of valves were also used to study the distribution of variation within and among populations. The species is characterized by a relatively high inter- and intrapopulation morphological and genetic variability. The highest values of percent polymorphism and heterozygosity (allozyme and microsatellite data) were found in the sample from Kerkennah Island. The occurrence of higher levels of genetic variability in insular population is probably because this population inhabit marginal environment characterized by temporal- ecological instability. The genetic heterogeneity analysis demonstrates a certain amount of genetic differentiation among local populations of R. decussatus with a relatively high level of genetic subdivision. Sample from Kerkennah Island was differentiated from almost all other populations. Kerkennah Island clams are also the most different in morphology. This study was intended to elucidate, from genetic markers and morphometric parameters, the relative importance of the biogeographical properties of islands on the observed patterns of differentiation of the Kerkennah population.

KEY WORDS: Ruditapes decussatus, genetic differentiation, Kerkennah Island. Tunisia

INTRODUCTION

Studies of genetic structure in marine species continue to increase, especially concerning commercially exploited species (Utter 1991, Thorpe et al. 2000). Some of the main putative roles for genetics in marine fisheries may be summarized as understanding the structuring of populations; identification of stocks (breeding units) and units for conservation; mixed stock analysis; genetic effects on growth rate, survival, disease resistance, or other important parameters; and development of strains for captive breeding. All of these possible uses are potentially relevant to marine species, and, of course, they are not all mutually exclusive; they are not completely discrete and in any practical application there is likely to be a degree of overlap between many of them. For example, the identification of breeding units is likely to entail understanding the structuring of populations and possibly also the identification and separation of mixed stocks (Thorpe et al. 2000).

The carpet shell Ruditapes decussatus (Linnaeus, 1758) was chosen as it is a commercially valuable bivalve mollusc. It is a morphologically and ecologically variable species occurring in a wide variety of habitats over its distribution range, which extends from the North Sea to the coast of Senegal and along the coasts of the whole Mediterranean, reaching as far east as the Red Sea. The carpet clam is a euryhaline species often occurring in marine and coastal lagoon habitats, lives in muddy sand sediments of tidal flats or shallow coastal areas (Parache 1982). It is a gonochoric species with external fertilization and planktonic larvae, although rare juvenile hermaphroditism has been reported (Lucas 1968). Hatchery experiments have shown that the duration of the planktotrophic larval stage is 8-10 days at 25[degrees]C (Borsa et al. 1994). Adult clams are sedentary. Samples of R. decussatus analyzed in this study were collected from either mainland or insular areas.

Marine organisms that inhabit isolated islands are faced with limited adult habitat and with marine currents that advect larvae away from the source population; some species have probably developed mechanisms for population maintenance, but these remain largely unknown at the present time. Thus the problems of recruitment of island resources differ significantly from those of species associated with continental shelf and slope regions, regardless if in boreal, temperate, or tropical regions.

Several early studies held that insular populations appear to have considerable importance for ecology and evolution (Otto & Endler 1989, Futuyma 1998). Insular populations often characterize the total genetic structure on the phylogeography of the species as a whole (Cheylan et al. 1998, Paetkau et al. 1998). As shown in the list of extinct species during the past several decades, a substantial proportion of endangered and vulnerable organisms are insular forms (Frankham 1997). The reasons for their higher extinction risk remain controversial, but recent conservation practice regards loss of genetic variability as one of the driving forces for extinction (Sheridan 1995, Meffe 1996). Species or populations with low genetic variability would be expected to have such reduced ability to cope with environmental change during evolution that they have a shorter evolutionary lifespan (O'Connel & Wright 1997). Although few empirical demonstrations for such associations in wildlife are available, there are many, though indirect, examples from genetics that support this hypothesis (Frankham 1995).

Theoretical models of subdivided finite populations consider local extinction, migration, and mutation rates as determinants of genetic variability (Slatkin 1977, Wade & McCauley 1988, Hedrick & Gilpin 1997). Compared with mainland populations, insular populations tend to have quantitatively lower genetic variability, because topographical isolation limits immigration and the smaller carrying capacity enhances the probability of local extinction through stochastic events (Gilpin & Soule 1986). More detailed analysis, however, is expected to reveal that each insular population possesses its own unique genetic variability according to the geographic properties of the island that can affect patterns of migration and extinction rates. One goal of conservation is to maintain the evolutionary potential of species or populations under natural environmental conditions (Jones et al. 1996). In this context, the genetic status of the population concerned should be assessed for deviation from the above expectation rather than by the detected genetic variation itself.

Allozyme variation in some populations of Ruditapes decussatus was already studied by (Gharbi et al. 2011) who provided evidence of high level of genetic variability in almost all populations and especially in insular population. Indeed, genetic variation and differentiation in populations of the species were previously also investigated by Gharbi et al. (2010), based on the sequencing of a portion of a mitochondrial gene and of the internal transcribed spacer region 1 (ITS1).

Genetic and morphometric variability of some Ruditapes decussatus populations was investigated paying particular attention to the Kerkennah insular population. Specifically, the following questions were posed: (1) Is Kerkennah Island population genetically and morphologically differentiated from mainland populations? (2) Do Kerkennah sample exhibit particular changes in the overall genetic diversity?

MATERIALS AND METHODS

Specimen Collection

Samples of Ruditapes decussatus used in this study were obtained from nine mainland localities of western and eastern Mediterranean, and from two insular areas (Kneiss Island and Kerkennah Island). The precise geographic origin of each sample and the number of individuals analyzed per population are indicated in Figure 1 and in Table 1.

Morphological A nalysis

A total of 340 specimens of Ruditapes decussatus were collected from 11 localities in Tunisian waters (Table 1). They have a variety of shapes and colors. Five morphometric parameters of shell valves were measured, including the width (greatest anteroposterior dimension), height (greatest dorsoventral dimension), the thickness of the tightly closed animal and two angles (see Fig. 2). All measurements were made by one person, the writer, with a sliding caliper reading directly to millimeters and by a vernier to 0.1 mm. The valves were also weighed on a balance sensitive to 0.01 g.

Two categories of studies were carried out: the first study was based on analysis of both variances and means of morphological characters using analysis of variance, Fisher's Fand least significant difference tests, and Student's /-test; the second study were submitted to multivariate analysis, the principle component analysis (PCA), all analysis using STATISTICA program.

Allozyme Analysis

Electrophoresis

The electrophoretic analysis was undertaken also for 346 specimens from 11 localities, on the eastern and western Mediterranean coasts of Tunisia, to establish the extent of gene flow and levels of genetic differentiation across the known Siculo-Tunisian region. Gene products for 15 presumptive enzyme loci were analyzed (Hk-1, Mod-1, Mod-2, Est-3, Est-14, Sod-1, Idh-1, Mpi-1, Lap-1, Pgm-1, Pgm-2, Mdh-1, Mdh-2, Gpi-1, and Aat-1). The buffer systems used, electrophoretic procedures, and loci and allele designations were describe in Gharbi et al. (2011).

Analysis

Genotypic and allelic frequencies were determined by direct counts from allozyme phenotypes, and the resulting data were analyzed by various statistical methods to describe the genetic structure of the Ruditapes decussatus populations. All genetic variability and genetic distance measures were calculated using the computer programs GENETIX 4.03 (Belkhir et al. 2001) and GENEPOP 3.4 (Raymond & Rousset 2003). An estimation of phenetic relationships among populations was obtained by generating a phenogram of all samples by means of the unweighted pair-group method with arithmetic averaging (UPGMA) based on the matrix of Nei's unbiased genetic distances (Sneath & Sokal 1973).

Cytochrome c Oxidase Subunit I and ITS1 Analysis

Sequences analysis was performed respectively on 561 bp of the cytochrome c oxidase subunit I (COI) of mitochondrial DNA (mtDNA) and on 597 bp of ITS1 gene amplified by the polymerase chain reaction (PCR). Amplification conditions were described in Gharbi et al. (2010).

Data analyses were performed using ARLEQUIN 3.0 (Excoffier et al. 2005). Intrapopulation diversity was quantified by estimating gene diversity (h) (based on the frequency of haplotypes within a population), and nucleotide diversity (7t) (as the average number of nucleotide substitutions per site for the sequences sampled). To estimate the amount of gene flow between populations and to test for the geographic structuring of collections, the pairwise genetic distances of fixation index ([F.sub.ST]) was calculated with analysis of molecular variance in Arlequin.

Microsatellites Analysis

Detectable levels of genetic variation often depend on the sensitivity of molecular markers examined. Microsatellite DNA is effective in detecting variation in some species with low levels of either allozyme or mtDNA polymorphism (Brunner et al. 1998).

In this study, a published expressed sequence tag (EST) database for Ruditapes decussatus (Tanguy et al. 2008) was used to search microsatellites. A total of 4,640 target EST of R. decussatus were downloaded from the NCBI-EST database and subject to bioinformatic analyses. All the EST were screened for potential microsatellites by using the software "Tandem Repeat Finder" (Benson 1999). A total of EST or genes were chosen for pilot tests for primer design, locus amplification, and polymorphism. Twenty-one of these EST contained microsatellites inside were maintained. Software "Primer 3" (http://www.genome.wi.mit.edu/cgi-bin/primer/) was used to design primers for the amplification of repeat regions of interest across the flanking regions.

After PCR amplification and polymorphism test for microsatellites, seven of the 21 EST-microsatellites were found to be polymorphic in Ruditapes decussatus populations. In this study five microsatellites loci were only genotyped (from dec-1 to dec-5; Table 2).

Amplification reactions were performed in 25 [micro]l volumes containing pure Taq Ready-to-go PCR beads from Amersham Biosciences, 2 of DNA extract and 1 [micro]l from each primer (with the forward primer fluorescently labeled). A precycling denaturation step of 3 min at 94[degrees]C was followed by 45 cycles of 94[degrees]C denaturation for 1minute, 53[degrees]C annealing for lmin, and 72[degrees]C extension for 1minute, followed by a final extension step of 72[degrees]C for 10 min. Primer sequences, type of microsatellite repeats, and PCR conditions for polymorphic microsatellites loci are described in Table 2. PCR products were run on an ABI PrismTM 310 automated sequencer and analyzed with the GeneMapper Software Version 4.0 to provide alleles calls.

RESULTS

Morphological Analysis

The analysis of variance and Fisher's least significant difference test for several examined characters revealed significant average differences (P < 0.05) among sampling sites, leading to the rejection of the null hypothesis of "no heterogeneity". Significant differences in variances and means for valves' weight, width, height, and thickness were revealed. Samples from Kerkennah Island and from Monastir were different from others samples, they have larger shells than the others (Fig. 3).

According to correlation matrix (data not shown), the most important discriminative character in distinguishing between the samples was width, which contributed to defining the first PC A axis (axis 1). Both angle alpha and angle beta defined the second and the third axes (Fig. 4).

The PCA of Ruditapes decussatus variables yielded three initial factorial axes, accounting for 63.56%, 18.78%, and 17.62% of total variance, respectively. Hence, the three axes were chosen for the analyses to expressing variation; however, here we have only plotted two PCA axes. Transforming and plotting the expression data in a two-dimensional graph resulted in a relatively distinction among the 11 studied localities (Fig. 4). The Kerkennah island sample, which projected onto the positive side of axis 1, was the most extreme sample along PCA axis 1 and seems to be different from all others samples.

Allozyme Genotyping

Of the 15 electrophoretic loci analyzed, 6 (40%) were monomorphic and fixed for the same allele in all samples, whereas the remaining 9 (60%) loci were found to be polymorphic showing from 3 (Mdh-2) to 7 alleles (Gpi and Mpi) (Gharbi et al. 2011).

Quantitative parameters of the genetic variability, heterozygosity (H), proportion of polymorphic loci at the 95% criterion (P95) and the mean number of alleles per locus (A), showed a high genetic variation among all samples (Table 3). The observed heterozygosity (Ho) values ranged from 0.24 to 0.36 and were the highest in the Kerkennah Island sample. Positive multilocus estimates of the fixation index (FIS) values at almost all populations indicated significant heterozygote deficiencies (Table 3).

Pairwise Fsx values are given in Table 4 and were significantly different from 0 (P < 0.05) in 30 (54%) of the 55 comparisons. After the sequential Bonferroni correction, 23 of the pairwise comparisons remained statistically significant. All significant [F.sub.ST] values were found between populations belonging to different regions (western and eastern regions) and between the insular population of Kerkennah and almost all the remaining populations.

Clams from these other 10 populations, however, evidently do not constitute a single homogeneous population. The genetic relationships among the samples studied are presented in Figure 5. The UPGMA clustering procedure revealed two main clusters in the phenogram constructed on the basis of the matrix of Nei's unbiased genetic distances. The first cluster includes the related samples (Faroua, Mzjemil, and Tunis) belonging to western Mediterranean basin; however, the second cluster includes remaining samples from the eastern Mediterranean one. The Kerkennah Island sample is genetically distinct from the samples belonging to the same geographic region, and it is located in a separate branch.

Cytochrome c Oxidase Suhunit I and IT SI Analysis

Twenty putative haplotypes (H1-H20) resulting from 20 variable sites were detected from the mtDNA COI gene. The number of haplotypes per site ranged from 2 to 6. The frequency of H1 was higher than 70% in Ruditapes decussatus sample and was the only haplotype shared by all populations, whereas the majority of the other haplotypes (65%) were unique. Within locality, genetic diversity was estimated in terms of haplotype diversity (h) and nucleotide diversity (7t) (Table 3). Both diversity indices were highest in Kerkennah and Kneiss Islands. As shown in Table 5, [F.sub.ST] values were generally low, suggesting small genetic differentiation between samples.

A total of 21 different haplotypes (H1-H21) were found among all samples for ITS]. The haplotypes differed from one another by 1-4 mutations (indels excluded), and had pairwise sequence divergence values ranging from 0.17% to 0.68%. Compared with COI, genetic diversity indices of ITS1 were high. The overall n value was 0.0021 and the within population [pi] values ranged from 0.0013 to 0.0056 (Table 3). Haplotype diversity values ranged from 0.384 to 0.933 (Table 3).

Pairwise [F.sub.ST] values were significantly different from 0 (P < 0.05) in 21 (38%) of the 55 comparisons including all populations (Table 5).

The most common haplotypes within populations described in this article have been submitted to the GenBank data library under accession nos KC149953-KC149960 and HQ179957-HQ179965 for COI and ITS1, respectively.

Microsatellite Variability

The five analyzed loci were found to be polymorphic showing from 6 (dec-5) to 12 alleles (dec-1). The mean expected heterozygosity (He) and Ho of these polymorphic loci are given in Table 6 and ranged from 0.58 to 0.66 and from 0.33 to 0.50, respectively. Higher heterozygosities and number of alleles were observed for Kerkennah island sample. When the frequencies and distributions of the alleles and genotypes were compared under the Hardy-Weinberg equilibrium expectation for an ideal population (random mating, no mutation, no drift, and no migration), all loci showed heterozygote deficits (occurs when there are more homozygotes than expected under HardyWeinberg equilibrium) in all samples. Likewise, the multilocus test by population showed departure from panmixia in all populations with a significant (P <0.05) heterozygote deficiency (Table 6). The between pairs of population [F.sub.ST] estimates are given in Table 7. All pairwise comparisons are presented for these populations. [F.sub.ST] values varied between -0.002 and 0.054. Among 15 comparisons, 8 (53%) were significantly different from 0 (P < 0.05) and after the sequential Bonferroni correction, only two of the pairwise comparisons remained statistically significant. These significant [F.sub.ST] concerned the comparisons between the insular population of Kerkennah and almost all the remaining populations.

DISCUSSION

The species Ruditapes decussatus is characterized by a relatively high inter- and intrapopulation variability in morphological traits. Various ecological factors are identified for their effect on bivalve shell shape: wave impact, trophic conditions, water depth, density, etc. (Seed 1980, Caill-Milly et al. 2012). Other factors such as nature of the sediment have also been proposed for their influence on Venerids' shape. For example, for Gerard (1978), the nature of the sediment is of a great influence on the sharpness of the shell. In this study, globular character was depicted in region with muddy substrates (data not shown).

Specimens from Kerkennah Island show significant distinctive morphological characteristics. They have thicker and larger valves perhaps to avoid predation or could be related to the "island rule". Mainland small animals tend to develop larger body sizes after colonizing islands for ecological strategy (Lomolino 1985, 2005).

Islands are somehow fragile and tend to have fewer species than mainland areas. Therefore, predation pressure on island may be stronger than in mainland areas because the resource base is reduced: specimens with a large body size in Kerkennah Island are in some way a result of the combination of the interspecific competition and predation pressure.

Moreover, from an evolutionary point of view, defense against predator is considered as the most important function of the shell as reminded by Tokeshi et al. (2000). Considering different species of bivalves including a related species Ruditapes variegatus, these authors pointed out that the larger the shell, the more resistant the shell is regarding breakage by predators. For Macoma balthica in the North Sea, the hypothesis of a selective predation of the more globular shells has been proposed by Luttikhuizen et al. (2003).

In this study, the results of the allozyme analyses indicate that genetic variability is relatively high in Ruditapes decussatus. The level of polymorphism was within the range detected in marine invertebrates, whereas the average heterozygosity (Ho = 0.29) was higher than the average 0.15 reported for these organisms (Berger 1983, Buroker 1983, Gallardo et al. 1998). The highest values of heterozygosity were found in the sample from Kerkennah Island. Likewise, the level of genetic variability for COI and ITS 1 markers quantified using h and [pi] was high for the two populations from Kerkennah and Kneiss islands.

Based on the theory (see e.g., Nei et al. 1975) levels of genetic variability in the insular sample of Ruditapes decussatus are expected to be low because this is more subject to the effects of geographic isolation, smaller population size, and founder effect. Nevertheless, results were in some way not congruent with these expectations as sample from Kerkennah island was characterized by levels of percent polymorphism and heterozygosity similar and sometimes higher than those observed in most of mainland populations. This finding is in agreement with the microsatellites data. This is probably because the insular populations inhabit marginal environments characterized by temporal and ecological instability. According to Lewontin (1974), in such environments no particular genotype is favored for long periods and natural populations usually show levels of genetic variability higher than those found in more stable environments. On the basis of these considerations, finding greater genetic variability in insular populations of R. decussatus could indicate that high heterozygosity levels can be preserved after colonization events in marginal populations of invertebrates, unless founder populations are so small that bottleneck effects occur.

The investigated sample from Kneiss Island exhibit genetic variability similar to mainland ones. One of the islands considered here (Kerkennah) is a large island (160 [km.sup.2]), whereas the other (Kneiss) is a tiny island (0.5 [km.sup.2]), and is separated by a relatively short geographic distance from mainland. In general, the magnitude of the stochastic factors that affect insular populations can vary according to island size. Levels of genetic diversity have been related to, among other things, island size, because larger islands can usually sustain higher population sizes, whereas small islands with lower population sizes are frequently associated with inbreeding, genetic bottlenecks, and higher extinction rates. A coastline of ~110 km in the Kerkennah Island could promote sufficient population sizes of Ruditapes decussatus as to avoid significant levels of inbreeding and/or genetic drift.

As deduced from h within a population, the level of genetic variability quantified using [pi] may be explained by the rate of gene flow. We hypothesize that the genetic variability on each island is a product of a dynamic equilibrium maintained by stochastic events, that is, continuous immigration from the mainland population balanced by local extinction. This view is analogous to the theory of island biogeography (MacArthur & Wilson 1967, MacArthur 1972), although we have examined populations rather than communities and focused on genetic variability rather than species richness.

The results illustrate that the geographical properties of islands allow for particular genetic equilibria. When an island is located far from the mainland and other conditions remain the same, the migration rate will be low owing to the isolation by distance, and accordingly the equilibrated genetic variability will be low. Likewise, when an island is small in size, the extinction rate of a haplotype will be high owing to the effects of demographic and genetic stochasticity (Gilpin & Soule 1986), and accordingly the equilibrated genetic variability will be low. Namely, for a given island size, populations on more isolated islands will have less variation, and for a given degree of isolation, populations on smaller islands will have less variation than those on larger islands. Indeed, among the surveyed populations, only the Kerkennah population seems to achieve distinctive morphological characteristics. On islands closer to the mainland and smaller in size, in contrast, genetic equilibrium will attain sooner, without any signs of phenotypic changes (Kneiss Island).

As inferred from variation in [pi] value, genetic variability observed in the insular population was on average in the same level (ITS 1 marker) and sometimes higher (COI markers) than that in the mainland populations. Given that high genetic variability is associated with decreased vulnerability to extinction, the overall high genetic variability observed in the insular populations of this species implies their lower extinction risk. Ultimately, high genetic variability is deemed to favor species to adapt to changing environmental conditions and respond to selection (O'Connel & Wright 1997). Proximally, high phenotypic variability involving the fixation of adaptive characteristics is involved. Increase of the variation in spawning period caused by elevated genetic variability may also make populations more resistant to diseases and catastrophes.

Genetic Structure and Differentiation

The genetic heterogeneity analysis demonstrates a certain amount of genetic differentiation among local populations of Ruditapes decussatus, with a relatively high level of genetic subdivision. Microsatellite data presented here indicate a certain amount of molecular divergence among R. decussatus populations and are congruent with the results of the molecular investigations (analysis of mitochondrial DNA sequences). Allozyme data show that, at the scale of the study, genetic variation in R. decussatus is distributed into two major population groups according to their geographic origin on either side of the Siculo-Tunisian Strait: the first includes the related three westernmost localities (Mzjemil, Faroua, and Tunis), the second the remaining localities (eastern group). The hierarchical F-statistics analysis showed an among-groups [F.sub.ST]t estimate ([F.sub.ST] = 0.030; P < 0.001) higher than that at the total population level (Gharbi et al. 2011). The results of the allozyme investigations show a pronounced geographical structure of the R. decussatus populations (Table 4). On the other hand, the data suggest that Kerkennah sample is quite different morphologically and genetically from the other 10 populations. It is genetically differentiated and appears to differ more from the other 10 populations than these 10 differ among themselves. The UPGMA phenogram (Fig. 5) depicts this relationship more clearly (allozymes data). In the absence of obvious barriers to gene flow and the substantial migration rate from and to Kerkennah population, as estimated from F-statistics (Nm ranged from 2.6 to 8.7), this genetic differentiation could result from the occurrence of past biogeographical barriers; however, exchanges probably occurred between the island and mainland because of intermittent contacts due to variations in sea level during Pleistocene glaciations. According to Blanc and Cariou (1987), the Kerkennah archipelago has been cut off from the mainland for 13,000 y; geological data show that communications with the Sahelian littoral could have occurred at several times in the past, especially between 40,000 and 80,000 y ago.

In addition to historical events, ecological attributes such as colonization or dispersal abilities should play a role in establishing patterns of genetic differentiation and colonization events. Although, paleo-oceanographic data about colonization of the island are lacking, it seems likely that the Kerkennah population have established sufficiently long ago to accumulate such high genetic differentiation. The continued existence of this genetic discontinuity suggests it has yet to be erased by present-day gene flow or indicates that present-day gene flow was overestimated. Other plausible explanations for the differentiation of Kerkennah population such as selection against migrants cannot be excluded. Selection against migrant larvae may act as a primary barrier to gene flow by reducing the contribution of migrant genes to a population, and it may also have a secondary effect through the evolution of enhanced habitat choice behavior where local adaptation increases fitness of residents relative to migrants.

Moreover, several mechanisms, in fact, can be proposed to explain genetic differentiation of Kerkennah population. The retention of larvae around islands is essential to the maintenance of populations (Leis & Miller 1976). Unfortunately, concurrent physical data are unavailable from this study to test the retention mechanisms proposed by several scientists; however, we emphasize the possibly marine current, which runs along the Coast of Kerkennah Island and that presumably act to trap waters for significant periods of time. Such currents are important in retaining planktonic stages (larvae), increasing their chance to return to their adult coastal habitat, and thus helping to maintain the influx of larvae around the Kerkennah Island. It appears that larval dispersal localized to the island or location of spawning may well account for the genetic differentiation found for Kerkennah population of Ruditapes decussatus.

In summary, in this study a relatively high level of variability for analyzed markers' pattern was detected. High level of genetic variability in marine invertebrates populations is a well-known fact (Berger 1983), especially for bivalves (Jarne et al. 1988, Nikula & Vainola 2003, Katsares et al. 2008, Yuan et al. 2009). Human impacts on insular populations lead to reduction in population size that could easily collapse the genetic variability of a small population. Overexploitation, habitat loss, or the introduction of alien species often promotes fragmentation and reduction of wild populations (Reid & Miller 1989, Sheridan 1995). Attention should be paid not to disturb the original local adaptation in distant larger populations by introducing maladaptive characteristics of alien stocks. Conserving genetic diversity in mainland populations, which are the source of gene flow, is also important for the conservation of insular populations.

ACKNOWLEDGMENTS

We thank all people who contributed to Ruditapes decussatus sampling. We also thank the anonymous reviewer and editor for their constructive comments on the paper.

LITERATURE CITED

Belkhir, K., P. Borsa, L. Chikhi, N. Raufaste & F. Bonhomme. 2001. Genetix ver. 4.03, logiciel sous Windows la genetique des populations. Laboratoire Genome, Populations. Interactions CNRS UMR 5000. Universite de Montpellier II.

Benson, G. 1999. Tandem repeats finder: a program to analyze DNA Sequences. Nucleic Acids Res. 27:573-580.

Berger, E. M. 1983. Population genetics of marine gastropods and bivalves. In: Russell-Hunter. W. D., editor. The mollusca. Ecology, Volume 6. Orlando, London: Academic Press, pp. 563-596.

Blanc, E. & M. L. Cariou. 1987. Geographical variability of allozyme variation and genetic divergence between Tunisian lizards of the sand-dwelling lacertid genus Acanthodactylus. Genetica 72:13-25.

Borsa. P., P. Jarne, K. Belkhir & F. Bonhomme. 1994. Genetic structure of the palourde Ruditapes decussatus L. in the Mediterranean. In: Beaumont, A. R., editor. Genetics and evolution of aquatic organisms. London: Chapman and Hall. pp. 103-113.

Brunner, P. C., M. R. Douglas & L. Bernatchez. 1998. Microsatellite and mitochondrial DNA assessment of population structure and stocking effects in Arctic charr Salvelinus alpinus (Teleostei: Salmonidae) from central Alpine lakes. Moi. Ecol. 7:203-223.

Buroker, N. E. 1983. Population genetics of the American oyster Crassostrea virginica along the Atlantic coast and the Gulf of Mexico. Mar. Biol. 75:99-112.

Caill-Milly, N., N. Bru, K. Mahe, C. Borie & F. D'Amico. 2012. Shell shape analysis and spatial allometry patterns of Manila clam (Ruditapes philippinarum) in a mesotidal coastal lagoon. J. Mar. Biol., doi: 10.1155/2012/281206.

Cheylan, G., L. Granjon & J. Britton-Davidian. 1998. Distribution of genetic diversity within and between Western Mediterranean island populations of the black rat Rattus rattus (L. 1758). Biol. J. Linn. Soc. Lond. 63:393-408.

Excoffier, L., G. Laval & S. Schneider. 2005. ARLEQUIN version 3.0an integrated software package for population genetics data analysis. Evoi. Bioinform. Online 1:47-50.

Frankham, R. 1995. Conservation genetics. Annu. Rev. Genet. 29:305-327.

Frankham, R. 1997. Do island populations have less genetic variation than mainland populations? Heredity 78:311-327.

Futuyma, D. J. 1998. Evolutionary Biology, 3rd edition. Sunderland: Sinauer Associates.

Gallardo, M. H., L. Penaloza & E. Clasing. 1998. Gene flow and allozymic population structure in the clam Venus antiqua from Southern Chile. J. Exp. Mar. Biol. Ecol. 230:193-205.

Gerard, A. 1978. Recherches sur la variabilite de diverses populations de Ruditapes decussatus et Ruditapes philippinarum (Veneridae, Bivalvia) (Dissertation thesis), Universite de Bretagne Occidentale, Brest, France. 149 pp.

Gharbi, A., N. Chatti, K. Said & A. Van Wormhoudt. 2010. Genetic variation and population structure of the carpet shell clam Ruditapes decussatus (Linnaeus 1758) along the Tunisian coast inferred from mtDNA and ITS1 sequence analysis. Biologia 65:688-696.

Gharbi, A.. R. Z. Chatti, A. Van Wormhoudt, M. N. Dhraief, F. Denis, K. Said & N. Chatti. 2011. Genetic differentiation in the carpet shell clam Ruditapes decussatus (Linnaeus 1758) populations across the Siculo-Tunisian strait. Biocheiv. Genet. 49:788-805.

Gilpin, M. E. & M. E. Soule. 1986. Minimum viable populations: processes of species extinction. In: Soule, M. E., editor. Conservation biology. Sunderland: Sinauer Associates, pp. 19-34.

Hedrick. P. W. & M. E. Gilpin. 1997. Genetic effective size of a metapopulation. In: Hanski, I. & M. E. Gilpin, editors. Metapopulation biology. San Diego, CA: Academic Press, pp. 165-181.

HQ 179957-HQ179965: GenBank accession for Ruditapes decussatus haplotype (1-9) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence. Available at: http://www.ncbi.nlm.nih.gov/pubmed/?term = HQ 179957.

Jarne, P., P. Berrebi & O. Guelorget. 1988. Variabilite genetique et morphometrique de cinq populations de la palourde Ruditapes decussatus. Oceanol. Acta 1L :401-407.

Jones, M. W., D. Clay & R. G. Danzman. 1996. Conservation genetics of brook trout (Sahelinus fontinalis) population structuring in Fundy National Park, New Brunswick, and eastern Canada. Can. J. Fish. Aquat. Sci. 53:2776-2791.

Katsares, V., A. Tsiora, S. Galinou-Mitsoudi & A. Imsiridou. 2008. Genetic structure of the endangered species Pinna nobilis (Mollusca: Bivalvia) inferred from mtDNA sequences. Biologia 63:412-417.

KC 149953-KC149960: GenBank accession for Ruditapes decussatus haplotype (1-8) cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial. Available at: http://www.ncbi.nlm.nih.gov/pubmed/?term = KC 149953.

Leis, J. M. & J. M. Miller. 1976. Offshore distributional patterns of Hawaiian fish larvae. Mar. Biol. 36:359-367.

Lewontin, R. C. 1974. The genetic basis of evolutionary change. New York: Columbia University Press.

Lomolino, M. V. 1985. Body size of mammals on islands: the island rule reexamined. Am. Nat. 125:310-316.

Lomolino, M. V. 2005. Body size evolution in insular vertebrates: generality of the island rule. J. Biogeogr. 32:1683-1699.

Lucas, A. 1968. Mise en evidence de l'hermaphrodisme juvenile chez Venerupis decussata (L.) (Bivalvia: Veneridae). CR. Acad. Sci. D 367:2332-2333.

Luttikhuizen, P. C., J. Drent, W. Van Delden & T. Piersma. 2003. Spatially structured genetic variation in a broadcast spawning bivalve: quantitative vs. molecular traits. J. Evol. Biol. 16:260-272.

MacArthur, R. H. & E. O. Wilson. 1967. The theory of island biogeography. Princeton, NJ: Princeton University Press.

MacArthur, R. H. 1972. Geographical ecology. Princeton. NJ: Princeton University Press.

Meffe, G. K. 1996. Conserving genetic diversity in natural systems. In: Szaro, R. C. & D. W. Johnston, editors. Biodiversity in managed landscapes. Oxford: Oxford University Press, pp. 41-57.

Nei, M. 1972. Genetic distance between populations. Am. Nat. 106:283-291.

Nei, M., T. Maruyama & R. Chakraborty. 1975. The bottleneck effect and genetic variability in populations. Evolution 29:1-10.

Nikula, R. & R. Vainola. 2003. Phylogeography of Cerastoderma glaucum (Bivalvia: Cardiidae) across Europe: a major break in the Eastern Mediterranean. Mar. Biol. 143:339-350.

O'Connel, M. & J. M. Wright. 1997. Microsatellite DNA in fishes. Rev. Fish Biol. Fish. 7:331-363.

Otto, D. & J. E. Endler. 1989. Speciation and its consequence. Sunderland: Sinauer Associates.

Parache, A. 1982. La palourde. Peche Marit. 1254:496-507.

Paetkau, D., G. F. Shields & C. Strobeck. 1998. Gene flow between insular, coastal and interior populations of brown bears in Alaska. Mol. Ecol. 7:1283-1292.

Raymond, M. & F. Rousset. 2003. Updated version of GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J. Hered. 86:248-249.

Reid, W. V. & K. R. Miller. 1989. Keeping options alive: the scientific basis of conserving biodiversity. Washington, DC: World Resources Institute.

Slatkin, M. 1977. Gene flow and genetic drift in a species subject to frequent local extinction. Theor. Popul. Biol. 12:253-262.

Seed, R. 1980. Shell growth and form in the Bivalvia, In: Rhoads, D. C. & R. A. Lutz, editors. Skeletal growth of aquatic organisms. New York: Plenum Press, pp. 23-67.

Sheridan, A. K. 1995. The genetic impacts of human activities on wild fish populations. Rev. Fish. Sci. 3:91-108.

Sneath, P. H. A. & R. R. Sokal. 1973. Numerical taxonomy. San Francisco, CA: W. H. Freeman, Co.

Tanguy, A., N. Bierne, C. Saavedra, B. Pina, E. Bachere, M. Kube, E. Bazin, F. Bonhomme. P. Boudry, V. Boulo, I. Boutet, L. Cancela, C. Dossat, P. Favrel, A. Huvet, S. Jarque, D. Jollivet, S. Klages, S. Lapegue, R. Leite, J. Moal, D. Moraga, R. Reinhardt, J. F. Samain, E. Zouros & A. Canario. 2008. Increasing genomic information in bivalves through new EST collections in four species: development of new genetic markers for environmental studies and genome evolution. Gene 408:27-36.

Thorpe, J. P., A. M. Sole-Cava & P. C. Watts. 2000. Exploited marine invertebrates: genetics and fisheries. Hydrobiologia 420:165-184.

Tokeshi, M., N. Ota & T. Kawai. 2000. A comparative study of morphometry in shell-bearing molluscs. J. Zool. (Lond.) 251:31-38.

Utter, F. M. 1991. Biochemical genetics and fishery management: an historical perspective. J. Fish Biol. 39:1-20.

Wade. M. J. & D. E. McCauley. 1988. Extinction and recolonization: their effects on the genetic differentiation of local populations. Evolution 42:995-1005.

Weir, B. S. & C. C. Cockerham. 1984. Estimating F-statistics for the analysis of population structure. Evolution 38:1358-1370.

Yuan, T., M. He & L. Huang. 2009. Intraspecific genetic variation in mitochondrial 16S rRNA and COI genes in domestic and wild populations of Huaguizhikong scallop Chlamys nobilis Reeve. Aquaculture 289:19-25.

AICHA GHARBI, (1,2) * KHALED SAID 2 AND ALAIN VAN WORMHOUDT (1)

(1) Station de Biologie Marine du Museum National d'Histoire Naturelle, BP225, 29900 Concarneau, France; (2) Laboratoire: Genetique, Biodiversite et Valorisation des Bioressources, LR11ES41, Institut Superieur de Biotechnologie de Monastir, Tunisia

* Corresponding author. E-mail: aichamnhn@gmail.com

DOI: 10.2983/035.034.0308

TABLE 1.
Number of individuals (N) collected in each locality
and for each analysis.

                   Morphometry  Allozyme  COI  ITS1  Microsatellites
Population             (N)        (N)     (N)  (N)         (N)

Faroua (Bizerte        35          35     12    10         --
  Lagoon)
Mzjemil (Bizerte       30          31     10    15         30
  Lagoon)
Tunis                  30          30     11    17         30
Monastir               30          30     22    14         30
Sfax                   30          30     10    13         --
Kerkennah Island       30          30     15    11         30
Kneiss Island          35          35     12    9          --
Akarit                 30          30     10    20         --
Galala (Bougrara       30          30      9    14         --
  Lagoon)
Bougrara               30          35     11    10         24
  (Bougrara
  Lagoon)
Biben lagoon           30          30     18    17         30
Total                 340         346    140   150        174

TABLE 2.
Microsatellites loci identified from EST database.

Loci     Motif          Forward                  Reverse

dec-1     TG     CGCGGCCATACATTTAATCA     CGGCAATAAATCAAACCAGAA
dec-2    TGAG    ATGCATCCCTCACCTTTGAA    TCAGGCAAATCTTAAACATAATCG
dec-3     AG     TTGAACCCTGGACCTTAGGA     TTTATAGTGTCGATTCGCCGTA
dec-4     TC     CAGCGCATCTGATTCTGGTA     CATTCAGTGACGGTCTAATGG
dec-5     TCA    TGGGATTGCATTTGTTATTCG     GTTCGATTGTGACGCCATTA
dec-6     AAC    CGTTGGAGGAAGTGAATGTC      GCTACCACTAGCAAGGCACA
dec-7     CAT    AAAAGCGAGTGGGCCTTATT      CAATCGCAATGGACAATCAC

Loci      tm     Percent GC   PCR product size

dec-1    61-59     45-38           250 pb
dec-2    60-59     45-33           216 pb
dec-3     59       50-40           100 pb
dec-4    59-58     50-47           264 pb
dec-5    60-59     38-15           200 pb
dec-6     59       50-55           240 pb
dec-7     59       45-45           246 pb

TABLE 3.

Quantitative parameters of the genetic variability
for populations of Ruditapes decussatus sampled.

                             Allozymes
Sample
location        N     He      Ho     [P.sub.95]     A     [F.sub.is]

Mzjemil         31   0.290   0.240     53.330     2.600    0.210 *
  (Bizerte
  Lagoon)
Faroua          35   0.280   0.240     53.330     2.400    0.157 *
  (Bizerte
  Lagoon)
Tunis           30   0.280   0.250     53.330     2.600    0.168 *
Monastir        30   0.330   0.300     60.000     2.800    0.111 *
Sfax            30   0.340   0.350     60.000     2.800   -0.025
Kerkennah       30   0.370   0.360     60.000     2.800    0.112 *
  Island
Kneiss Island   35   0.310   0.280     60.000     2.730    0.141 *
Akarit          30   0.320   0.280     60.000     2.800    0.155 *
Galala          30   0.340   0.290     60.000     2.800    0.189 *
  (Bougrara
  Lagoon)
Bougrara        35   0.340   0.310     60.000     2.800    0.124 *
  (Bougrara
  Lagoon)
Biben           30   0.340   0.320     60.000     2.930    0.121 *
Mean            31   0.321   0.292     58.180     2.732    0.131 *

                              COI
Sample
location        N              h                      [pi]

Mzjemil         10   0.377 [+ or -] 0.181    0.0007 [+ or -] 0.0008
  (Bizerte
  Lagoon)
Faroua          12   0.1667 [+ or -] 0.137   0.0003 [+ or -] 0.0004
  (Bizerte
  Lagoon)
Tunis           11   0.318 [+ or -] 0.163    0.0006 [+ or -] 0.0007
Monastir        16   0.177 [+ or -] 0.106    0.0003 [+ or -] 0.0004
Sfax            10   0.644 [+ or -] 0.101    0.0013 [+ or -] 0.0011
Kerkennah       15   0.666 [+ or -] 0.100    0.0023 [+ or -] 0.0017
  Island
Kneiss Island   12   0.757 [+ or -] 0.122    0.0020 [+ or -] 0.0014
Akarit          10   0.377 [+ or -] 0.181    0.0007 [+ or -] 0.0008
Galala          9    0.583 [+ or -] 0.183    0.0011 [+ or -] 0.0011
  (Bougrara
  Lagoon)
Bougrara        11   0.618 [+ or -] 0.164    0.0015 [+ or -] 0.0013
  (Bougrara
  Lagoon)
Biben           18   0.405 [+ or -] 0.142    0.0008 [+ or -] 0.0008
Mean            12   0.486 [+ or -] 0.198    0.0011 [+ or -] 0.0009

                                         ITS1
Sample
location        N              h                      [pi]

Mzjemil         15   0.790 [+ or -] 0.051    0.0017 [+ or -] 0.0014
  (Bizerte
  Lagoon)
Faroua          10   0.866 [+ or -] 0.085    0.0025 [+ or -] 0.0019
  (Bizerte
  Lagoon)
Tunis           17   0.698 [+ or -] 0.075    0.0014 [+ or -] 0.0012
Monastir        14   0.802 [+ or -] 0.068    0.0020 [+ or -] 0.0015
Sfax            13   0.384 [+ or -] 0.132    0.0013 [+ or -] 0.0011
Kerkennah       11   0.563 [+ or -] 0.134    0.0016 [+ or -] 0.0013
  Island
Kneiss Island   9    0.805 [+ or -] 0.111    0.0024 [+ or -] 0.0018
Akarit          20   0.671 [+ or -] 0.091    0.0017 [+ or -] 0.0013
Galala          14   0.494 [+ or -] 0.087    0.0016 [+ or -] 0.0013
  (Bougrara
  Lagoon)
Bougrara        10   0.933 [+ or -] 0.077    0.0056 [+ or -] 0.0035
  (Bougrara
  Lagoon)
Biben           17   0.661 [+ or -] 0.125    0.0024 [+ or -] 0.0017
Mean            14   0.700 [+ or -] 0.177    0.0021 [+ or -] 0.0018

N, sample size; He. expected heterozygosity; Ho, observed
heterozygosity; [P.sub.95], proportion of polymorphic loci
at the 95% criterion; A. mean number of alleles per locus:
Fis. multilocus estimates of the fixation index; h,
haplotype diversity; [pi], nucleotide diversity.

* P < 0.05.

TABLE 4.
Pairwise comparison of 11 carpet shell clam populations
(allozyme data).

Population    Mzjemil   Faroua     Tunis    Monastir

Mzjemil         --       0.013    0.010      0.025
Faroua        0.011      --       0.007      0.015
Tunis         0.004    -0.002      --        0.022
Monastir      0.034#@   0.016@    0.028#@      --
Sfax          0.039#@   0.037#@   0.043#@    0.006
Kerkenna      0.087#@   0.094#@   0.092#@    0.042#@
Kneiss        0.026#@   0.011@    0.010      0.001
Akarit        0.038#@   0.036#@   0.015@     0.012
Galala        0.028#@   0.025#@   0.027#@   -0.006
Bougrara      0.045#@   0.026#@   0.032#@   -0.001
Biben         0.043#@   0.029#@   0.028@    -0.005

Population    Sfax    Kerkennah    kneiss   Akarit

Mzjemil       0.028    0.060       0.020    0.027
Faroua        0.025    0.061       0.012    0.024
Tunis         0.029    0.060       0.012    0.015
Monastir      0.012    0.035       0.009    0.016
Sfax           --      0.020       0.011    0.023
Kerkenna      0.012      --        0.039    0.049
Kneiss        0.006    0.041#@      --      0.012
Akarit        0.025@   0.059#@     0.007      --
Galala        0.001    0.028@     -0.002    0.012
Bougrara      0.010    0.037#@     0.003    0.010
Biben         0.002    0.028@      0.001    0.005

Population    Galala   Bougrara   Biber

Mzjemil       0.023     0.031     0.032
Faroua        0.022     0.020     0.021
Tunis         0.022     0.024     0.022
Monastir      0.010     0.011     0.007
Sfax          0.010     0.015     0.011
Kerkenna      0.029     0.035     0.025
Kneiss        0.011     0.012     0.009
Akarit        0.016     0.015     0.012
Galala          --      0.009     0.008
Bougrara     -0.003      --       0.009
Biben        -0.006    -0.001      --

Above the diagonal Nei's (1972) unbiased genetic distances;
below the diagonal pairwise [F.sub.ST] (Weir & Cokerham 1984)
estimates. Significant values before (italic) and after
(bold) sequential Bonferroni adjustment are indicated for
[F.sub.ST] values.

Note: bold indicated with #.

Note: italic indicated with @.

Note: Significant values before (italic) and after
(bold) indicated with #@.

TABLE 5.
Pairwise FST values between populations of Ruditapes
decussatus based on COI sequences (below diagonal)
and on ITS1 sequences (above diagonal).

             Mzjemil   Faroua     Tunis    Monastir

Mzjemil        --      -0.0257   -0.004    -0.0517
Faroua       -0.0463      --      0.0342    0.0195
Tunis        -0.0426   -0.0578     --       0.0357
Monastir      0.0540   -0.0201    0.0255       --
Sfax          0.2381    0.2687#   0.1840    0.2896#
Kerkennah     0.1368#   0.1678#   0.1048    0.2386#
Kneiss        0.1171    0.1468#   0.0779    0.1791#
Akarit       -0.0493   -0.0482   -0.0696    0.0304
Galala        0.0274    0.0551   -0.0057    0.0901
Bougrara      0.0365    0.0638    0.0058    0.0855
Biben        -0.0376   -0.0103   -0.0316    0.0285

              Sfax     Kerkennah   Kneiss    Akarit

Mzjemil      0.2086#    0.1143#   -0.0256    0.0858#
Faroua       0.1194     0.0063    -0.0753    0.0247
Tunis        0.1422#    0.2465#   -0.0146    0.0411
Monastir     0.3037#    0.1790#    0.0354    0.1579#
Sfax           --       0.2679#    0.337     0.0282
Kerkennah    0.1052       --       0.0631    0.1764#
Kneiss      -0.0271     0.0301       --     -0.0239
Akarit       0.0873     0.0768     0.0205      --
Galala       0.0628     0.0267    -0.0093   -0.0278
Bougrara     0.0221    -0.0104    -0.0441   -0.0355
Biben        0.1159     0.0973     0.0549   -0.0519

             Galala    Bougrara    Biben

Mzjemil      0.1702#    0.0598     0.12365#
Faroua       0.0371    -0.0227     0.0371
Tunis        0.2782#    0.1535#    0.2719#
Monastir     0.2435#    0.0852     0.1565#
Sfax         0.2367     0.2453#    0.3506#
Kerkennah   -0.0711     0.0453    -0.0253
Kneiss       0.0821     0.0209     0.1238#
Akarit       0.1799#    0.1277#    0.2376#
Galala         --       0.0868     0.0355
Bougrara    -0.0439      --        0.0329
Biben       -0.0248    -0.0163       --

Significant values are indicated in bold estimates
(5% level).

Note: bold indicated with #.

TABLE 6.
Quantitative parameters for microsatellites data of the
genetic variability for populations of Ruditapes decussatus
sampled.

                         Populations

              Mzjemil     Tunis      Monastir
              (n = 30)   (n = 30)    (n = 30)

Fis           0.4271 *   0.2571 *    0.2834 *
He             0.5817     0.6193      0.6202
Ho             0.3333     0.4511      0.4444
[P.sub.95]     1.0000     1.0000      1.0000
A              5.3333     5.6667      6.0000

                         Populations

              Kerkennah   Bougrara    Biben
              (n = 30)    (n = 24)   (n = 30)

Fis           0.2445 *    0.4677 *   0.2842 *
He             0.6611      0.6001     0.6054
Ho             0.5011      0.3194     0.4333
[P.sub.95]     1.0000      1.0000     1.0000
A              6.0000      5.0000     5.3333

Multilocus estimates of the [F.sub.ST]
within each population are also indicated.

* P < 0.05.

TABLE 7.

Pairwise [F.sub.ST] (Weir & Cokerham 1984) estimates of carpet
shell clam populations for microsatellites data.

Mzjemil       Tunis    Monastir   Kerkennah   Bougrara    Biben

Mzjemil      0.01603   0.01829    0.03418@    0.03947@   0.01403
Tunis          --      0.00859    0.05241#@   0.04577@   0.03209@
Monastir                  --      0.05433#@   0.03748@   0.02427
Kerkennah                            --       0.03567@   0.01895
Bougrara                                         --      0.00276
Biben                                                       --

Significant values before (italic) and after (bold)
sequential Bonferroni adjustment are indicated.

Note: italic indicated with @.

Note: Significant values before (italic) and after (bold)
indicated with #@.

Figure 5. Phenogram generated by UPGMA cluster analysis based
on Nei's (1972) unbiased genetic distances (allozyme data)
among Ruditapes decussatus populations.

loci     Motif          Forward                  Reverse

dec-1     TG     CGCGGCCATACATTTAATCA    CGGCAATAAATCAAACCAGAA
dec-2    TGAG    ATGCATCCCTCACCTTTGAA    TCAGGCAAATCTTAAACATAATCG
dee-3     AG     TTGAACCCTGGACCTTAGGA    TTTATAGTGTCGATTCGCCGTA
dec-4     TC     CAGCGCATCTGATTCTGGTA    CATTCAGTGACGGTCTAATGG
dec-5     TCA    TGGGATTGCATTTGTTATTCG   GTTCGATTGTGACGCCATTA
dec-6     AAC    CGTTGGAGGAAGTGAATGTC    GCTACCACTAGCAAGGCACA
dec-7     CAT    AAAAGCGAGTGGGCCTTATT    CAATCGCAATGGACAATCAC

loci      tm     % GC    PGR product size

dec-1    61-59   45-38        250 pb
dec-2    60-59   45-33        216 pb
dee-3     59     50-40        100 pb
dec-4    59-58   50-47        264 pb
dec-5    60-59   38-45        200 pb
dec-6     59     50-55        240 pb
dec-7     59     45-45        246 pb
COPYRIGHT 2015 National Shellfisheries Association, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Gharbi, Aicha; Said, Khaled; Van Wormhoudt, Alain
Publication:Journal of Shellfish Research
Article Type:Report
Date:Dec 1, 2015
Words:7689
Previous Article:Influence of grain size on burrowing and alongshore distribution of the yellow clam (Amarilladesma Mactroides).
Next Article:Distribution and migration of immature germ cells in the pearl oyster Pinctada fucata with the expression pattern of the vasa ortholog by in situ...
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |