Printer Friendly

Identification of two LDL-receptor mutations causing familial hypercholesterolemia in Indian subjects by a simplified rapid PCR-heteroduplex method.

The molecular analysis of familial hypercholesterolemia (FH), an autosomal dominant disease caused by a multitude of LDL receptor (LDLR) gene mutations, is complicated by mutational heterogeneity of the disease in the majority of population studied to date (1). Exceptions occur where the frequencies of specific mutations are increased in a population because of founder effects, or where a mutation has been introduced on many occasions into a small isolated community (2-4). The prevalence of FH in India is not known. In addition, to the best of our knowledge there are no published reports on systematic analyses of mutations underlying FH in India. However, to date 10 different LDLR mutations in immigrants from India have been reported in the literature (5). Most of these mutations have been reported in exons 3, 4, 9, and 14 among Indians settled in South Africa, which suggests an increased frequency of FH in India (5). More than 80% of the 150 000 Indians who immigrated to South Africa between 1860 and 1911 originated from diverse areas in India (6). This group has remained isolated as a whole and also within different communities, primarily as a result of religious and cultural practices. This probably indicates that the increased incidence of mutations is attributable to multiple entries of defective LDLR genes into the Indian population of South Africa from India and that the group in South Africa probably represents the incidence in the Indian subcontinent.

The current study was thus undertaken to identify four previously reported LDLR gene point mutations in Indian hypercholesterolemic patients with clinical features of FH. The subjects were screened for mutations W66G (7), E207K (7), E387K (8), and P664L (9) in exons 3, 4, 9, and 14, respectively, which are those most reported among Indians in South Africa. In an attempt to identify other mutations causing FH among Indian subgroups in the same exons by heteroduplex (HDX) analysis, we further modified the technique and applied this approach for rapid detection of mutations in the LDLR gene.

Genomic DNA was extracted from blood samples of an apparently healthy control group and hypercholesterolemic patients with clinical features of FH (10) to detect mutations in exons 3, 4, 9, and 14 of the LDLR gene, using a salting out method (11). The exons were PCR amplified (12) using specific oligonucleotide primers (Table 1) and conditions as described elsewhere (7-9). The known point mutations were detected by restriction enzyme digestion of the amplified DNA as described previously (7-9). HDX analysis was performed with slight modification (13) of the known techniques (14,15). The amplified products (5 [micro]L) from both controls and patients were mixed and subjected to denaturation and renaturation cycles. Denaturation and renaturation were performed in a programmed PCR thermal cycler (model 480; Perkin-E1mer) at 95 [degrees]C for 8 min, followed by 1 min each at 90, 80, and 70 [degrees]C, and so forth until room temperature (20 [degrees]C) was reached. The renatured samples were diluted with equal volumes of gel loading buffer (950 mL/L formamide, 20 mmol/L EDTA, 0.5 g/L xylene cyanol, and 0.5 g/L bromphenol blue) and electrophoresed through low cross-linking 10% denaturing polyacrylamide gels (160 X 180 X 1 mm) supplemented with 75 g/L urea. The low cross-linking (1% cross-linked) 10% polyacrylamide gel was made from 40% acrylamide solution containing 40% acrylamide and 0.4% N,N'-methylenebisacrylamide. Electrophoresis was performed with 1 X Tris-borate-EDTA buffer at 200 V and 23 mA for 3-5 h at room temperature, stained with 0.5 mg/L ethidium bromide in 0.6X Trisborate-EDTA buffer for 30 min, and visualized under ultraviolet light.

DNA samples from 25 hypercholesterolemic patients and equal numbers of healthy controls were screened for mutations in exons 3, 4, 9, and 14 of the LDLR gene. The previously reported point mutations were absent in the samples analyzed. Using HDX analysis, we detected two patients showing an abnormal HDX pattern, one each in exon 3 and exon 4, indicating sequence variation (Fig. 1A). Sequencing reactions revealed the presence of single nucleotide "G" insertions at position 242 in exon 3 (Fig. 1B) and position 397 in exon 4 (Fig. 1C) compared with the LDLR cDNA sequence (16). Both the 242insG and 397insG mutations are predicted to cause translational frameshift, encoding unstable truncated LDLR proteins because of premature termination codons created downstream of the mutations. The mutant proteins are likely to be degraded intracellularly and are therefore pathogenic. A study by Kotze et al. (5) has indicated that CpG dinucleotides may be mutational hotspots among Asian Indians settled in South Africa. However, our study indicates mutational heterogeneity among Indian subgroups, which is not surprising considering the different ethnic groups present in the heterogeneous Indian population.

[FIGURE 1 OMITTED]

In addition to the two previously unpublished insertion mutations that we detected, the usefulness of this technique to detect minor changes was tested using mutation-positive control samples for exon 3 (R57C), exon 4 (E207K and D200Y), exon 9 (E387K), and exon 14 (P664L) of the LDLR gene [kindly provided by Dr. M.J. Kotze (Department of Human Genetics, Faculty of Medicine, University of Stellenbosch, Tygerberg, South Africa), Dr. A Soutar (MRC Lipoprotein Team, Clinical Science Centre, Royal Postgraduate Medical School, Hammersmith Hospital, London, United Kingdom), and Dr. A Minnich (Clinical Research Institute of Montreal, Montreal, Quebec, Canada)]. It remains to be seen whether all possible base pair changes could be detected by the method described, but of the five known point mutations that we have tested (relatively large PCR fragments), four (fragments up to 496-bp) were easily detectable using this technique, whereas one (550-bp fragment in exon 9) was not.

The use of low cross-linked polyacrylamide gels supplemented with urea (9,17) previously has been demonstrated to be highly sensitive in detecting single-base substitutions as HDXs. Furthermore, we also observed that the mixing of control and mutant DNA samples and an extra denaturing/renaturing step increases the chances of HDX formation between the nonhomologous DNA strands during cross-annealing, making them more apparent and easily visualized with reduced electrophoresis time. The mixing of control and mutant DNA can also facilitate formation of HDXs in homozygous mutant alleles where HDXs do not arise during amplification cycles.

In conclusion, this simplified nonradioactive PCR-HDX analysis gives reliable results with simple procedures within a short time. The method requires only small amounts of PCR-amplified DNA, is easy to handle because radioactivity is not involved, and readily resolves differences between mutant and control DNA. Accordingly, we expect that it could be the preferred initial method of screening and could complement other techniques for detecting minor gene mutations.

References

(1.) Goldstein JL, Hobbs HH, Brown MS. Familial hypercholesterolemia. In: Scriver CR, Beaudet AL, Sly WS, Valle B, eds. The metabolic bases of inherited diseases, 7th ed. New York: McGraw-Hill, 1995:2:1980-2037.

(2.) LeitersdorF E, Tobin EJ, Davignon J, Hobbs HH. Common low-density lipoprotein receptor mutations in the French Canadian population. J Clin Investig 1990;85:1014-23.

(3.) LeitersdorF E, van der Westhuyzen DR, Coetzee GA, Hobbs HH. Two common low-density lipoprotein receptor gene mutations cause familial hypercholesterolemia in Afrikaners. J Clin Investig 1989;84:954-61.

(4.) Lehrman MA, Schneider WJ, Brown MS, Davis CG, Elhanmer A, Russell DW, Goldstein JL. The Lebanese allele at the low-density lipoprotein receptor locus. J Biol Chem 1987;262:401-10.

(5.) Kotze MJ, Loubser 0, Thiart R, Nico J, de Villiers P, Langenhoven E, et al. CpG hotspot mutations at the LDL receptor locus is a frequent cause of familial hypercholesterolemia among South African Indians. Clin Genet 1997;51:394-8.

(6.) Bhana S, Brain J. Setting down roots: Indian migrants in South Africa. Johannesburg, South Africa: Witwatersrand University Press, 1990:15-43.

(7.) Minnich A, Roy M, Chamberland A, Lavigne J, Davignon J. New methods for rapid detection of low density lipoprotein receptor and apolipoprotein B gene mutation causing familial hypercholesterolemia. Clin Biochem 1995;28: 277-84.

(8.) Webb TC, Sun X-M, McCarthy SN, Neuwirth C, Thompson GR, Knight BL, SOUtaYAK. Characterization of mutations in the low-density lipoprotein (LDL) receptor gene in patients with homorygous familial hypercholesterolemia, and frequency of these mutations in FH patients in the United Kingdom. J Lipid Res 1996;37:368-81.

(9.) Rubinsztein DC, Coetzee GA, Marias AD, Leitersdorf E, Seftel HC, van der Westhuyzen DR. Identification and properties of the proline 664-leucine mutant LDL receptor in South Africans of Indian origin. J Lipid Res 1992; 33:1647-55.

(10.) Durrington PN. Familial hypercholesterolemia In: Durrington PN, ed. Hyperlipidaemia: diagnosis and management. London: Buttenvorth & Co, 1989: 91-113.

(11.) Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from nucleated cells. Nucleic Acids Res 1988;16:1215.

(12.) Mullis KB, Faloona FA. Specific synthesis of DNA in-vitro via polymerase catalyzed chain reaction. Methods Enzymol 1987;155:335-50.

(13.) Ashavaid TF, Altaf AK, Nair KG, Rao R. Simplified heteroduplex analysis: a rapid method of detecting single-base substitutions in the low-density lipoprotein receptor gene analysis [Abstract]. Clin Chem 1997;43:2218.

(14.) Peeters AV, Kotze MJ. Improved heteroduplex detection of single-base substitution in PCR-amplified DNA. PCR Methods Appl 1994;4:352-6.

(15.) Xing Y, Wells RL, Elkind MM. Non-radioactive PCR heteroduplex analysis: a rapid, reliable method of detecting minor gene mutations. Biotechniques 1996;21:186-7.

(16.) Yamamoto T, Davis CG, Brown MS, Schneider WJ, Casey ML, Goldstein JL, Russell DW. The human LDL receptor: a cysteine-rich protein with multiple Alu sequences in its mRNA. Cell 1984;39:27-38.

(17.) Kotze MJ, Theart L, Callis M, Peeters AV, Thiart R, Langenhoven E. Non-radioactive multiplex PCR screening strategy for the simultaneous detection of multiple low-density lipoprotein receptor gene mutations. PCR Methods Appl 1995;4:352-6.

Tester F. Ashavaid, [1] * Altaf A. Kondkar, [1] and Kappiareth G. Nair [2] ([1] Research Laboratory, P. D. Hinduja National Hospital & Medical Research Center, Mumbai 400 016, India; [2] Breach Candy Hospital & Research Center, Mumbai 400 026, India; * author for correspondence: fax 91-22-4449151, e-mail dr_tashavaid@hindujahospital.com)
Table 1. Primers for PCR amplification.

Region Primer sequence (5' [right arrow] 33') Size, bp

EXOn 3 TGACAGTTCCAATCCTGTCTCTTCTG (a) 162
 ATAGCAAAGGCAGGGCCACACTTAC (b)
EXOn 4 CCCCAAGACTGTCTCCCAGGACGA (a) 431
 ACGCCCCGCCCCCACCCTGCCCCGC (b)
ExOn 9 CTGACCTCGCTCCCCGGACC (a) 550
 GCCCTCAGCGTCGTGATCG (b)
EXOn 14 AATGTCGACGTCATCTTCCTTGCTGCCTGT (a) 496
 TATGTCCAGAAACAAGGCGTGTGCCAC (b)

(a) Sense.

(b) Antisense.
COPYRIGHT 2000 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2000 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Technical Briefs
Author:Ashavaid, Tester F.; Kondkar, Altaf A.; Nair, Kappiareth G.
Publication:Clinical Chemistry
Date:Aug 1, 2000
Words:1702
Previous Article:Validation of an assay for routine monitoring of sirolimus using HPLC with mass spectrometric detection.
Next Article:Does iron concentration in a liver needle biopsy accurately reflect hepatic iron burden in [beta]-thalassemia?
Topics:


Related Articles
Lipid disorders and mutations in the APOB gene.
Flow cytometric assessment of LDL ligand function for detection of heterozygous familial defective apolipoprotein B-100.
Mutations in the apolipoprotein (apo) B-100 receptor-binding region: detection of apo B-100 ([Arg.sup.3500] [right arrow] Trp) associated with two...
Compound heterozygous familial hypercholesterolemia and familial defective apolipoprotein B-100 produce exaggerated hypercholesterolemia.
Reliable low-density DNA array based on allele-specific probes for detection of 118 mutations causing familial hypercholesterolemia.
Single-strand conformation polymorphism analysis with high throughput modifications, and its use in mutation detection in familial...
Identification and haplotype analysis of apolipoprotein B-100 [Arg.sub.3500] [right arrow] Trp mutation in hyperlipidemic Chinese.
Long-distance PCR-based screening for large rearrangements of the LDL receptor gene in Korean patients with familial hypercholesterolemia.
Flow cytometry with a monoclonal antibody to the low density lipoprotein receptor compared with gene mutation detection in diagnosis of heterozygous...
Denaturing gradient-gel electrophoresis screening of familial defective apolipoprotein B-100 in a mixed Asian cohort: two cases of...

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters