Identification of single nucleotide polymorphisms (SNPs) of the bovine growth hormone (bGH) gene associated with growth and carcass traits in Hanwoo.
INTRODUCTIONThe bovine growth hormone (bGH) gene is located in q22 of bovine chromosome 19 and includes five exons with 217 amino acids (Santome et al., 1971; Wallis, 1973; Miller et al., 1980). The gene was sequenced by Gordon et al. (1983) and Hediger et al. (1990). Its product, growth hormone, is secreted in somatotropic or acidophilic cells of the anterior pituitary gland of mammals. The hormone regulates expression of many genes including one encoding insulin-like growth factor I (IGF-I), and influences growth rate, body composition, health, and milk production (Woychik et al., 1982; Gordon et al., 1983; Sumantran et al., 1992; Ho and Hoffman, 1993; Lincoln et al., 1995; Ge et al., 2013). In general, GH binds to a GH receptor and forms a dimer. Janus kinase and mitogen-activated protein kinase are involved in GH activity (Herrington et al., 2000). Recently, studies of the bGH gene have focused on single nucleotide polymorphisms (SNPs) within the gene and how the polymorphisms influence production traits such as milk production, growth, or carcass traits in cattle.
Roth et al. (1990) found a SNP in the bGH promoter region, '253' SNP near the binding site of polyoma virus enhancer A binding protein 3 (PEA3) transcription factor. Theill and Karin (1993) identified '303' SNP in the first nucleotide of biding site of another transcription factor, thyroid hormone response element (TRE). The 303 SNP was confirmed in eight cattle breeds (Hecht and Geldermann, 1996). Ge et al. (2013) analyzed effects of the bGH SNPs on growth traits and concentrations of IGF-I in Angus, but did not find significant evidence that the SNPs were associated with the traits. However, Kim et al. (2004) reported a bGH SNP, '-120' SNP in promoter region of the gene, which was associated with 3-month weight and carcass weight in Hanwoo.
There are also many reports that bGH SNPs, especially ones in exon 5, influenced milk production in Holstein and economically important traits in beef cattle (Eppard et al., 1992; Zhang et al., 1992, 1993; Lee et al., 1993; Lucy et al., 1993; Schlee et al., 1994; Yao et al., 1996). The 2141 C > G SNP encoding the 127th amino acid of bGH involves a change from leucine (CTG) to valine (GTG) (Zhang et al., 1992, 1993; Lucy et al., 1993). For the SNP, Eppard et al. (1992) found that the GTG increased milk yields in Holstein. However, Lee et al. (1993) and Lucy et al. (1993) reported that the mutation to valine decreased milk yield in cattle. Schlee et al. (1994) demonstrated that German black and white bulls with homozygous leucine had higher plasma levels than the ones with heterozygous leucine. Yao et al. (1996) reported that the 2291 A > C bGH SNP was significantly associated with milk yield, fat, and protein content in Holstein cattle. Recently, Ardiyanti et al. (2012) reported association of bGH to fatty acid components in Japanese black cattle.
Yoon et al. (2003) found a 2258 C > T SNP of bGH in Hanwoo, causing replacement of arginine (CGG) with tryptophan (TGG). Chikuni et al. (1994) also reported a 2277 C > T SNP in bGH in Japanese cattle.
The objective of this study was to find any association of bGH SNPs with growth and carcass traits in Hanwoo.
MATERIALS AND METHODS
Animals and phenotype data
A sample of 242 Hanwoo steers from 25 sires was collected from the Korea Animal Improvement Association. All the steers were under the progeny-testing program to select Hanwoo proven sires in the National Livestock Research Institute (NLRI), Korea. The steers were raised under tightly controlled conditions of the feeding program in the Daekwanryeong and Namwon branches of NLRI. The animals were born between the spring of 1998 and the fall of 2002, castrated at 6 months of age, and raised in groups of four animals per pen (4 mx8 m). After 6 months of age, the steers were fed concentrates consisting of 15% crude protein (CP)/71% totally digestible nutrients (TDN) for a period of 60 to 90 d, 15% CP/71% TDN for a period of 180 d, and 13% CP/72% TDN for a period of 90 to 120 d. The steers had access to roughage and fresh water ad libitum throughout the entire period. All steers were slaughtered approximately at 24 months of age. Live weight of each steer was measured before slaughter using electronic scales. Following a 24-h chilling, cold carcass weight was also measured.
Growth traits included weights of six-month (WT6), 12-month (WT12), 18-month (WT18), and 24-month (WT24) of age. Average daily gain (ADG) was also measured. Carcass quality traits included carcass weight (CWT), backfat thickness (BF), longissimus dorsi (eye) muscle area (EMA), and marbling scores (MS). According to the protocols of Korean Animal Product Grade System of Korean Institute for Animal Products Quality Evaluation, BF (mm) was measured at the 2/3 point of backfat that was located toward abdomen along the right side of the eye muscle cross-section. EMA ([cm.sup.2]) was measured in the eye muscle cross-section. MS was scored on a scale of 1 thorough 9 (1 = trace, 9 = very abundant) according to the Korean Beef Marbling Standard.
Sequence analysis of bGH gene
Genomic DNA was extracted from white blood cells of 21 unrelated Hanwoo individuals using the phenolchloroform method (Sambrook et al., 2001). We sequenced 47 bp to 2,528 bp of the bGH gene (GenBank accession number, M57764) and the flanking regions to evaluate SNP variants using the BigDye Terminator (ver. 3.1) cycle sequencing kit (Applied Biosystems, Foster City, CA) with an ABI 3730XL DNA analyzer (Applied Biosystems). Six primer sets for amplification and sequencing analysis were designed based on the GenBank sequence using Primer3 software. Primer sequences are shown in Table 1. Sequence editing was performed by visual confirmation using Sequencher 4.6 software (Gene Codes Corp., Ann Arbor, MI).
Genotyping by single-base extension (SBE)
A primer set (GH-P1-F and GH1-P1-R) was designed to generate a 639-bp product that included four SNPs in the bGH gene promoter. Another primer set (GH-E1-F and GHE1-R) was designed to generate a 328-bp product that included 679-bp SNP in the exon 1 region. A third primer set (GH-E2-F and GH-E2-R) was designed to produce a 536-bp amplicon that included 1,692-bp SNP in intron 3, while a primer set (GH-E3-F and GH-E3-R) was designed to obtain a 428-bp product that included four SNPs in exon 4 (Table 1). Primer extension was performed using a SNaPshot ddNTP Primer Extension Kit (Applied Biosystems, Foster City, CA). To purify the primer extension products, exonuclease 1 and shrimp alkaline phosphatase were added to the reaction mixtures. The samples were incubated at 37[degrees]C for 1 h and the reactions were stopped by incubating at 72[degrees]C for 15 min. The products were mixed with a Genescan 120 LIZ standard and HiDi formamide (Applied Biosystems) before being denatured at 95[degrees]C for 5 min. Electrophoresis was performed using an ABI PRISM 3130XL Genetic Analyzer and the results were analyzed using GeneMapper v.4.0 software (Applied Biosystems).
Statistical analysis
Heterozygosity, minor allele frequency (MAF), and Hardy-Weinberg equilibrium (HWE) were assessed using Haploviewer v4.2 (Barret et al., 2005). HWE was tested by comparing the expected and observed genotype frequencies using a chi-square test. Associations of growth and carcass traits for each SNP were analyzed with a mixed analysis of covariance (ANCOVA) linear model using SAS v9.1 (SAS Institute, Cary, NC). For growth traits, two fixed effect were fitted, year-season-birth place and SNP genotype. For carcass quality traits, an additional effect was included in the model, a covariate for age in days at the time of slaughter.
RESULTS AND DISCUSSION
The DNA segment of 2,482 bps that was located at 47 to 2,528 bp of bGH gene was sequenced, and a total of 10 SNPs were identified (Figure 1 and Table 2). Among the ten SNPs, four SNPs were located in the promoter region, i.e. 253 C > T, 303 C > T, 502 C > T, and 559 G > A. Results of association tests between the four SNPs and growth and carcass traits showed that 303 C > T and 559 G > A SNPs had significantly affected WT6 and eye muscle area (EMA), respectively at p = 0.05 level (Tables 3 and 4). The significant SNPs in the bGH gene promoter region may have limited efficiency as molecular markers, partly because the SNPs are located in the SINE/BovA2 repeat element, in which repetitive mutations occur frequently (Vaccarelli et al., 2008), suggesting that the SNPs does not strongly influence gene expression. Alternatively, the SNPs may affect growth and carcass traits due to great linkage disequilibrium with the causal variants that were closely located to the bGH SNPs (Ge et al., 2013). Kim et al. (2004) reported that a SNP at a promoter position -120 spanning a DraI restriction site was associated with 3-month weight and carcass weight in a Hanwoo population. However, our study did not confirm the SNP, partly because the SNP in Kim et al. (2004) was not detected with strong statistical evidence, i.e. comparison-wise p values were 0.025 and 0.041 for 3-month weight and carcass weight, respectively, which may be not confirmed in another random Hanwoo sample. Also, Kim et al. (2004) analyzed the association tests with estimated breeding values of the growth and carcass quality traits, while raw phenotypes were used in this study.
In this study, 679 C > T SNP was found in exon 1, 1692 T > C SNP in intron 3, and four SNPs (2141 C > G, 2258 C > T, 2277 C > T, and 2291 A > C) in exon 5 of the bGH gene. Among the SNPs in the CDS region, the 2141 C > G, the 2258 C > T, and the 2277 C > T SNPs were non-synonymous causing amino acid substitution, while the 2291 A > C SNP was a silent mutation. Among the SNPs in exon 1 and intron 3, 679 C > T and 1692 T > C did not significantly influence any growth or carcass trait (Tables 3 and 4). These results are in accordance with the report of Yao et al. (1996), in which there was no significant association of the SNPs with milk yield, fat and protein content in Holstein bulls.
The 2141 C > G SNP was non-synonymous and induced a mutation from leucine (CTG) to valine (GTG), which significantly affected ADG at p = 0.05 level (Table 3), even if HWE for the SNP was significantly deviated from expectation (Table 2). The 2258 C > T SNP was non synonymous, causing mutation of arginine to tryptophan in the process of transition from C to T. The SNP significantly affected ADG and CWT at p = 0.05 level (Tables 3 and 4). The genotype effect of the 2258 SNP on ADG was 0.74 [+ or -] 0.01 for CC and 0.71 [+ or -] 0.01 for CT, respectively (Table 3). For CWT, the estimates of CC and CT genotypes were 310.4 [+ or -] 2.4 and 298.5 [+ or -] 4.9, respectively (Table 4). For the SNP, Yoon et al. (2003) reported that MAF, Msp I (-), was low (0.00 to 0.054) in European Bos taurus species (Hereford, Angus, Charolais, Holstein, brown Swiss, Limousine, and Simmental), 0.043 to 0.229 in Asian Bos taurus breeds, except for Japanese black cattle (0.00), and 0.162 in Hanwoo. The MAF (C allele) of the 2258 SNP was 0.084 in this study (Table 4), which was lower than the frequency of the SNP in Yoon et al. (2003). This may be partly due to sampling effect, i.e. a small sample size (N = 242) in this study. For the 2258 C > T SNP, the high allele frequency of the favorable allele (C) in both European and Asian Bos taurus breeds indicate that selection for genetic improvement of ADG and CWT has been processed for the SNP or near the chromosomal region of the SNP.
There are some limitations in this association study. First of all, the sample size was small (N = 242), such that some significant SNPs for growth and carcass quality traits may not have been detected. Second, there may have been a chance of a false positive SNP, i.e. spurious SNPs with significant evidence that have no true effects on the tested traits. Some significant SNPs, e.g. the 303 C > T SNP for WT6 or the 2258 C > T SNP for CWT (Tables 3 and 4), had MAF less than 0.05, for which efficiency of marker-assisted selection would not be high.
Our results indicate that four SNPs in the bGH gene were associated with growth and carcass quality traits in Hanwoo (Tables 3 and 4). However, further study is needed to validate effects of the significant SNPs, before considering implementation of marker-assisted selection in Hanwoo commercial populations.
http://dx.doi.org/ 10.5713/ajas.2013.13248
ACKNOWLEDGEMENTS
This research was supported by a grant titled as "Development of production technologies for high quality & nutrional values of beef in Hanwoo from the Technology Development Program for Agriculture and Forestry (Project No. 311016-3), Ministry of Agriculture, Forestry, and Fisheries, Republic of Korea. Jong-Joo Kim's work was also supported by the Yeungnam University Research Grant 2012.
REFERENCES
Ardiyanti, A., T. Abe, N. Tameoka, E. Kobayashi, N. Shoji, Y. Ohtani, K. Suzuki, S. Roh, and K. Katoh. 2012. Effects of growth hormone gene polymorphism on lipogenic gene expression levels in diaphragm tissues of Japanese black heifers. Asian-Aust. J. Anim. Sci. 25:1055-1062.
Chikuni, K., T. Nagatsuma, T. Tabata, M. Monma, M. Saito, S. Ozawa, and K. Ozutsumi. 1994. Genetic variants of the growth hormone gene in Japanese cattle. Anim. Sci. Technol. (Jpn.) 65:340-346.
Choi, Y. J., D. S. Yim, J. S. Cho, B. D. Cho, K. J. Na, and M. G. Baik. 1997. Analysis of restriction fragment length polymorphism in the bovine growth hormone gene related to growth performance and carcass quality of Korean native cattle. Meat. Sci. 45:405-410.
Eppard, P. J., L. A. Nenthe, B. N. Violan, S. Ganguli, R. L. Hintz, L. Kung Jr., G. G. Krivi, and G. M. Lanza. 1992. Comparison of the galactopoietic response to pituitary-derived and recombinant-derived variants of bovine growth hormone. J. Endocrinol. 132:47-56.
Ferraz, A. L., J. C. Bortolossi, R. A. Curi, M. I. T. Ferro, J. A. Ferro, and L. R. Furlan. 2006. Identification and characterization of polymorphisms within the 5' flanking region, first exon and part of first intron of bovine GH gene. J. Anim. Breed. Genet. 123:208-212.
Ge, W., M. E. Davis, H. C. Hines, K. M. Irvin, and R. C. Simmen. 2003. Association of single nucleotide polymorphisms in the growth hormone and growth hormone receptor genes with blood serum insulin-like growth factor I concentration and growth traits in Angus cattle. J. Anim. Sci. 81:641-648.
Gordon, D. F., D. P. Quick, C. R. Erwin, J. E. Donelson, and R. A. Maurer. 1983. Nucleotide sequence of the bovine growth hormone chromosomal gene. Mol. Cell. Endocrinol. 33:81-95.
Hecht, C. and H. Geldermann. 1996. Variants within the 5'-flanking region and intron I of the bovine growth hormone gene. Anim. Genet. 27:329-332.
Hediger, R., S. E. Johnson, W. Barendse, R. D. Drinkwater, S. S. Moore, and J. Hetzel. 1990. Assignment of the growth hormone gene locus to 19q26-qter in cattle and to 11q25-qter in sheep by in situ hybridization. Genomics 8:171-174.
Herrington, J., L., S. Smit, J. Schwartz, and C. Carter-Su. 2000. The role of STAT proteins in growth hormone signaling. Oncogene.19:2585-97.
Ho, K. K. and D. M. Hoffman. 1993. Aging and growth hormone. Horm. Res. 40:80-86.
Kim, N. K., Y. W. Seo, G. H. Kim, J. H. Joh, O. H. Kim, E. R. Chung, and C. S. Lee. 2004. A previously unreported DraI polymorphism within the regulatory region of the bovine growth hormone gene and its association with growth traits in Korean Hanwoo cattle. Anim. Genet. 35:152-154.
Lee, B. K., G. F. Lin, B. A. Crooker, M. P. Murtaugh, L. B. Hansen, and H. Chgester-Jones. 1996. Association of somatotropin (BST) gene polymorphism at the 5th exon with selection for milk yield in Holstein cows. Domest. Anim. Endocrinol. 13:373-381.
Lincoln, D. T., F. Sinowatz, E. El-Hifnawi, R. L. Hughes, and M. Waters. 1995. Evidence of a direct role for growth hormone (GH) in mammary gland proliferation and lactation. Anat. Histol. Embryol. 24:107-115.
Lucy, M. C., S. D. Hauser, P. J. Eppard, G. G. Krivi, J. H. Clark, D. E. Bauman, and R. J. Collier. 1993. Variants of somatotropin in cattle: gene frequencies in major dairy breeds and associated milk production. Domest. Anim. Endocrinol. 10:325-333.
Miller, W. L., J. A. Martial, and J. D. Baxter. 1980. Molecular cloning of DNA complementary to bovine growth hormone mRNA. J. Biol. Chem. 255:7521-7524.
Roth, P., C. Nerlov, R. Blasi, and M. Johnsen. 1990. Transcription factor PEA3 participates in the induction of urokinase plasminogen activator transcription in murine kerainocytes stimulated with epidermal growth factor or phorbolester. Nucl. Acid. Res. 18:5009-5017.
Sambrook, J. and D. W. Russell. 2001. Molecular cloning: A laboratory manual. Vol. 1 3rd ed.: Cold Spring Harbor. New York. pp. 6.4-6.12.
Santome, J. A., J. M. Dellacha, A. C. Paladini, C. E. Wolfenstein, C. Pena, E. Poskus, S. T. Daurat, M. J. Biscoglio, Z. M. De
Sese, and A. V. De Sanguesa. 1971. The amino acid sequence of bovine growth hormone. FEBS Lett. 16:198-200.
Schlee, P., R. Graml, E. Schallenberger, D. Schams, O. Rottmann, A. Olbrich-Bludau, and F. Pirchner. 1994. Growth hormone and insulin-like growth factor I concentrations in bulls of various growth hormone genotypes. Theor. Appl. Genet. 88:497-500.
Sumantran, V. N., M. L. Tsai, and J. Schwartz. 1992. Growth hormone induces c-fos and c-jun expression in cells with varying requirements for differentiation. Endocrinology 130: 2016-2024.
Theill, L. E. and M. Karin. 1993. Transcriptional control of GH expression and anterior pituitary development. Endocrine Rev. 14:670-689.
Vaccarelli, G., C. M. Maria, A. Rachele, P. Graziano, and C. Salvatrice. 2008. Genomic organization and recombinational unit duplication-driven evolution of ovine and bovine T cell receptor gamma loci. BMC Genomic 9:81.
Wallis, M. 1973. The primary structure of bovine growth hormone. FEBS Lett. 35:11-14.
Woychik, R. P., S. A. Camper, R. H. Lyons, S. Horowitz, E. C. Goodwin, and F. M. Rottman. 1982. Cloning and nucleotide sequencing of the bovine growth hormone gene. Nucl. Acid. Res. 10:7197-7210.
Yao, J., S. E. Aggrey, D. Zadworny, J. F. Hayes, and U. Kuhnlein. 1996. Sequence variations in the bovine growth hormone gene characterized by single-strand conformation polymorphism (SSCP) analysis and their association with milk production traits in Holsteins. Genetics 144:1809-1816.
Yoon, D. H., T. H. Kim, K. H. Lee, E. W. Park, H. K. Lee, I. C. Cheong, and K. C. Hong. 2003. A missense mutation in exon 5 of the bovine growth hormone gene. J. Anim. Sci. Technol. (Kor.) 45:13-22.
Zhang, H. M., D. R. Brown, S. K. Denise, and R. L. Ax. 1992. Nucleotide sequence determination of a bovine somatotropin allele. Anim. Genet. 23:578.
Zhang, H. M., K. C. Maddock, D. R. Browns, S. K. Denise, and R. L. Ax. 1993. Bovine growth hormone gene frequencies in samples of U.S. AI bulls (Abstr.). J. Anim. Sci. 71:93.
Ji-Hong Leea, Yun-Mi Lee (1,a), Jea-Young Lee (2), Dong-Yep Oh (3), Dae-Jin Jeong (3), and Jong-Joo Kim (1), *
Gyeongbuk Provincial College, Yecheon, Gyeongbuk, Korea
* Corresponding Author: Jong-Joo Kim. Tel: +82-53-810-3027, Fax: +82-53-801-3027, E-mail: kimjj@ynu.ac.kr
(1) School of Biotechnology, Yeungnam University, Gyeongsan, Gyeongbuk, Korea.
(2) Department of Statistics, Yeungnam University, Gyeongsan, Gyeongbuk, Korea.
(3) Gyeongbuk Livestock Research institution, Yeongju, Gyeongbuk, Korea.
(a) The two authors contributed equally.
Submitted May 7, 2013; Accepted Jun. 15, 2013; Revised Jul. 1, 2013
Table 1. Sequences of primers for sequencing the bovine growth hormone (bGH) gene in Hanwoo Primer Primer name size (bp) Primer sequence Sequencing GH1-N1 F 20 CCAGGGATTGAACCTGAGTC R 21 CCATTAGCACAGGCTGCCAGT GH1-N2 F 20 AGTGGAGACGGGATGATGAC R 21 CCTCCTGGTCTCTCCCTAGGC GH1-N3 F 21 CATTTGGCCAAGTTTGAAATG R 20 CATCCAGAACACCCAGGTTG GH1-N4 F 18 AACCGCGCACCAGCTTAG R 20 GAGAAGCTGAAGGACCTGGA GH1-N5 F 20 TCTCACTGCTCCTCATCCAG R 20 GCAGATCCTCAAGCAGACCT GH1-N6 F 20 CTTCGGCCTCTCTGTCTCTC R 21 GAAGACAATAGCAGGCATGCT Genotyping GH1-P1 F 20 CCAGGGATTGAACCTGAGTC R 20 TGAGTCGTCTGGTGAACTGG GH1-E1 F 20 ACGGGAACAGGATGAGTGAG R 20 CACATTCGGAAGCCCTAAAG GH1-E2 F 20 CAGGTTGCCTTCTGCTTCTC R 20 CGTGCATTCTCCTGGCTAAG GH1-E3 F 20 TTTTCCCCTTTTGAAACCTC R 20 CGATGCAATTTCCTCATTTT Fragment Annealing temp Primer name Location size (bp) ([degrees]C) Sequencing GH1-N1 F 47-558 512 56 R 56 GH1-N2 F 451-972 522 56 R 56 GH1-N3 F 852-1,413 562 56 R 56 GH1-N4 F 1,314-1,839 526 56 R 56 GH1-N5 F 1,722-2,186 465 56 R 56 GH1-N6 F 2,105-2,528 424 56 R 56 Genotyping GH1-P1 F 639 62 R 62 GH1-E1 F 328 58 R 58 GH1-E2 F 536 58 R 58 GH1-E3 F 428 54 R 54 Table 2. Genotype and allele frequencies of SNPs within the bGH gene of Hanwoo Genotype allele frequency SNP Position (No. of individuals) 253 C > T Promoter CC(131) CT(82) TT(22) 0.557 0.349 0.094 303 C > T Promoter CC(202) CT(28) TT(5) 0.860 0.119 0.021 502 C > T Promoter CC(152) CT(74) TT(9) 0.647 0.315 0.038 559 G > A Promoter GG(231) GA(4) AA(0) 0.983 0.017 0.000 679 C > T Exon1 CC(225) CT(5) TT(0) 0.978 0.022 0.000 1692 T > C Intron3 CC(5) CT(56) TT(147) 0.024 0.269 0.707 2141 C > G Exon5 CC(196) CG(27) GG(8) 0.848 0.117 0.035 2258 C > T Exon5 CC(192) CT(39) TT(0) 0.831 0.169 0.000 2277 C > T Exon5 CC(222) CT(9) TT(0) 0.961 0.039 0.000 2291 A > C Exon5 CC(10) CA(67) AA(154) 0.043 0.290 0.667 No. of SNP individuals MAF (1) H (2) HWE (3) 253 C > T 235 0.268 0.392 0.089 303 C > T 235 0.081 0.149 0.002 502 C > T 235 0.196 0.315 0.999 559 G > A 235 0.009 0.017 0.895 679 C > T 230 0.011 0.022 0.868 1692 T > C 208 0.159 0.267 0.903 2141 C > G 231 0.093 0.169 0.000 2258 C > T 231 0.084 0.155 0.161 2277 C > T 231 0.019 0.038 0.763 2291 A > C 231 0.188 0.306 0.436 (1) Heterozygosity. (2) Minor allele frequency. (3) p value indicates degree of deviation of genotype distribution from Hardy-Weinberg equilibrium. Table 3. Least square mean and standard error of genotype effects of bGH gene for growth traits in Hanwoo Traits (kg) SNP 303 C > T CC(202) WT6 168.51 [+ or -] 1.77 (b) WT12 277.35 [+ or -] 2.27 WT18 411.72 [+ or -] 2.98 WT24 564.35 [+ or -] 4.03 ADG 0.73 [+ or -] 0.01 2141 C > G CC(196) WT6 168.02 [+ or -] 1.78 WT12 276.60 [+ or -] 2.34 WT18 410.86 [+ or -] 3.09 WT24 562.55 [+ or -] 4.13 ADG 0.73 [+ or -] 0.01 (a) 2258 C > T CC(192) WT6 167.25 [+ or -] 1.89 WT12 278.02 [+ or -] 2.46 WT18 414.89 [+ or -] 3.23 WT24 567.62 [+ or -] 4.33 ADG 0.74 [+ or -] 0.01 (b) Genotype means [+ or -] Traits standard errors (No. (kg) of individuals) SNP 303 C > T CT(28) WT6 170.53 [+ or -] 4.68 (b) WT12 284.18 [+ or -] 5.985 WT18 428.40 [+ or -] 7.855 WT24 577.10 [+ or -] 10.64 ADG 0.75 [+ or -] 0.02 2141 C > G CG(27) WT6 167.95 [+ or -] 4.73 WT12 281.04 [+ or -] 6.20 WT18 420.74 [+ or -] 8.19 WT24 566.09 [+ or -] 10.95 ADG 0.74 [+ or -] 0.02 (a) 2258 C > T CT(39) WT6 168.46 [+ or -] 3.84 WT12 273.14 [+ or -] 4.99 WT18 400.85 [+ or -] 6.56 WT24 548.59 [+ or -] 8.79 ADG 0.71 [+ or -] 0.01 (a) Traits (kg) p-value SNP 303 C > T TT(5) WT6 137.81 [+ or -] 11.01 (a) 0.019 WT12 261.69 [+ or -] 14.07 0.275 WT18 404.56 [+ or -] 18.46 0.114 WT24 594.13 [+ or -] 25.00 0.284 ADG 0.81 [+ or -] 0.04 0.062 2141 C > G GG(8) WT6 149.54 [+ or -] 8.55 0.103 WT12 276.18 [+ or -] 11.21 0.788 WT18 418.93 [+ or -] 14.80 0.470 WT24 596.31 [+ or -] 19.79 0.241 ADG 0.81 [+ or -] 0.03 (b) 0.038 2258 C > T TT(0) WT6 0.779 WT12 0.381 WT18 0.057 WT24 0.054 ADG 0.015 (a,b) Mean values with different superscript letters within the same row are significantly different (p < 0.05). Table 4. Least square mean and standard error of genotype effects of bGH gene for carcass quality traits in Hanwoo SNP Traits 559 G > A GG(231) CWT (kg) 309.62 [+ or -] 2.18 LMA ([cm.sup.2]) 76.17 [+ or -] 0.55 (b) BF (mm) 7.10 [+ or -] 0.19 MS 5.82 [+ or -] 0.23 2258 C > T CC(192) CWT (kg) 310.41 [+ or -] 2.41 (b) LMA ([cm.sup.2]) 76.11 [+ or -] 0.61 BF (mm) 6.97 [+ or -] 0.21 MS 5.79 [+ or -] 0.27 Genotype means [+ or -] standard errors SNP Traits (No. of individuals) 559 G > A GA(4) AA(0) CWT (kg) 296.37 [+ or -] 15.44 LMA ([cm.sup.2]) 67.89 [+ or -] 3.89 (a) BF (mm) 7.80 [+ or -] 1.36 MS 3.89 [+ or -] 1.65 2258 C > T CT(39) TT(0) CWT (kg) 298.50 [+ or -] 4.93 (a) LMA ([cm.sup.2]) 74.93 [+ or -] 1.24 BF (mm) 7.40 [+ or -] 0.44 MS 5.48 [+ or -] 0.54 SNP Traits p-value 559 G > A CWT (kg) 0.397 LMA ([cm.sup.2]) 0.037 BF (mm) 0.614 MS 0.249 2258 C > T CWT (kg) 0.031 LMA ([cm.sup.2]) 0.392 BF (mm) 0.375 MS 0.615 (a,b) Mean values with different superscript letters within the same row are significantly different (p < 0.05).
![]() ![]() ![]() ![]() | |
Author: | Leea, Ji-Hong; Lee, Yun-Mi; Lee, Jea-Young; Oh, Dong-Yep; Jeong, Dae-Jin; Kim, Jong-Joo |
---|---|
Publication: | Asian - Australasian Journal of Animal Sciences |
Article Type: | Report |
Geographic Code: | 9SOUT |
Date: | Oct 1, 2013 |
Words: | 4406 |
Previous Article: | Perspective of membrane technology in dairy industry: a review. |
Next Article: | Effect of FTO expression and polymorphism on fat deposition in Suzhong pigs. |
Topics: |