Printer Friendly

Identification of major CYP2C9 and CYP2C19 polymorphisms by fluorescence resonance energy transfer analysis.

CYP2C9 and CYP2C19 monooxygenases (EC 1.14.14.1) are responsible for the metabolism of a variety of drugs and other xenobiotics, including proton pump inhibitors, certain tricyclic antidepressants, barbiturates, beta-blockers, nonsteroidal antiinflammatory drugs, warfarin, and others (1). More than 12 variants of CYP2C9 and CYP2C19 are known, some of which can be linked to altered drug metabolism and to potential severe side effects (2,3). CYP2C9*2 (430C [right arrow] T), CYP2C9*3 (1075A [right arrow] C), CYP2C19*2 (681G [right arrow] A), CYP2C19*3 (636G [right arrow] A), and CYP2C19*4 (1A [right arrow] G) account for >90% of Caucasian poor-metabolizer alleles (nucleotide changes in parentheses after the allele) (4,5). The nucleotide changes in the CYP2C9*2 and CYP2C9*3 alleles lead to changes in the amino acid sequence (R144C for CYP2C9*2 and 1359L for CYP2C9*3) and thus to decreased enzyme activity. In the case of CYP2C19*2, *3, and *4, the nucleotide changes lead to a splicing defect, stop codon, and GTG initiation codon, respectively, and therefore to a protein with no activity.

We developed a new assay based on fluorescence resonance energy transfer (FRET). We labeled oligonucleotides with donor and acceptor fluorophores for mutation detection and applied this assay to the LightCycler (Roche Diagnostics). Single base alterations can be identified on the basis of different melting temperatures ([T.sub.m]s), and we used this method to screen genotypes of healthy unrelated individuals from Southern Germany. We report a robust and swift genotyping assay to permit analysis of major CYP2C9 and CYP2C19 alleles within 60 min of blood collection for each allele. This assay can be used in routine clinical practice to provide guidance for dose adjustments of drugs metabolized by CYP2C9/19.

We examined 189 healthy males and females from a Human Pharmacology Unit for participation in various clinical research trials. After giving written informed consent, these individuals were genotyped for CYP2C9*2, CYP2C9*3, CYP2C19*2, CYP2C19*3, and CYP2C19*4.

DNA from whole blood was isolated using the NucleoSpin Blood DNA Extraction Kit (Macherey-Nagel) according to the manufacturer's instructions.

CYP2C9 alleles were genotyped as follows. The fluorogenic adjacent hybridization probes were obtained from TIB-MOLBIOL. The sequences for the various PCR oligonucleotides are shown in Table 1. Hybridization probes were designed in such a way that their [T.sub.m]s were marginally higher than the [T.sub.m]s of the primers. The sensor probes of the CYP2C9*2 and CYP2C9*3 alleles were labeled with fluorescein at the 3' end, and the anchor probes were coupled with LightCycler Red 640 (CYP2C9*2) or LightCycler Red 705 (CYP2C9*3) at the 5' end (see Table 1). Each of the corresponding probes recognized adjacent sequences, with the shorter probe lying over the mutation site, and probes were separated by one base. Fluorescein was used as the donor fluorophore and blocked extension from the probe during PCR. LightCycler Red 640 and LightCycler Red 705 were used as acceptors in the FRET process, with the 3' ends of the anchor probes phosphorylated to block extension. The greater stability of the longer anchor probe meant that loss of fluorescence occurred as the shorter probe (sensor) melted off the template. The probes were designed such that the two different mutation sites could be detected simultaneously (duplex PCR).

PCR was performed with 100 nM CYP2C9 primers (see Table 1) in a standard PCR reaction containing 400 nM each of the anchor and sensor hybridization probes, 100 ng of DNA, 4.0 mM Mg[Cl.sub.2], and 2 [micro]L of LightCycler DNA master hybridization mixture (LightCycler-DNA Master Hybridization Probes; Roche Diagnostics Inc.) in a total of 20 [micro]L. The reaction was started with a denaturation step at 95[degrees]C for 30 s, and amplification was performed for 50 cycles of denaturation (95[degrees]C for 0 s; ramp rate, 20[degrees]C/s), annealing (55[degrees]C for 7 s; ramp rate, 20[degrees]C/s), and extension (72[degrees]C for 12 s; ramp rate, 20[degrees]C/s).

PCR products were identified by monitoring DNA melting curves in the glass capillary. DNA was denatured at 95[degrees]C for 30 s, and maximum fluorescence was acquired by holding the reaction at 52[degrees]C for 30 s. Data for the melting curves were generated by heating slowly to 80[degrees]C with a ramp rate of 0.1[degrees]C/s, and were collected continuously during that time. When the shorter probe melted off the template, FRET no longer took place, and fluorescence was converted to melting peaks by software that plotted the negative derivative of fluorescence with respect to temperature (-dF/dT vs T). The sequence-specific hybridization probes melted off the target sequences at characteristic temperatures: 68[degrees]C (variant allele) and 73[degrees]C (wild-type allele) in the case of CYP2C9*2 (channel F2 in the LightCycler), and 60[degrees]C (wild-type allele) and 660C (variant allele) for CYP2C9*3 (channel F3 in the LightCycler). The mutations produced a minimum [T.sub.m] shift of 5[degrees]C, allowing easy detection of a wild-type from a variant allele. A typical example is given in Fig. 1.

Reverse complementary oligonucleotides of the anchor and sensor probes were used as positive controls (see Table 1). Certain amplification products were also sequenced (Genetic Analyzer 3100; ABI) to verify correct genotyping with this assay.

To detect the various CYP2C19 alleles, we used the same principle as described above with the following modifications: The sequences for PCR oligonucleotides and hybridization probes are shown in Table 1. The sensor probe for CYP2C19*2 was labeled with LightCycler Red 640 at the 5' end, and the anchor probe was labeled with fluorescein at the 3' end. For the CYP2C19*3 and CYP2C19*4 alleles, the sensor probe was labeled with fluorescein at the 3' end, and the anchor probe was labeled with LightCycler Red 640 at the 5' end (see Table 1). Hybridization probes were separated by one (CYP2C19*3), two (CYP2C19*2), or three (CYP2C19*4) bases.

PCR was performed with 400 nM CYP2C19 primers (see above) in a standard PCR reaction containing 100 nM each of the anchor and sensor hybridization probes, 100 ng of DNA, 4.0 mM Mg[Cl.sub.2], and 2 [micro]L of LightCycler DNA master hybridization mixture (LightCycler-DNA Master Hybridization Probes) in a total of 20 [micro]L. To detect the CYP2C19*2 and CYP2C19*3 alleles, the reaction started with denaturation at 95[degrees]C for 30 s, and amplification was performed for 50 cycles of denaturation (95[degrees]C for 0 s; ramp rate, 20[degrees]C/s), annealing (48[degrees]C for 7 s; ramp rate, 20[degrees]C/s), and extension (72[degrees]C for 14 s; ramp rate, 20[degrees]C/ s). To detect the CYP2C19*4 allele, the reaction started with denaturation at 95[degrees]C for 30 s, and amplification was performed for 50 cycles of denaturation (95[degrees]C for 0 s; ramp rate, 20[degrees]C/s), annealing (55[degrees]C for 10 s; ramp rate, 20[degrees]C/s), and extension (72[degrees]C for 14 s; ramp rate, 20[degrees]C/ s). Melting point analysis for all CYP2C19 alleles was done by heating the amplification products slowly from 40 to 80[degrees]C with a ramp rate of 0.1[degrees]C/s.

Hybridization probes melted off the target sequences at characteristic temperatures that were detected by channel F2 in the LightCycler. For CYP2C19*2, the [T.sub.m]s were 56[degrees]C for the wild-type and 62[degrees]C for the variant allele; for CYP2C19*3, the [T.sub.m]s were 61[degrees]C for the wild-type and 67[degrees]C for the variant allele; and for CYP2C19*4, the [T.sub.m]s were 59[degrees]C for the variant and 65[degrees]C for the wild-type allele.

Reverse complementary oligonucleotides of the anchor and sensor probes were used as positive controls (see Table 1).

Representative melting curves for the CYP2C9*2 and CYP2C19*2 alleles are depicted in Fig. 1. The differences in the [T.sub.m]s among individual genotypes were sufficient to permit reliable discrimination of single alleles (dT, +5-7 [degrees]C). There was no difference between the theoretically predicted and sequenced PCR products (data not shown). We thus show corroborative and conclusive evidence for accurate DNA amplification of individual alleles.

In our cohort of unrelated individuals from Southern Germany, the allelic frequencies were 0.125 for the CYP2C9*2 and 0.083 for the CYP2C9*3 allele (n = 24), and 0.158, 0.003, and 0.000 for the CYP2C19*2, *3, and *4 alleles, respectively (n = 165).

We report a new genotyping assay for identification of the CYP2C9*2, CYP2C9*3, CYP2C19*2, CYP2C19*3, and CYP2C19*4 alleles, which contribute substantially to the genetic variability in the pharmacokinetics of drugs and other xenobiotics that are metabolized by CYP2C9 and CYP2C19 in Caucasians (4,5). Other molecular biology methods may be used to detect genetic polymorphisms, including direct sequencing (6), restriction fragment length polymorphism analysis (7), and single-strand conformation polymorphism analysis (8), but these methods are laborious and cumbersome, which is a major drawback for their routine use in clinical practice. Others have developed a fluorescence-based assay that can be performed with the TagMan System, but not with the LightCycler technology (9,10).

[FIGURE 1 OMITTED]

FRET provides a powerful tool for the rapid, inexpensive, and reliable determination of certain genetic polymorphisms, as recently shown by us for the molecular diagnosis of the Gilbert syndrome (11).

Recently, the clinical significance of cytochrome P450 genotyping before drug treatment has been shown for patients treated with the antiepileptic drug phenytoin: patients carrying at least one variant CYP2C9 allele required dose adjustment approximately two-thirds of standard doses to achieve a therapeutic serum concentrations (12).

In conclusion, our assay can be used in routine clinical practice to provide guidance on dose adjustments for drugs that are metabolized by CYP2C9 and CYP2C19.

References

(1.) Goldstein JA, de Morais SM. Biochemistry and molecular biology of the human CYP2C subfamily. Pharmacogenetics 1994;4:285-99.

(2.) Pirmohamed M, Park BK. Genetic susceptibility to adverse drug reactions. Trends Pharmacol Sci 2001;22:298-305.

(3.) Human Cytochrome P450 (CYP) Allele Nomenclature Committee. http:// www.imm.ki.se/cypalieles/ (Accessed May 2002).

(4.) Stubbins MJ, Harries LW, Smith G, Tarbit MH, Wolf CR. Genetic analysis of the human cytochrome P450 CYP2C9 locus. Pharmacogenetics 1996;6: 429-39.

(5.) Xie HG, Stein CM, Kim RB, Wilkinson GR, Flockhart DA, Wood AJ. Allelic, genotypic and phenotypic distributions of Smephenytoin 4'-hydroxylase (CYP2C19) in healthy Caucasian populations of European descent throughout the world. Pharmacogenetics 1999;9:539-49.

(6.) Kidd RS, Curry TB, Gallagher S, Edeki T, Blaisdell J, Goldstein JA. Identification of a null allele of CYP2C9 in an African-American exhibiting toxicity to phenytoin. Pharmacogenetics 2001;11:803-8.

(7.) Garcia-Barcelo M, Chow LY, Kum Chiu HF, Wing YK, Shing Lee DT, Lam KL, et al. Frequencies of defective CYP2C19 alleles in a Hong Kong Chinese population: detection of the rare allele CYP2C19*4. Clin Chem 1999;45: 2273-4.

(8.) Itch K, Inoue K, Nakao H, Yanagiwara S, Tada H, Suzuki T. Polymerase chain reaction-single-strand conformation polymorphism based determination of two major genetic defects responsible for a phenotypic polymorphism of cytochrome P450 (CYP) 2C19 in the Japanese population. Anal Biochem 2000;284:160-2.

(9.) Hiratsuka M, Agatsuma Y, Omori F, Narahara K, Inoue T, Kishikawa Y, et al. High throughput detection of drug-metabolizing enzyme polymorphisms by allele-specific fluorogenic 5' nuclease chain reaction assay. Biol Pharm Bull 2000;23:1131-5.

(10.) Oliver DH, Thompson RE, Griffin CA, Eshleman JR. Use of single nucleotide polymorphisms (SNP) and real-time polymerase chain reaction for bone marrow engraftment analysis. J Mol Diagn 2000;2:202-8.

(11.) Borlak J, Thum T, Landt 0, Erb K, Hermann R. Molecular diagnosis of a familial nonhemolytic hyperbilirubinemia (Gilbert's syndrome) in healthy subjects. Hepatology 2000;32:792-5.

(12.) van der Weide J, Steijns LS, van Weelden MJ, de Haan K. The effect of genetic polymorphism of cytochrome P450 CYP2C9 on phenytoin dose requirement. Pharmacogenetics 2001;11:287-91.

Jurgen Borlak * and Thomas Thum (Fraunhofer Institute of Toxicology and Aerosol Research, Center of Drug Research and Medical Biotechnology, 30625 Hannover, Germany; * address correspondence to this author at: Fraunhofer Institute of Toxicology and Aerosol Research, Center of Drug Research and Medical Biotechnology, D-30659 Hannover, Germany; fax 49-511-5350-573, e-mail Borlak@ita.fhg.de)
Table 1. Oligonucleotide primer and hybridization probes used in
this study.

Gene 5'-3' sequence (a)

Oligonucleotide primers
 CYP2C9*2 FP (b) TCCTAGTTTCGTTTCTCTTCCTGT
 CYP2C9*2 RP GTTTTTCTCAACTCCTCCACAAGG
 CYP2C9*3 FP AGCTAAAGTCCAGGAAGAGATTGAA
 CYP2C9*3 RP CCTTGGGAATGAGATAGTTTCTGAA
 CYP2C19*2 FP AATTACAACCAGAGCTTGGC
 CYP2C19*2 RP TATCACTTTCCATAAAAGCAAG
 CYP2C19*3 FP AAATTGTTTCCAATCATTTAGCT
 CYP2C19*3 RP ACTTCAGGGCTTGGTCAATA
 CYP2C19*4 FP GGAGTGCAAGCTCATGGTTG
 CYP2C19*4 RP TTGGTTAAGGATTTGCTGACA
Hybridization probes
 CYP2C9*2 S CCTCTTGAACACGGTCCTCAATGC-X
 CYP2C9*2 A LC Red640-CCTCTTCCCCATCCCAAAATTCCGCA-P
 CYP2C9*3 S GTCCAGAGATACATTGACCTTCT-X
 CYP2C9*3 A LC-Red705-CCCACCAGCCTGCCCCATGCA-P
 CYP2C19*2 S LD Red640-TGATTATTTCCCAGGAACCC-P
 CYP2C19*2 A CTCTTAGATATGCAATAATTTTCCCACTATC-X
 CYP2C19*3 S GGATTGTAAGCACCCCCTGAATC-X
 CYP2C19*3 A LC Red640-AGGTAAGGCCAAGTTTTTTGCTTCCTGAG-P
 CYP2C19*4 S AAGGCTTCAATGGATCCTTTTGT-X
 CYP2C19*4 A LC-Red 640-CCTTGTGCTCTGTCTCTCATGTTTGCT-P
Positive controls
 CYP2C9(C)*1 CTGCGGAATTTTGGGATGGGGAAGAGGAGCATTGAGGACCGT-
 GTTCAAGAGGA
 CYP2C9(T)*2 CTGCGGAATTTTGGGATGGGGAAGAGGAGCATTGAGGACTGT-
 GTTCAAGAGGA
 CYP2C9(A)*1 CTGCATGGGGCAGGCTGGTGGGGAGAAGGTCAATGTATCTCT-
 GGACC
 CYP2C9(C)*3 CTGCATGGGGCAGGCTGGTGGGGAGAAGGTCAAGGTATCTCT-
 GGACC
 CYP2C19(G)*1 TGGGTTCCCGGGAAATAATCAATGATAGTGGGAAAATTATTG-
 CATATCTAAGAGA
 CYP2C19(A)*2 TGGGTTCCTGGGAAATAATCAATGATAGTGGGAAAATTATTG-
 CATATCTAAGAGA
 CYP2C19(G)*1 TCTCAGGAAGCAAAAAACTTGGCCTTACCTGGATCCAGGGGG-
 TGCTTACAATCCT
 CYP2C19(A)*3 TCTCAGGAAGCAAAAAACTTGGCCTTACCTGGATTCAGGGGG-
 TGCTTACAATCCT
 CYP2C19(A)*1 AGCAAACATGAGAGACAGAGCACAAGGACCACAAAAGGATCC-
 ATTGAAGCCT
 CYP2C19(G)*4 AGCAAACATGAGAGACAGAGCACAAGGACCACAAAAGGATCC-
 ACTGAAGCCT

(a) Single-nucleotide polymorphisms are indicated in bold.

(b) FP, forward primer; RP, reverse primer; S, sensor; A, anchor;
P, phosphorylated; X, fluorescein.
COPYRIGHT 2002 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2002 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Technical Briefs
Author:Borlak, Jurgen; Thum, Thomas
Publication:Clinical Chemistry
Date:Sep 1, 2002
Words:2262
Previous Article:Analytical requirements for measuring monocytic human lymphocyte antigen DR by flow cytometry: application to the monitoring of patients with septic...
Next Article:Monitoring analytical quality in routine glycohemoglobin measurements.
Topics:


Related Articles
Effects of intrinsic fluorescence and quenching on fluorescence-based screening of natural products.
New DNA test: prescription for genetic precision.
New DNA test's data could shape clinical decisions: seen as step to 'personalized medicine.'.
Estimation of warfarin maintenance dose based on VKORC1 (-1639 G>A) and CYP2C9 genotypes.
Influence of cytochrome P450 2C9*2 and 2C9*3 variants on the risk of ischemic stroke: a cross-sectional case-control study.
Pyrosequencing method for genotyping cytochrome P450 CYP2C8 and CYP2C9 enzymes.
CYP2C9*2 and CYP2C9*3 alleles confer a lower risk for myocardial infarction.
Improved real-time PCR assay for homogeneous multiplex genotyping of four CYP2C9 alleles with hybridization probes.
Two single-tube tetra-primer assays to detect the CYP2C19*2 and *3 alleles of S-mephenytoin hydroxylase.
Rapid detection of UGT1A1 gene polymorphisms by newly developed invader assay.

Terms of use | Copyright © 2017 Farlex, Inc. | Feedback | For webmasters