Printer Friendly

Identification of mRNA markers for molecular staging of lymph nodes in colorectal cancer.

A critical component of improving the treatment of patients with colorectal cancer (CRC) and other cancers is improving our ability to accurately predict an individual patient's prognosis. The presence of metastasis to regional lymph nodes (LNs) provides the most prognostically significant information for adenocarcinomas and drives treatment decisions. There is now conclusive data for most cancers that improved LN analysis through increased sampling (multiple cross-sections) and sensitivity [immunohistochemistry (IHC)] identifies previously occult metastases (1-5). Similarly, in CRC, a sizeable percentage of patients who would be staged as node-negative by standard histologic analysis have occult IN disease that may be clinically significant (6-8).

Most published reports have used sentinel IN localization techniques and IHC to visually detect occult disease. Others have used reverse transcription (RT)-PCR to detect carcinoembryonic antigen (CEA) mRNA as a marker of occult disease (1, 9). Interestingly, studies using RT-PCR in colon cancer occult disease detection have consistently suggested that occult disease identified by this technique is clinically significant (1, 9), whereas studies using IHC have led to conflicting results and controversial conclusions (10, 11). These controversies have contributed to the failure of acceptance, even in academic settings, of sentinel IN biopsy and/or serial section analysis of IN, including IHC analysis for CRC. The lack of standardized sample preparation procedures and the labor-intensive nature of the analysis have also contributed.

We have previously reported the identification of IN metastases in other solid-organ tumors, using internally controlled, quantitative RT-PCR (QRT-PCR) assays to provide sensitive, objective, molecular staging of LNs (2,12-14). Importantly, we recently demonstrated that this approach can be fully automated, including sample preparation (15). These studies have consistently demonstrated that the success of this approach depends on the quality of disease-specific mRNA markers. Surprisingly, no systematic analysis of potential mRNA markers for CRC has been reported. We therefore performed an extensive mRNA marker survey for CRCs. We report several new markers capable of producing highly accurate QRT-PCR analysis of LNs from a CRC patient.

We conducted an extensive literature and public database survey to identify any potential markers relevant to CRC, followed by 2 phases of screening with QRT-PCR. All potential markers entered the primary screening phase, and expression was analyzed in 6 primary colon tumors and in 10 benign LNs obtained from patients without cancer. Markers that showed good characteristics for IN metastasis detection (i.e., high expression in primary tumors and low expression in benign LNs) passed into the secondary screening phase. The secondary screen consisted of expression analysis on 28 primary tumors, 12 histologically positive LNs, and 21 benign LNs from 21 patients without cancer (see Table 1 in the Data Supplement that accompanies the online version of this Technical Brief at www.clinchem.org/content/vol52/issue3). All tumors and positive IN samples were from different patients. Primary tumor and benign IN specimens were obtained from tissue banks at the University of Pittsburgh Medical Center through protocols approved by the Institutional Review Board. Positive LNs from patients with colon cancer were purchased from Ardais. We performed all quantitative PCBs on the ABI Prism 7700 Sequence Detection Instrument (Applied Biosystems). Relative expression of the marker genes was calculated by use of previously described delta-[C.sub.T] methods (16) and with [beta]-glucuronidase (GUS) as the endogenous control gene. The details of RNA preparation, reverse transcription, and quantitative PCR have been described in previous reports (17,18). Primers and probes were designed with use of the ABI Primer Express software (Ver. 2.0), and where possible, amplicons spanned exon junctions to provide cDNA specificity. In addition, all primer pairs were tested empirically for amplification from 100 ng of genomic DNA, and primers were redesigned when necessary. With the exception of CK19, cDNA-specific primer sets were successfully identified for all genes in this study. The sequences of primers and probes (purchased from IDT) for genes evaluated in the secondary screen are listed in Table 1.

Our literature and database surveys identified a total of 43 genes for evaluation in the primary tumor marker screen. All of these genes were analyzed for expression in 6 primary colon tumors and in 10 benign LNs. By calculating median expression in the tumors and lowest tumor/highest benign node and median tumor/highest benign node ratios, we selected 6 genes that we judged to have expression characteristics suitable for detection of IN metastases (see Table 2 in the online Data Supplement). Five of these genes--CDX1, CEA, CK19, TACSTD1, and Villin1 (VIL1)--have median tumor/highest benign node ratios >300 and therefore have the potential to detect small foci of tumor while still differentiating negative nodes. In addition, we selected CK20 based on the finding that it was moderately expressed in tumors but undetectable in benign nodes.

The relative expression profiles of the markers selected for the secondary screen are shown in Fig. 1. As the data indicate, all markers are expressed in positive LNs as well as in primary tumors, indicating that metastatic tumor cells continue to express these genes. Of the 6 markers analyzed, all except CK19 provided perfect classification of positive and benign LNs with 100% sensitivity and 100% specificity. CK19 had poor sensitivity (83.3%) because of relatively high background in benign LNs (Table 1). Although our primer design for CK19 does not avoid the known CK19 pseudogenes, all samples were DNase-treated, and "no-reverse transcriptase" controls were consistently negative, indicating that the background expression observed was not a result of contaminating DNA. On the basis of expression results in positive nodes and distribution of expression in benign nodes, TACSTD1 expression was, at a minimum, 595-fold higher in positive nodes than the highest expression in benign nodes. Expression of the existing markers, CEA and CK20, was 474-and 48-fold higher, respectively, in positive nodes than in benign nodes. Expression of CDX1 and VIL1 was relatively low in positive nodes compared with other markers, but the expression rates were 96- and 29-fold higher, respectively, than in benign nodes.

Despite promising data from the literature or gene expression databases, we found that the expression characteristics of most of the 43 marker genes evaluated in the primary screen were not suitable for use in CRC. Most had either very low or infrequent expression in the neoplasms, or they had relatively high expression in healthy or benign LNs. We were, however, able to identify 6 markers that we believed had good potential for identification of CRC in LNs. These markers (CEA, CK19, CDX1, CK20, TACSTD1, and VIL1) are mostly epithelial-cell related markers that have absent or low expression in healthy LNs. TACSDT1, CDX1, and VIL1 have not been reported previously for use in detection of CRC metastases in LNs.

[FIGURE 1 OMITTED]

TACSTD1, also known as EPCAM, KS1/4, GA-733-2, and MIC-18, is a human cell surface antigen that is detected by the monoclonal antibodies AUAI and BerEp4, and it has been used in several studies to detect LN micrometastases in a variety of tumor types via both IHC and RT-PCR (19-21). Although TACSTD1 was expressed at easily detectable concentrations in all positive LNs in our study, it was very highly and consistently expressed in CRC samples. As with CEA, high expression of TACSTD1 in tumors facilitates the identification of even small amounts of metastatic tumor in LNs when a quantitative assay is used.

CDX1 is a member of the caudal-type homeobox family of genes. These are cognates of the caudal gene in Drosophila, which is required for anterior-posterior regional identity. Homologous genes have been found in the mouse, rat, chicken, and Xenopus. Bonner et al. (22) isolated the human CDX1 gene from a small-intestine cDNA library, using a murine CDX1 cDNA probe. Later, Northern analysis indicated that expression of CDX1 in adults is limited to the intestine and colon. As such, CDX1 appeared to be a good potential marker for CRC. Our screening results showed that expression of CDX1 is at least 96-fold higher in positive nodes than in benign nodes. When combined with other markers, CDX1 is likely to provide a good assay to detect colon tumor cells in LNs.

Finally, Villin1 (VIL1) is a major structural component of the brush border cytoskeleton. It is a calcium-regulated, actin-binding protein that is specifically expressed in simple epithelia of some tissues of the gastrointestinal and urogenital tracts. Because CRC arises from a columnar epithelium, the finding that VIL1 is a potentially useful marker for this disease is not surprising.

In summary, the current TNM staging system for CRC is flawed, and one approach to improved prognostication is the identification of previously occult disease through techniques such as sentinel LN mapping, IHC, and RT-PCR. We have identified several new mRNA markers that are capable of providing exceptionally accurate characterization of IN status in CRC. An automated, multimarker QRT-PCR assay for characterization of LNs from CRC patients could be very useful for improved staging and treatment decision-making in CRC.

This work was supported in part by Grant CA-01958 from the National Institutes of Health (to S.J.H.), and by a cooperative research and development grant from Cepheid (to T.E.G.).

References

(1.) Liefers GJ, Cleton-Jansen AM, van de Velde CJ, Hermans J, van Krieken JH, Cornelisse CJ, et al. Micrometastases and survival in stage II colorectal cancer. N Engl J Med 1998;339:223-8.

(2.) Godfrey TE, Raja S, Finkelstein SD, Gooding WE, Kelly LA, Luketich JD. Prognostic value of quantitative reverse transcription-polymerase chain reaction in lymph node-negative esophageal cancer patients. Clin Cancer Res 2001;7:4041-8.

(3.) Sakorafas GH, Geraghty J, Pavlakis G. The clinical significance of axillary lymph node micrometastases in breast cancer. Eur J Surg Oncol 2004;30: 807-16.

(4.) Doubrovsky A, de Wilt JH, Scolyer RA, McCarthy WH, Thompson JF. Sentinel node biopsy provides more accurate staging than elective lymph node dissection in patients with cutaneous melanoma. Ann Surg Oncol 2004;11: 829-36.

(5.) Coello MC, Luketich JD, Litle VR, Godfrey TE. Prognostic significance of micrometastasis in non-small-cell lung cancer. Clin Lung Cancer 2004;5: 214-25.

(6.) Bilchik AJ, Saha S, Wiese D, Stonecypher JA, Wood TF, Sostrin S, et al. Molecular staging of early colon cancer on the basis of sentinel node analysis: a multicenter phase II trial. J Clin Oncol 2001;19:1128-36.

(7.) Wiese DA, Saha S, Badin J, Ng PS, Gauthier J, Ahsan A, et al. Pathologic evaluation of sentinel lymph nodes in colorectal carcinoma. Arch Pathol Lab Med 2000;124:1759-63.

(8.) Saha S, Monson KM, Bilchik A, Beutler T, Dan AG, Schochet E, et al. Comparative analysis of nodal upstaging between colon and rectal cancers by sentinel lymph node mapping: a prospective trial. Dis Colon Rectum 2004;47:1767-72.

(9.) Noura S, Yamamoto H, Ohnishi T, Masuda N, Matsumoto T, Takayama 0, et al. Comparative detection of lymph node micrometastases of stage II colorectal cancer by reverse transcriptase polymerase chain reaction and immunohistochemistry. J Clin Oncol 2002;20:4232-41.

(10.) Rosenberg R, Friederichs J, Gertler R, Hoos A, Mueller J, Nahrig J, et al. Prognostic evaluation and review of immunohistochemically detected disseminated tumor cells in peritumoral lymph nodes of patients with pNO colorectal cancer. Int J Colorectal Dis 2004;19:430-7.

(11.) Bustin SA, Dorudi S. Gene expression profiling for molecular staging and prognosis prediction in colorectal cancer. Expert Rev Mol Diagn 2004;4: 599-607.

(12.) Raja S, Luketich JD, Kelly LA, Ruff DW, Godfrey TE. Increased sensitivity of one-tube, quantitative RT-PCR. Biotechniques 2000;29:702, 704, 706.

(13.) Raja S, Luketich JD, Kelly LA, Gooding WE, Finkelstein SD, Godfrey TE. Rapid, quantitative reverse transcriptase-polymerase chain reaction: application to intraoperative molecular detection of occult metastases in esophageal cancer. J Thorac Cardiovasc Surg 2002;123:475-83.

(14.) Raja S, El Hefnawy T, Kelly LA, Chestney ML, Luketich JD, Godfrey TE. Temperature-controlled primer limit for multiplexing of rapid, quantitative reverse transcription-PCR assays: application to intraoperative cancer diagnostics. Clin Chem 2002;48:1329-37.

(15.) Raja S, Ching J, Xi L, Hughes SJ, Chang R, Wong W, et al. Technology for automated, rapid, and quantitative PCR or reverse transcription-PCR clinical testing. Clin Chem 2005;51:882-90.

(16.) Tassone F, Hagerman RJ, Taylor AK, Gane LW, Godfrey TE, Hagerman PJ. Elevated levels of FMR1 mRNA in carrier males: a new mechanism of involvement in the fragile-X syndrome. Am J Hum Genet 2000;66:6-15.

(17.) Xi L, Luketich JD, Raja S, Gooding WE, Litle VR, Coello MC, et al. Molecular staging of lymph nodes from patients with esophageal adenocarcinoma. Clin Cancer Res 2005;11:1099-109.

(18.) Ferris RL, Xi L, Raja S, Hunt JL, Wang J, Gooding WE, et al. Molecular staging of cervical lymph nodes in squamous cell carcinoma of the head and neck. Cancer Res 2005;65:2147-56.

(19.) Schroder CP, Ruiters MH, de Jong S, Tiebosch AT, Wesseling J, Veenstra R, et al. Detection of micrometastatic breast cancer by means of real time quantitative RT-PCR and immunostaining in perioperative blood samples and sentinel nodes. Int J Cancer 2003;106:611-8.

(20.) Takes RP, Baatenburg de Jong RJ, Wijffels K, Schuuring E, Litvinov SV, Hermans J, et al. Expression of genetic markers in lymph node metastases compared with their primary tumours in head and neck cancer. J Pathol 2001;194:298-302.

(21.) Mitas M, Cole DJ, Hoover L, Fraig MM, Mikhitarian K, Block MI, et al. Real-time reverse transcription-PCR detects KS1/4 mRNA in mediastinal lymph nodes from patients with non-small cell lung cancer. Clin Chem 2003;49:312-5.

(22.) Bonner CA, Loftus SK, Wasmuth JJ. Isolation, characterization, and precise physical localization of human CDX1, a caudal-type homeoboxgene. Genomics 1995;28:206-11.

DOI: 10.1373/clinchem.2005.062844

William Gooding, [2] Kenneth McCarty, [3] Tony E. Godfrey, [1,4] and Steven J. Hughes (1) * (Departments of [1] Surgery and [3] Pathology, and the [2] Pittsburgh Cancer Institute, University of Pittsburgh, Pittsburgh, PA; [dagger] current affiliation: Mount Sinai School of Medicine, New York, NY; * address correspondence to this author at: University of Pittsburgh, 497 Scaife Hall, 3550 Terrace Street, Pittsburgh, PA 15261; fax 412-648-2045, e-mail Hughess2@upmc.edu)
Table 1. mRAN marker design and detection sensitivity.

 Marker design

Gene Oligonucleotide Sequence, 5' [right arrow] 33'

GUS Forward primer CTCATTTGGAATTTTGCCGATT
 Reverse primer CCGAGTGAAGATCCCCTTTTTA
 Probe TGAACAGTCACCGACGAGAGTGCTGG

CDX1 Forward primer CGGTGGCAGCGGTAAGAC
 Reverse primer GATTGTGATGTAACGGCTGTAATG
 Probe ACCAAGGACAAGTACCGCGTGGTCTACA

CEA Forward primer AGACAATCACAGTCTCTGCGGA
 Reverse primer ATCCTTGTCCTCCACGGGTT
 Probe CAAGCCCTCCATCTCCAGCAACAACT

CK19 Forward primer AGATCGACAACGCCCGT
 Reverse primer AGAGCCTGTTCCGTCTCAAA
 Probe TGGCTGCAGATGACTTCCGAACCA

CK20 Forward primer CACCTCCCAGAGCCTTGAGAT
 Reverse primer GGGCCTTGGTCTCCTCTAGAG
 Probe CCATCTCAGCATGAAAGAGTCTTTGGAGCA

TACSTD1 Forward primer TCATTTGCTCAAAGCTGGCTG
 Reverse primer GGTTTTGCTCTTCTCCCAAGTTT
 Probe AAATGTTTGGTGATGAAGGCAGAAATGAATGG

VIL1 Forward primer TGGTTCCTGGCTTGGGATC
 Reverse primer TTGCCAGACTCCGCCTTC
 Probe TCAAGTGGAGTAACACCAAATCCTATGAGGACC

 Marker design

 Annealing
 [T.sub.m]
 Amplicon (a)
Gene Oligonucleotide size, bp [degrees]C

GUS Forward primer 81 60
 Reverse primer
 Probe

CDX1 Forward primer 109 62
 Reverse primer
 Probe

CEA Forward primer 77 64
 Reverse primer
 Probe

CK19 Forward primer 64 60
 Reverse primer
 Probe

CK20 Forward primer 86 60
 Reverse primer
 Probe

TACSTD1 Forward primer 82 64
 Reverse primer
 Probe

VIL1 Forward primer 74 62
 Reverse primer
 Probe

 LN metastasis detection

 Sensitivity
 with 100% Fold difference (c)
 specifity,
Gene Oligonucleotide (b) n (%) Minimum Median

GUS Forward primer
 Reverse primer
 Probe

CDX1 Forward primer 12/12 (100) 96.3 286.1
 Reverse primer
 Probe

CEA Forward primer 12/12 (100) 474.4 1349.8
 Reverse primer
 Probe

CK19 Forward primer 10/12 (83.3) 0.1 14.6
 Reverse primer
 Probe

CK20 Forward primer 12/12 (100) 48.3 8025.8
 Reverse primer
 Probe

TACSTD1 Forward primer 12/12 (100) 595.0 2025.0
 Reverse primer
 Probe

VIL1 Forward primer 12/12 (100) 29.0 90.4
 Reverse primer
 Probe

(a) [T.sub.m], melting temperature.

(b) Sensitivity calculation was based on absolute
cutoff on highest expression in benign LNs.

(c) Minimum and median fold differences were calculated
from the fold changes of expression of each marker in
positive LNs based on the maximum expression in benign
LNs.
COPYRIGHT 2006 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2006 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Technical Briefs
Author:Xi, Liqiang; Gooding, William; McCarty, Kenneth; Godfrey, Tony E.; Hughes, Steven J.
Publication:Clinical Chemistry
Date:Mar 1, 2006
Words:2623
Previous Article:Allele dropout in PCR-based diagnosis of Wilson disease: mechanisms and solutions.
Next Article:Cell-free plasma DNA: a marker for apoptosis during hemodialysis.
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |