Printer Friendly

Identification of genetic mutations in Australian malignant hyperthermia families using sequencing of RYR1 hotspots.

SUMMARY

Advances in analysis of the RYR1 gene (which encodes the skeletal muscle ryanodine receptor) show that genetic Examination is a useful adjunct to the in vitro contracture test in the diagnosis of malignant hypothermia, as defects in RYR1 have been shown to be responsible for malignant hyperthermia susceptibility. DNA from 34 malignant hyperthermia susceptible individuals and four malignant hyperthermia equivocal subjects was examined using direct sequencing of 'hot-pots' in the RYR1 gene to identify mutations associated with malignant hyperthermia. Seven different causative mutations (as defined by the European Malignant Hyperthermia Group) in nine malignant hyperthermia susceptible individuals were identified. In another six malignant hyperthermia susceptible individuals, five different published but as yet functionally uncharacterised mutations were identified. A further three as yet unpublished and functionally uncharacterised (novel) mutations were identified in three malignant hyperthermia susceptible samples If the novel and previously published mutations prove to be functionally associated with calcium homeostasis, then this method of analysis achieved a mutation defection rate of 47910. Based on the number of relatives presenting to our unit in the study period, the muscle biopsy rate would have decreased by 25%. That we only identified a genetic defect in RYR1 in 47% of in vitro contracture test positive individuals suggests that there are other areas in RYR1 where pathogenic mutations may occur and that RYR1 may not be the sole gene associated with malignant hyperthermia. It may also reflect a less than 100 pecificity of the in vitro contracture test.

Key Words: malignant hypothermia, genetics, diagnosis, physiopathology, DNA sequencing, RYR1, ryanodine receptor, calcium release channel, in vitro contracture test, novel mutation, general anaesthesia, chromosome 19

**********

Malignant hyperthermia (MH) is an acute pharmacogenetic disorder, which develops during or immediately after the application of general anaesthesia. The classic MH crisis consists of a hyper-metabolic state caused primarily by continued contraction of the skeletal muscles, which leads to massive C[O.sub.2] production, skeletal muscle rigidity, tachyarrhythmias, unstable haemodynamics, respiratory acidosis, cyanosis, hyperkalaemia, lactic acidosis, fever and eventually (if untreated) death'.

The disorder is essentially a result of a defect in calcium homeostasis(2), which can result from an alteration in DNA coding for the ryanodine receptor (RYR1) on chromosome 19q(3,4). Volatile anaesthetic agents and depolarising muscle relaxants interact with the calcium channel resulting in the clinical crisis.

The RYR1 gene is very large (contains a total of 106 exons and 15,000 bases of coding sequence). Mutations in three 'hot-spot' areas of the RYR1 gene have been shown to be functionally responsible for up to 50% of malignant hyperthermia susceptible (MHS) patients in European populations'. These areas include the N-terminal region between codons 34 and 614 (exons 2 to 19), the central region between codons 2163 and 2458 (exons 39 to 47) and the C-terminal region between codons 4136 and 4973 (exons 85 to 104). The European Malignant Hyperthermia Group (EMHG) Guidelines(6) state that patients displaying one of the causative mutations in the RYR1 gene can be diagnosed as MHS without the need for a muscle biopsy.

The aim of this study was to identify mutations associated with MH in Australian families by direct sequencing of these previously outlined 'hot-spots' in the RYR1 gene and to use this information to decrease the number of family members requiring muscle biopsy and in vitro contracture test (IVCT) for diagnosis of MH. Secondary aims were to add to the international pool of RYR1 defects that may be associated with MH and to identify those mutations occurring more commonly in the Australian population.

MATERIALS AND METHODS

Approval was granted for this project by our Institutional Human Ethics Committee. Participants were chosen from records of MH families at the Royal Melbourne Hospital between 1977 and 2004. The majority were referred after an episode of possible MH and as far as possible these episodes were given a clinical grading score 7. Clinical details are outlined in Tables 1 and 2.

The method of contracture testing changed in 2001 to the EMHG IVCT(8). Prior to this the criteria for defining MHS were >0.2 g response to 2 mmol caffeine and a > 1 g response to aeration with carbogen bubbled through a saturated solution of halothane in water (RMH protocol). Four patients were included who had positive caffeine halothane contracture tests(9) performed in another institution. While most subjects were MHS according to the above criteria, we also included four malignant hyperthermia equivocal (MHE) subjects. MHE was defined according to the EMHG criteria regardless of the test method used, so that a result was considered MHE if they had a threshold response to caffeine or halothane but not both.

After appropriate provision of information and written consent, blood was collected and DNA extracted.

Mutation detection

Genomic DNA was extracted from unclotted blood using the Nucleon DNA extraction kit (Amersham Biosciences, U.K.). Amplification of genomic DNA was performed with a standard polymerase chain reaction (PCR) method using Hotstar TAQ (Qiagen, Valencia, CA), consisting of a denaturation at 95[degrees]C for 15 minutes, followed by 35 cycles of 95[degrees]C for 30 seconds, annealing at 55 or 59[degrees]C for 30 seconds (optimised for each primer pair), extension at 72[degrees]C for 90 seconds, with a final extension at 72[degrees]C for 10 minutes. The PCR mixture contained 50 ng DNA, 5 [micro]1 2 mM deoxyribonucleotide triphosphates (dNTPs) (lithium salts), 5 [micro]1 10x Hotstar Buffer, 3 or 5 [micro]1 additional 25 mM MgC[1.sub.2], 5 or 10 pmol of each primer (forward and reverse), 0.5 or 1 U Hotstar TAQ, in a final volume of 50 [micro]1. The exact composition of the PCR reaction mixture was optimised for each primer pair individually. Primer pairs were prepared for exons 1, 2, 3, 4-5, 6, 7, 8-9, 10-11, 12, 13, 14-16, 17, 18, 19, 20, 38, 39, 40-41, 42, 43, 44, 45, 46-47, 85-87, 98-99, 100-101, 102, 103-104 of the RYR1 gene which account for the 'hot-spots' of known MH causative mutations. Primer sequences are presented in Table 3.

The PCR products were sequenced in forward and reverse directions using the fluorescent DYEnamic ET dye terminator kit (Amersham Biosciences, U.K.). The sequencing PCR mixture contained 5 [micro]d of DNA product from the Hotstar amplification PCR, 4 [micro]1 ET Mix and 10 pmol of the same primer pairs used in the amplification PCR, in a final volume of 10 [micro]1. The reaction consisted of 35 cycles of 95[degrees]C for 20 seconds, 50[degrees]C for 15 seconds and 72[degrees]C for 120 seconds. The fluorescent products were purified using AutoSeg96 plates (Amersham Biosciences, U.K.) after the addition of 10 [micro]1 [H.sub.2]O to each well and sequenced on a MegaBACE 1000 (Molecular Dynamics, Sunnyvale, CA, U.S.A.). Electro-pherograms were analysed with Mutation Surveyor 3.01 software (SoftGenetics, State College, PA, U.S.A.).

Mutations were considered likely to be causative if the following criteria were met:

* An amino acid substitution was produced which substantially changed the polarity or the cross-linking ability of the amino acid residue in question.

* The amino acid residue changed by the mutation was preserved across vertebrate species down to at least mouse and rat.

* The mutation was not present in IVCT malignant hyperthermia negative (MHN) control samples from 100 unrelated individuals.

* The mutation segregated with MHS and MHN IVCT results, as known, within the appropriate family.

Despite meeting the above criteria, functional analysis of these novel mutations was beyond the scope of this project, so novel mutations cannot yet be proven as causative.

Haplotype analysis

Haplotype analysis was carried out using the chromosome 19 microsatellite repeat sequence markers D19S228, D19S557, D19S897, D19S421, D19S422, D19S881(10), flanking the RYR1 locus. The forward primer of each pair was fluorescently labelled with either 6-carboxy Fluorescein (FAM) or hexachloroFluorescein (HEX) and amplified using the same Hotstar TAQ PCR method as for mutation detection. The primer sequences are presented in Table 4.

The reactions were analysed on the MegaBACE 1000 using 550 6-carboxy-X-rhodamine (ROX) as size marker, using Fragment Profiler 1.2 software (Amersham, U.K.).

RESULTS

Mutation detection

Samples of genomic DNA from 38 individuals with known positive IVCTs (MHS or MHE) were sequenced over RYR1 exons 1 to 20, 38 to 47, 85 to 87, 98 to 104 covering the known hotspots. Seven different causative (as defined by EMHG) mutations were identified in nine individuals. In another six individuals, five different published but as yet functionally uncharacterised mutations were identified. Three further, as yet unpublished and functionally uncharacterised (novel), mutations were identified in four different samples. Two samples each contained two functionally uncharacterised mutations. The mutations are presented in Table 5. None of the mutations was observed in 100 unrelated MHN controls.

IVCT/Genetic concordance

One hundred percent concordance was achieved in all families included in the study as shown in Table 6. Some families had more than one member with an IVCT result to use for concordance measurement but in half of the cases only one individual in the family had been tested. It is in no way implied that these numbers represent statistically significant concordance for the families with more than one member studied, but the lack of discordance is satisfying when all the mutations identified are taken in to account.

The numbers of IVCTs that could have been or were avoided were recorded for all referred family members in Table 7.

Haplotype analysis

The six microsatellite markers flanking the RYR1 locus were used to determine the haplotypes of each of the families displaying identical mutations. The results are presented for families AH and M with the c.1615T>C mutation (Figure 1), families C and H with the c.7300G>A mutation (Figure 2) and families AD, I and F with the c.14210G>A mutation (Figure 3). Haplotypes were also determined for families AM and W with the c.487C>T mutation, although only a single individual from each family was available for testing.

[FIGURE 1 OMITTED]

[FIGURE 2 OMITTED]

[FIGURE 3 OMITTED]

Families AH and M displayed a common haplotype which clearly segregated with the mutation in both families (212, 144, 89, 191, 185, 136 for markers D19S228, D19S557, D19S897, D19S421, D19S422, D19S881 respectively). However, this was not the case for the two families displaying the c.7300G>A mutation, the haplotypes being 210, 136, 89, 193, 195, 136 for family C and 206, 136, 90, 189, 197, 134 or 138 for family H, respectively. The data for the c.14210G>A mutation in families F and I (who would be considered the same family except that family F has a second causative mutation on a different allele) when compared with family AD is inconclusive, as a common haplotype is possible for D19S557-D19S421, with a crossover between markers D19S421 and D19S422 and the possibility that the mutation may lie between D19S421 and the crossover point. Finally, for the mutation c.487C>T, although the available information is limited to a single member for each of families W and AM, a common haplotype is probable, the allele sizes being 208/210, 132/144, 96/96, 189/197, 195/195, 134/140 for family W and 206/210, 124/144, 89/96, 191/197, 195/195, 136/140 for family AM, respectively.

DISCUSSION

Sequencing of 'hot-spot' areas proved to be an effective, if somewhat limited, way of examining for RYR1 mutations. Sequencing has revealed a number of previously identified mutations as well as some novel mutations.

Sequencing of the RYR1 gene in our patients has identified several families displaying known MH causative mutations which are common in the European population; a single family each with c.1021G>A, c.1840C>T, c.6617C>T and two families each with c.487C>T and c.7300G>A mutations plus a single family with the less common c.7373G>A mutation. Although the limited information available from haplotype analysis indicates that the two families with c.487C>T may not be distinct, the two families with c.7300G>A do have clearly distinct haplotypes. In addition, we have found a single family with a c.742G>C which produces the same amino acid substitution as the known MH causative c.742G>A mutation described in several North American and UX families.

Six of our families display mutations which have been published but not yet functionally characterised, two families with c.14210G>A having similar haplotypes and one each with the c.529C>T, c.1201C>T and c.14477C>T mutations each of which have been observed in several European families and one with the c.677T>A which has been described in one Swiss family to date.

Two families in this study displayed the c.1615T>C novel mutation which segregated with MHS and MHN in both families. Haplotyping in these families revealed a common allele, indicating that these families are highly likely to be related, although the common forebear is unknown at this stage. This mutation produces a phenylalanine to leucine substitution at amino acid residue 539, six amino acids along from the published mutations c.1597C>T(20) and c.1598G>A(21), also located in exon 15. This region is highly conserved, being consistent right down to at least fish(22) (Figure 4, middle panel).

The novel mutation c.11798A>G in exon 86 codes for a tyrosine to cysteine substitution at amino acid 3933. Although this is not a well-known region for MH causative mutations, there have been reports of mutations in adjoining exons(13) and this is also a highly conserved region of RYR1 (Figure 4, lower panel). The closest reported mutation is from the French population, where a c.11748T>G mutation has been described(23), which produces an amino acid substitution 17 residues earlier.

The final novel mutation found in this study is in exon 2, being c.152C>A, coding for a threonine to asparagine substitution at residue 51, six amino acids after the cysteine(20) and histidine(13) substitutions described for arginine at residue 44, and also in a highly conserved region of the gene (Figure 4, upper panel). Interestingly, this mutation was found in a family in combination with the previously described c.677T>A mutation. As these mutations were observed together in two generations of MHS individuals in the pedigree, and therefore reside on the same allele, it is difficult to determine what effect this mutation may have on MH sensitivity without independent functional analysis. While it appears that the c.677T>A mutation alone is sufficient to confer the MHS phenotype, it is possible that the c.152C>A may also confer MHS status and that the compound heterozygote state may behave differently to c.677T>A alone, perhaps increasing sensitivity to MH triggers.

Like the study by Monnier et al we have also found at least one family with more than one independent causative mutation, occurring on separate alleles, reinforcing the EMHG guidelines for the use of genetic testing to diagnose MHS but not MHN(24). Family F demonstrates two mutations (c.14210G>A and c.14477C>T), which can be tracked to both of the parents of the MHS patient studied. This was discovered by two distinct episodes of clinical MH occurring in relatives of both parents of the index case in this family.

While mutation identification and analysis has been significant for those families who have a mutation identified, it still leaves 53% of families with no mutation identified. There are several possible reasons for this:

* We know that mutations exist in regions other than the 'hot-spots' of the RYR1 gene(13, 25, 26).

* Linkage analysis indicates a high likelihood of the involvement of several other genes in the pathogenesis of MH. These may include SCN4A (chromosome 17g11.2-g24)(27), CACNA1S (alpha 1A subunit, dihydropyridine receptor) on Chromosome 1q32(28, 29), CACNA2 (chromosome 7g21-q22)(30) and other genes located on chromosome 3 and 5 of the human genome. These were not analysed in this study.

* The quoted specificity of the IVCT using the EMHG protocol is 94%(31). The specificity of the IVCT in our laboratory is difficult to determine as there were two different methods of IVCT testing, but the possibility exists that in families with only one positive IVCT and a mild or atypical clinical story that there could have been a false positive result. It is also possible that our MHE subjects fall in to this category.

We were able to recruit 47 relatives of mutation positive probands for analysis. Twenty-one of these (45%) would have been able to be diagnosed as MHS by mutation analysis alone if all mutations are proven functional, resulting in a total saving of A$76,000--equating to a 22% reduction in costs (total cost of all having IVCT with no genetic testing available =A$340,000, total cost with genetic testing available and IVCT testing for probands and negatives =A$264,000). These figures are based on an initial IVCT cost of A$4000.00 (combining day stay, surgical and anaesthetic costs) at our institution, initial proband DNA sequencing costs of A$500.00 and further screening for known mutations at A$100.00 per person.

The MH status of a child under the age of 10 years was able to be determined in four cases. As muscle biopsy is not performed under the age of 10 years, genetic testing facilitated early diagnosis. In addition, the MH status of two elderly patients who refused muscle biopsy on the grounds of ill health was able to be determined and five patients residing in states with no IVCT Unit were diagnosed as MHS avoiding travel related expenses and major inconvenience. The cost savings for future genetic testing would be amplified for larger families and for those remote from IVCT testing centres.

[FIGURE 5 OMITTED]

[FIGURE 6 OMITTED]

A significant limitation of this study was the inclusion of only four MHE subjects (those with an IVCT responsive to caffeine or halothane but not both) as this is a problematic group of patients who need further definition in genetic analysis. Our follow up study sequencing the entire RYR1 using cDNA with the inclusion of more of our MHE subjects will aim to redress this limitation.

It may be significant that there is a higher mutation detection rate in those with more strongly positive contracture tests (Figures 5 and 6).

This may be a reflection of the highly sensitive but less highly specific dynamic test used for MHS diagnosis. Other potential explanations for this phenomenon are:

* Phenotypes with less strong contracture tests have mutations on other genes coding for different parts of the ryanodine receptor complex. Linkage studies in European and North American families have indicated that this may be one factor in the less than 100% mutation detection rate.

* There have been over 178 missense mutations(13) identified in all areas of RYR1. This project has been limited to the 'hot-spots'.

One of our secondary aims was to identify those mutations occurring more commonly in the Australian population. While further analysis of the RYR1 gene in patients not displaying a mutation in a 'hot-spot' region and RYR1 investigation of many more families will be needed to meet this aim, we have begun the process, which may help to decide on a limited screening test for RYR1 defects in MHS individuals in this country.

This project has achieved its aims of identifying mutations associated with MH and reducing the number of IVCTs required in those families for MHS diagnosis. We have also added to the pool of likely mutations in RYR1 related to MH.

The discovery of two mutations within one family has further emphasised the importance of only using genetic testing for diagnosis of MHS and not for MHN. Further analysis of the family with two possible causative mutations is required before any conclusions about compound heterozygosity can be made. This study has highlighted the need to functionally analyse new mutations so they can be added to the pool of mutations outlined by the EMHG and used for MH diagnosis. Future attempts at increasing the sensitivity of genetic testing should involve the study of other genes that code for proteins responsible for calcium channel activity as well as more detailed analysis of the RYR1 gene.

ACKNOWLEDGEMENTS

This project was funded in part by a grant-in-aid from the Australian and New Zealand College of Anaesthetists and supported by the Department of Anaesthesia and Pain Management at the Royal Melbourne Hospital. The authors would also like to thank the Murdoch Children's Research Institute and Victorian Genetic Health Services for the provision of facilities and clinical genetic advice essential for conducting this project.

Accepted for publication on January 10, 2008.

REFERENCES

(1.) Hopkins PM. Malignant Hyperthermia: advances in clinical management and diagnosis. Br J Anaesth 2000; 85:118-128.

(2.) Mickleson JR, Ross JA, Hyslop RJ, Gallant EM, Louis CE Skeletal muscle sarcolemma in malignant hyperthermia: Evidence for a defect in calcium regulation. Biochim Biophys Acta 1987; 897:364-376.

(3.) MacLennan DH, Duff C, Zorzato F, Fujii J, Phillips M, Korneluk RG et al. Ryanodine receptor gene is a candidate for predisposition to malignant hyperthermia. Nature 1990; 343:559-561.

(4.) McCarthy TV, Healy JM, Heffron JJ, Lehane M, Deufel T, Lehmann-Horn F et al. Localization of the malignant hyperthermia susceptibility locus to human chromosome 19g12-13.2. Nature 1990; 343:562-564.

(5.) Girard T, Treves S, Voronkov E, Siegemund M, Urwyler A. Molecular genetic testing for malignant hyperthermia susceptibility. Anesthesiology 2004; 100:1076-1080.

(6.) Urwyler A, Deufel T, McCarthy T, West S; European Malignant Hyperthermia Group. Guidelines for molecular genetic detection of susceptibility to malignant hyperthermia. Br J Anaesth 2001; 86:283-287.

(7.) Larach MG, Localio AR, Allen GC, Denborough MA, Ellis FR, Gronert GA et al. A clinical grading scale to predict malignant hyperthermia susceptibility. Anesthesiology 1994; 80:771-779.

(8.) A protocol for the investigation of malignant hyperpyrexia (MH) susceptibility. The European Malignant Hyperpyrexia Group.

(9.) Larach MG. Standardization of the caffeine halothane contracture test. Anesth Analg 1989; 69:511-515.

(10.) University of California, Santa Cruz (UCSC) Genome Browser on Human Mar. 2006 Assembly. From http://genome.ucsc.edu/ cgi-bin/hgTracks?org=human Accessed November 2007.

(11.) Quane KA, Healy JM, Keating KE, Manning BM, Couch FJ, Pahnucci LM et al. Mutations in the ryanodine receptor gene in central core disease and malignant hyperthermia. Nat Genet 1993; 5:51-55.

(12.) Monnier N, Kozak-Ribbens G, Krivosic-Horber R, Nivoche Y, Qi D, Kraev N et al. Correlations between genotype and pharmacological, histological, functional and clinical phenotypes in malignant hyperthermia susceptibility. Hum Mutat 2005; 26:413-425.

(13.) Robinson R, Carpenter D, Shaw M, Halsall J, Hopkins P Mutations in RYR1 in malignant hyperthermia and central core disease. Hum Mutat 2006; 27:977-989.

(14.) Gillard EF, Otsu K, Fujii J, Duff C, de Leon S, Khanna VK et al. Polymorphisms and deduced amino acid substitutions in the coding sequence of the ryanodine receptor (RYR1) gene in individuals with malignant hyperthermia. Genomics 1992; q.

(15.) Quane KA, Keating KE, Manning BM, Healy JM, Monsieurs K, Heffron JJ et al. Detection of a novel common mutation in the ryanodine receptor gene in malignant hyperthermia: implications for diagnosis and heterogeneity studies. Hum Mol Genet 1994; 3:471-476.

(16.) Davis M, Brown R, Dickson A, Horton H, James D, Laing N et al. Malignant hyperthermia associated with exercise-induced rhabdomyolysis or congenital abnormalities and a novel RYR1 mutation in New Zealand and Australian Pedigrees. Br J Anaesth 2002; 88:508-515.

(17.) Manning BM, Quane KA, Ording H, Urwyler A, Tegazzin V, Lehane M et al. Identification of novel mutations in the ryanodine-receptor gene (RYR1) in malignant hyperthermia: genotype-phenotype correlation. Am J Hum Genet 1998; 62:599-609.

(18.) Keating KE, Quane KA, Manning BM, Lehane M, Hartung E, Censier K et al. Detection of a novel RYR1 mutation in four malignant hyperthermia pedigrees. Hum Mol Genet 1994; 3:1855-1858.

(19.) Brown RL, Pollock AN, Couchman KG, Hodges M, Hutchinson DO, Waaka R et al. A novel ryanodine receptor mutation and genotype-phenotype correlation in a large malignant hyperthermia New Zealand Maori pedigree. Hum Mol Genet 2000; 9:1515-1524.

(20.) Tammaro A, Bracco A, Cozzolino S, Esposito M, Di Martino A, Savoia G et al. Scanning for mutations of the ryanodine receptor (RYR1) gene by denaturing HPLC: detection of three novel malignant hyperthermia alleles. Clin Chem 2003; 49:761-768.

(21.) Brandt A, Schleithoff L, Jurkat-Rott K, Klingler W, Baur C, Lehmann-Horn E Screening of the ryanodine receptor gene in 105 malignant hyperthermia families: novel mutations and concordance with the in vitro contracture test. Hum Mol Genet 1999; 8:2055-2062.

(22.) University of California, Santa Cruz (UCSC) Vertebrate Multiz Alignment & PhastCons Conservation. From http://genome. ucsc.edu/cgi-bin/hgGateway?org=Human&db=hg18 Accessed November 2007.

(23.) Monnier N, Krivosic-Horber R, Payen JF, Kozak-Ribbens G, Nivoche Y, Adnet P et al. Presence of two different genetic traits in malignant hyperthermia families. Anesthesiology 2002; 97:1067-1074.

(24.) European Malignant Hyperthermia Group - List of Causative Mutations compiled by T Girard. From http://www.emhg.org/ index.php?option=com_ryrl&Itemid=66 Accessed November 2006.

(25.) Sambuughin N, Holley H, Muldoon S, Brandom BW, de Bantel AM, Tobin JR et al. Screening of the entire ryanodine receptor type 1 coding region for sequence variants associated with malignant hyperthermia susceptibility in the north american population. Anesthesiology 2005; 102:515-521.

(26.) XXIV Annual Meeting of the European Malignant Hyperthermia Group. Mainz, Germany. May 19-21, 2005 Report of scientific meeting. Anesthesiology 2005;103 no. 6.

(27.) Olckers A, Meyers DA, Meyers S, Taylor EW, Fletcher JE, Rosenberg H et al. Adult muscle sodium channel alpha-subunit is a gene candidate for malignant hyperthermia susceptibility. Genomics 1992; 14:829-831.

(28.) Robinson RL, Monnier N, Wolz W, Jung M, Reis A, Nuernberg G et al. A genome wide search for susceptibility loci in three European malignant hyperthermia pedigrees. Hum Molec Genet 1997; 6:953-961.

(29.) Monnier N, Procaccio V, Steiglitz P, Lunardi J. Malignant hyperthermia susceptibility is associated with a mutation of the alpha 1 subunit of the human dihydropyridine-sensitive L-type calcium channel receptor in skeletal muscle. Am J Hum Genet 1997; 60:1316-1325.

(30.) Iles DE, Lehmann-Horn F, Scherer SW, Tsui LC, Olde Weghuis D, Suijkerbuijk RF et al. Localization of the gene encoding the alpha-2/delta-subunits of the L-type voltage-dependent calcium channel to chromosome 7q and analysis of the segregation of flanking markers in malignant hyperthermia susceptible families. Hum Molec Genet 1994; 3:969-975.

(31.) Ording H, Brancadoro V, Cozzolino S, Ellis FR, Glauber V, Gonano EF et al. In vitro contracture test for diagnosis of malignant hyperthermia following the protocol of the European MH Group: results of testing patients surviving fulminant MH and unrelated low-risk subjects. The European Malignant Hyperthermia Group. Acta Anaesthesiol Scand 1997; 41:955-966 .

(32.) MacLennan DH. Ca2+ signalling and muscle disease. Eur J Biochem 2000; 267:5291-5297.

(33.) Lynch PJ, Krivosic-Horber R, Reyford H, Monnier N, Quane K, Adnet P et al. Identification of heterozygous and homozygous individuals with the novel RYR1 mutation Cys35Arg in a large kindred. Anesthesiology 1997; 86:620-626.

(34.) Galli L, Orrico A, Cozzolino S, Pietrini V, Tegazzin V, Sorrentino V Mutations in the RYR1 gene in Italian patients at risk for Malignant Hyperthermia: evidence for a cluster of novel mutations in the C-terminal region. Cell Calcium 2002; 32:143-151.

(35.) Tong J, Oyamada H, Demaurex N, Grinstein S, McCarthy TV, MacLennan DH. Caffeine and halothane sensitivity of intracellular Ca2+ release is altered by 15 calcium release channel (ryanodine receptor) mutations associated with malignant hyperthermia and/or central core disease. J Biol Chem 1997; 272:26332-26339.

(36.) Rueffert H, Olthoff D, Deutrich C, Meinecke CD, Froster UG. Mutation screening in the ryanodine receptor 1 gene (RYR1) in patients susceptible to malignant hyperthermia who show definite IVCT results: identification of three novel mutations. Acta Anaesthesiol Scand 2002; 46:692-698.

R. L. GILLIES *, A. R. BJORKSTEN ([dagger]), M. DAVIS ([double dagger]), D. DU SART ([section])

Department of Anesthesia and Pain Management, Royal Melbourne Hospital, Parkville and Victorian Clinical Genetics Services Murdoch Children's Research Institute Melbourne Victoria, Australia

* M.B., B.S.(Hons.), F.A.N.Z.C.A., Head of Malignant Hyperthermia Diagnostic Unit, Royal Melbourne Hospital.

([dagger]) Ph.D., Medical Scientist, Department of Anaesthesia and Pain Management.

([double dagger]) Ph.D. (Distinction), F.H.G.S.A., Senior Medical Scientist, Department of Anatomical Pathology, Royal Perth Hospital, Perth, Western Australia.

([section]) Ph.D., F.H.G.S.A., Director, Molecular Genetics Laboratory, Victorian Clinical Genetics Services.

No reprints will be available from the authors. Electropherograms will be available from the authors upon request.
FIGURE 4: Conservation of the 20 amino acid residues on either side of
the three novel mutations in RYR1 across species using the University
of California, Santa Cruz (USCS) Multiz Alignment and PhastCons
Conservation tools. The amino acid in bold is the novel mutation and
other known MH causative mutations shown by residue number (15).
Species included are human (Homo sapiens: hgl8), rhesus (Macaca
mulatta: rheMac2), mouse (Mus musculus: mm8), dog (Canis familiaris:
canFam2), horse (Equus caballus: equCabl), platypus (Ornithorhynchus
anatinus: ornAnal), lizard (Anolis carolinensis: anoCarl),
stickleback (Gasterosteus aculeatus: gasAcul).

Exon 2 p.T51N p.C35R

Human Q L K L C L A A
Rhesus Q L K L C L A A
Mouse Q L K L C L A A
Do Q L K L C L A A
Horse Q L K L C L A A
Platypus Q Q K L C L A A
Lizard Q L K L C L A T
Stickleback I K L C L S C

Exon 15 p.F539L p.Y522S, C

Human N L L Y E L L A
Rhesus N L L Y E L L A
Mouse N L L Y E L L A
Horse N L L Y E L L A
Platypus N S L Y E L L A
Lizard N L L Y E L L A
Stickleback N L L Y E L L A

Exon 86 p.Y3933C p.I3916M

Human N I I I C T V D
Rhesus N I I I C T V D
Mouse N I I I C T V D
Do N I I I C T V D
Horse N I I I C T V D
Platypus N I I I S T V D
Lizard N I I I C T V D
Stickleback N I I I C T V D

Exon 2 p.T51N p.R44C

Human E G F G N R L
Rhesus E G F G N R L
Mouse E G F G N R L
Do E G F G N R L
Horse E G F G N R L
Platypus E G F G N R L
Lizard E G F G N R L
Stickleback E G F G N R L

Exon 15 p.F539L p.R530H p.R533C

Human S L I R G N R
Rhesus S L I R G N R
Mouse S L I R G N R
Horse S L I R G N R
Platypus A L I R G N R
Lizard S L I R G N R
Stickleback A L I R G N R

Exon 86 p.Y3933C

Human Y L L R L Q E
Rhesus Y L L R L Q E
Mouse Y L L R L Q E
Do Y L L R L Q E
Horse Y L L R L Q E
Platypus Y L L R L Q E
Lizard Y L L R L Q E
Stickleback Y L L R L Q E

Exon 2 p.T51N p.T51N

Human C F L E P T S N A
Rhesus C F L E P T S N A
Mouse C F L E P T S N A
Do C F L E P T S N A
Horse C F L E P T S N A
Platypus C F L E S T S N S
Lizard C T L E P T S N A
Stickleback C F L E T T S N A

Exon 15 p.F539L p.F539L

Human S N C A L F S T N
Rhesus S N C A L F S T N
Mouse T N C A L F S T N
Horse T N C A L F S N N
Platypus L N C A Q F S G S
Lizard S N C A L F S N N
Stickleback S N C A L F C D N

Exon 86 p.Y3933C p.Y3933C

Human S I S D F Y W Y Y
Rhesus S I S D F Y W Y Y
Mouse S I S D F Y W Y Y
Do S I S D F Y W Y Y
Horse S I S D F Y W Y Y
Platypus S I S D F Y W Y Y
Lizard S I S D F Y W Y Y
Stickleback S I S D F Y W Y Y

Exon 2 p.T51N p.D60N

Human Q N V P P D L A I
Rhesus Q N V P P D L A I
Mouse Q N V P P D L A I
Do Q N V P P D L A I
Horse Q N V P P D L A I
Platypus Q N V P P D L S I
Lizard Q K V P P D L A I
Stickleback L N V P P D L A I

Exon 15 p.F539L

Human L D W L V S K L D
Rhesus L D W L V S K L D
Mouse L D W L V S K L D
Horse L D W L V S K L D
Platypus L D W L I S R L E
Lizard L D W L V S K L D
Stickleback L D W L V S K L D

Exon 86 p.Y3933C

Human S G K D V I E E Q
Rhesus S G K D V I E E Q
Mouse S G K D V I E E Q
Do S G K D V I E E Q
Horse S G K D V I E E Q
Platypus S G K D V I E E Q
Lizard S G K D V I E E E
Stickleback S G K D I I D G P

Exon 2 p.T51N

Human C C F V L E Q S
Rhesus C C F V L E Q S
Mouse C C F I L E Q S
Do C C F V L E Q S
Horse C C F V L E Q S
Platypus C T F V L E Q S
Lizard C C F S L E Q S
Stickleback C S F V L V Q S

Exon 15 p.F539L p.R552W

Human R L E A S S G I
Rhesus R L E A S S G I
Mouse R L E A S S G I
Horse R L E A S S G I
Platypus R L E A S S G I
Lizard R L E A S S G I
Stickleback R L E A S S G I

Exon 86 p.Y3933C

Human G K R N F S K A
Rhesus G K R N F S K A
Mouse G K R N F S K A
Do G K R N F S K A
Horse G K R N F S K A
Platypus G Q R N F S K A
Lizard G K R N F S K A
Stickleback G K R N F S K A

TABLE 1
Clinical details of index cases of each of the families in whom a
causative of putative causative mutation was found

Proband Family Clinical Number of MH Other
number code grading of positive status clinical notes
 IVCT
 MH episode in family

7321 A 50 1 MHS
7294 B 25 2 MHS
8370 C 1 MHS Death post GA
 in family
7380 D 43 4 MHS Death post GA
 in family
28603 E 32 1 MHS 32
8547 F 5 MHS Multiple MH
 episodes in
 family
7289 G 2 MHS
8318 H 35 1 MHS 35
7880 I 1 MHS Multiple MH
 episodes in
 family
28171 M 45 1 MHS
30274 0 38 2 MHS
30651 V 58 1 MHS
31303 W 6 MHS 1 MH episode
 and multiple
 MHS by IVCT
 in family
28234 AD 1 MHS Post op
 rhabdomyolysis
7370 AK 35 1 MHS 35
31304 AH 60 1 MHS 60
32810 AM 3 MHS 3 positive IVCT
 in family
8003 AC 50 1 MHS MH episode

Proband Year IVCT (2% IVCT IVCT Test
number of halothane) (2 mmol halothane protocol
 test caffeine) (bubbled
 or 3%)
7321 2001 1.2 g 1.3 g * EMHG
7294 1985 NA 2.7 g >1g ** RMH
8370 2003 1.85 g 2.5 g EMHG

7380 2001 0.45 g 2.15 g EMHG

28603 2000 NA 3 g >2g RMH
8547 1995 NA 1.2 g >2g *** CHCT

7289 2001 0.9 g 1.95 g EMHG
8318 2002 1.05 g 5.7 g EMHG
7880 2002 0.5 g 0.45 g EMHG

28171 1997 NA 1.3 g >2g RMH
30274 1996 NA 1.0 g >1.5 g RMH
30651 1997 NA 1.9 g >2g RMH
31303 2002 2.3 g 1.4 g EMHG

28234 2004 1.2 g 3.5 g EMHG

7370 2001 0.9 g 1.6 g EMHG
31304 2002 4 g 1.7 g EMHG
32810 1996 NA 2.5 g >5 g CHCT

8003 2002 1.1 g 0.6 g EMHG

* EMHG=European Malignant Hyperthermia Group IVCT protocol,
** RMH=RMH protocol, ***CHCT=caffeine halothane contracture
test. (See text for other abbreviations).

TABLE 2
Clinical details of index cases of each of the families in whom no
mutation has been found as yet

Proband Family Number of MH Other clinical notes
number code positive status
 IVCT
 in family

30524 AB 1 MHE Clinical grading=23 (4)

8469 AE 1 MHS Masseter spasm and
 2 previous 'difficult
 anaesthetics', stiff baby

8546 AF 1 MHS Death in family ?MH

25077 AG 1 MHS EIR

28635 AI Isolated high temp PO

31052 AJ 1 MHS High CK and
 myonecrosis PO

31842 AL 3 MHS

9341 J 1 MHS Death in family ?MH

9020 K 1 MHS High temp, hypoxia,
 hyperpnoea PO

31301 L 1 MHS High temp, tachycardia
 and hypoxia PO

31344 N 1 MHE Rhabdomyolysis, high CK

8274 P 1 MHS Clinical grading=30 (4)

30593 Q 4 MHE Death in family and 3
 other MHS

31305 R 1 MHS 1st degree relative MHS

9098 S 11 MHS 5 MH deaths in family

25088 T 2 MHE 1st degree relative MHS
 post viral myoglobinuria

7935 U 1 MHS Death in family ?MH

31302 X 3 MHS 2 other positive family
 members

7284 Y 1 MHS High CK and
 myonecrosis PO

31300 Z 3 MHS 2 other positive family
 members

Proband IVCT (2% IVCT (2 mmol Year IVCT Test
number halothane) caffeine) of test (bubbled protocol
 halothane)

30524 0.15 g 0.3 g 2005 EMHG

8469 0.45 g 0.5 g 2003 EMHG

8546 0.6 g 0.3 g 2002 EMHG

25077 0.2 g 0.3 g 2003 EMHG

28635 0.6 g 0.3 g 2004 EMHG

31052 1.5 g 0.6 g 2005 EMHG

31842 2.5 g 1993 >1g RMH

9341 1.0 g 0.5 g 2002 EMHG

9020 0.75 g 0.25 g 2003 EMHG

31301 0.65 g 2001 >1g

31344 0.1 g 0.2 g 2005 EMHG

8274 1.4 g 1.6 g 2003 EMHG

30593 NA 0.15 g 1982 0.4 g CHCT

31305 NA 0.3 g 2001 >1g RMH

9098 NA 1.0 g 1987 >1g

25088 NA 0.15 g 1991 0.55 g CHCT

7935 NA 1.6 g 1986 >1g CHCT

31302 NA 0.6 g 2002 1.0 g EMHG

7284 NA 0.5 g 1992 >1g RMH

31300 0.4 g 0.3 g 2001 EMHG

** European Malignant Hyperthermia Group IVCT protocol, ** RMH
protocol, *** caffeine halothane contracture test, PO=post-operative.
(See text for other abbreviations). EIR = excercise induced
rhabdomyolysis. IVCT = in vitro contracture test

TABLE 3
Primer sequences for ranodyne receptor (RYR1) from genomic DNA

Exon Forward primer sequence

1 TGTAAAACGACGGCCAGTCGGGTGCCTCTGGTGTCT

2 GGCCTGTGGTCTGCAGTATT

3 TGTAAAACGACGGCCAGTGTGGCAGGGAATGTTGCT

4-5 TGTAAAACGACGGCCAGTACCTGTGACTAGGCCAGACC

6 GGAAATGGGAAATTGGGAGT

7 TGTAAAACGACGGCCAGTACCCTTGATTTCTGGCCTCT

8-9 CAGAGAGTTGGTGGCAGTGA

10-11 GACTGTAATGTCCATGGGAG

12 GGCAAGTGCAGAACTCAAGTC

13 TGTAAAACGACGGCCAGTGAGTGAGGTTGCGGCAGT

14-16 TTCGTGAATCCAAGAAAGACA

17 TCCACTTTCACCACCTCCTC

18 TGTAAAACGACGGCCAGTCTCTGGCTTCCCACCACTT

19 CCACAGGAGCCTCCAATATC

20 TGTAAAACGACGGCCAGTCATTGATCCCAGGACTGCTT

38 TGTAAAACGACGGCCAGTCCACTGCAACAGAACAAGACA

39 TTCACATTGTTCTGGTCCAA

40-41 TGTAAAACGACGGCCAGTTGTCACAGTGGTGGCTATGG

42 GTGGTCAGGGAGGGCTTC

43 TGTAAAACGACGGCCAGTCTCTGACAGGACCAGGGCTA

44 AGACCCCCTTTCCCCATGC

45 TGCCTCCCCAACCCACCCACCTTC

46-47 CCTGCTCTACCCTCCTGTGT

85-87 CCCACTGTTCATCTCCCCTA

98-99 GAGTTTGGAGTGTCCCCAGA

100- CTCCAGAGTGCTCCTCGTGT

101

102 CAGGAAACAGCTATGACCCCTGGGCCTGCATTCTTAG

103- AAGCCCTGGAGGTAGGTAGC

104

Exon Reverse primer sequence

1 CAGGAAACAGCTATGACCCCGGACAGGGACATTCAG

2 TCCTGTCAGCACCTCGTTC

3 CAGGAAACAGCTATGACCCACCGTGCCCTAAACGAC

4-5 CAGGAAACAGCTATGACCGGCGTTCTGCAGACCTTCTA

6 GGAAATGGGAAATTGGGAGT

7 CAGGAAACAGCTATGACCGTATGCCTGAAGGGCAACAT

8-9 GCCCCTGACTTCATCTTGG

10-11 ACTGCAGCCTTGACCTCCT

12 TGGGCAACAGAGGTAGAGATG

13 CAGGAAACAGCTATGACCCAGACCCTACTTCCCCAGGT

14-16 GGAAGTGAGGGAGTGAGCA

17 GGGGTGGGAGATTAAGGAAA

18 CAGGAAACAGCTATGACCAACCCCAAGGTGTATGGTCA

19 GGTGAGCTAGCCATCGAGAG

20 CAGGAAACAGCTATGACCATTACAGGCATGAACGATGG

38 CAGGAAACAGCTATGACCTCTGTCCTCATGCCCTCTTT

39 GGTGAGCTAGCCATCGAGAG

40-41 CAGGAAACAGCTATGACCAGTGAGCTGGTGGAAAGTGG

42 GAATCAGCAGGTGTCCCAAG

43 CAGGAAACAGCTATGACCGTCATCTCGAGGGAGGTGTG

44 GCGGGTTGCCCTATTGAG

45 TGCCTGCCCTCCCTTCCCATCCTG

46-47 GCTCTACCGTGACCCATCTC

85-87 GGCAAGACTTGGAAATGGAC

98-99 AGGGTCCCAGGAGTCATTCT

100- CGGCCTGGAGGTACCATTA

101

102 CAGGAAACAGCTATGACCCCTGGGCCTGCATTCTTAG

103- TGGACACTACACCCCCTTTC

104

TABLE 4

Primer sequences used for haplotyping of chromosome 19

Marker Forward primer sequence

D19S228 AGCTAATATGGCAGAATCTTGAC

D19S421 AGCCCTTGCTGGTTTATG

D19S422 AGCTATGATCTCACCACTGTA

D19S557 GAGATCAAGCCCAGGCAAC

D19S881 TGAGATCACACGCCACTGC

D19S897 AGGATTTCCCCAACAGC

Marker Reverse primer sequence 5' label

D19S228 GCAGGATCGCAGTGCTT HEX

D19S421 GAGCCTGTGGTGGAGC FAM

D19S422 CAGCATTTTGCCAGACTT FAM

D19S557 AGCTGTGTTCATTCCCTTGG HEX

D19S881 CTCTGCCCAGCCACAAAGGT HEX

D19S897 TGCACATTACAGTGTGAGACAG FAM

TABLE 5
EMHG causative and putative novel ranodyne receptor (RYR1) mutations

DNA Family Mutation Exon Amino acid Ref EMHG
sample code change causative

30651 V c.152C>A 2 p.T51N

32810 AM c.487C>T 6 p.R163C 11 Yes

31303 W c.487C>T 6 p.R163C 11 Yes

30274 0 c.529C>T 6 p.R177C 12

30651 V c.677T>A 8 p.M226K 13

7289 G c.742G>C 9 p.G248R 14 Yes

7380 D c.1021G>A 11 p.G341R 15 Yes

7294 B c.1201C>T 12 p.R401C 16

31304 AH c.1615T > C 15 p.F539L

28171 M c.1615T > C 15 p.F539L

8003 AC c.1840C>T 17 p.R614C 15 Yes

7321 A c.6617C>T 40 p.T2206M 17 Yes

8370 C c.7300G>A 45 p.G2434R 18 Yes

8318 H c.7300G>A 45 p.G2434R 18 Yes

28603 E c.7373G>A 46 p.R2458H 17 Yes

7370 AK c.11798A>G 86 p.Y3933C

28234 AD c.14210G>A 98 p.R4737Q 1,213

7880 1 c.14210G>A 98 p.R4737Q 1,213

8547 F c.14210G>A 98 p.R4737Q 1,213

8547 F c.14477C>T 100 p.T42861 19

TABLE 6
Concordance--RYR1 sequencing and in vitro contractivetest (IVCT) results

Family Mutation Number Mutation Mutation Concordance
code of IVCT (-) (+)

V c.677T>A 100%

 2 2

V c.152C>A

AM c.487C>T 1 1

W c.487C>T 1 1

O c.529C>T 2 0 2

G c.742G>C 3 1 2 100%

D c.1021G>A 7 3 4 100%

B c.1201C>T 4 2 2 100%

AH c.1615T>C 1 1 100%

M c.1615T>C 1 1

AC c.1840C>T 1 1

A c.6617C>T 6 5 1

C c.7300G>A 1 1 100%

H c.7300G>A 3 2 1

E c.7373G>A 1 1

AK c.11798A>G 1 1

AD c.14210G>A 1 1

I c.14210G>A 3 2 1

F c.14210G>A 3

 5
F c.14477C>T 2 2 100%

TABLE 7

Reduction of in vitro contracture tests (IVCTs) required
for MH diagnosis

Number of biopsies required Mutation testing No mutation testing
 available available

Initial IVCT 38 38

IVCT required 26 * 47

Total 64 85

* Negative for familial mutation.
COPYRIGHT 2008 Australian Society of Anaesthetists
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2008 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Gillies, R.L.; Bjorksten, A.R.; Davis, M.; Du Sart, D.
Publication:Anaesthesia and Intensive Care
Geographic Code:8AUST
Date:May 1, 2008
Words:7376
Previous Article:Intra-ocular pressure changes associated with intubation with the intubating laryngeal mask airway compared with conventional laryngoscopy.
Next Article:Haemodynamic and Bispectral index response to insertion of the Streamlined Liner of the Pharynx Airway (SLIPA[TM]): comparison with the laryngeal...
Topics:


Related Articles
New tests urged for breast cancer gene mutations.
Predicting Lynch syndrome propensity to cancer: two new models help sort out which patients need extensive genetic testing for the hereditary...
Genetic mutation linked to hereditary neuroendocrine tumour identified.
Array-based resequencing assay for mutations causing hypertrophic cardiomyopathy.
Methodologic European external quality assurance for DNA sequencing: the EQUALseq program.
Novel technique for scanning of codon 634 of the RET protooncogene with fluorescence resonance energy transfer and real-time PCR in patients with...
Use of constant denaturant capillary electrophoresis of pooled blood samples to identify single-nucleotide polymorphisms in the genes (Scnn1a and...
Genetic mutations of butyrylcholine esterase identified from phenotypic abnormalities in Japan.
BRCA1 mutation testing: controversies and challenges.

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |