Printer Friendly

Identification of conserved domains and motifs for TaWdhn13 gene in Triticum aestivum by in silico analysis.

Introduction

Bioinformatics is an interdisciplinary research area, which may be defined as the interface between biological and computational sciences. It greatly helps in management of complex and scattered biological data, sequence analysis, algorithmic designing [7]. Domains, traditionally known as structurally independently folding units, are conserved functional units that may contain or more motifs. Domains are functional structural units. These units are conserved at the level of sequence and structure. Motifs are conserved across proteins at the level of sequence or structure or both. They include both short stretches of fixed residue length that act as sites for post-translational modification, phosphorylation, and longer sequence that form secondary structure for protein-DNA, protein-ion or protein-lipid interaction [7, 9]. TaWdhn13 gene has a crucial role as the cold-acclimation process in the wheat. TaWdhn13 gene is transcriptionally activated and produces the accumulated proteins and metabolites and protection cell structure from freezing damage [1]. In this study, we identify and characterize the conserved domain and motifs of TaWdhn13 gene.

Methods:

Download sequence:

Download the complete sequence for TaWdhn13 gene (with accession number: AB297677) in the NCBI database.

Identification of the conserved domain:

To identify conserved domain, we used the Conserved domain database (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.c gi).

Identification of the motifs in TaWdhn13 gene:

To analyze the nucleotide sequence we searched for the motifs and the motif search software (http://www.genome.jp/tools/motif) was used to identify the motifs in nucleotide sequence.

Results and Discussion

Conserved domain:

Our results showed TaWdhn13 conserved domain incudes: Dehydrin superfamily (Fig. 1).

Motif structure:

In silico analysis showed the motif structure for this gene includes (Table 1 and Fig. 2):

a) 2FE-2S_FER_1 Motif, or ferredoxins, iron-sulfur binding region signature. Motif 2Fe-2S is a structural motif, from the comparison of the coding proteins between rice and spinach chlorine monooxygenase (CMOs), rice CMO potentially shares two conservative motifs including a Rieske-type [2Fe-2S] [5] cluster and a mononuclear non-heme Fe binding sequence. These motifs are considered to be essential for the function of CMO [13].

b) INTEGRIN_BETA Motif. Integrins are expressed on the cell surface as a noncovalently linked heterodimer consisting of [alpha] and [beta] subunit, which conveys specificity in cell-cell adhesion, cell-extracellular matrix (ECM) adhesion, immune cell recruitment, extravasation, and signaling [10].

c) CTCK_1 Motif or C-terminal cystine knot signature. The cystine-knot motif, made up of three intertwined disulfide bridges, is a unique feature of several toxins, cyclotides and growth factors, and occurs in a variety of species, including fungi, insects, molluscs and mammals [4].

d) ANAPHYLATOXIN_1 Motif. In the mammalian cell, Anaphylatoxins are able to trigger j) degranulation (release of substances) of endothelial cells, mast cells or phagocytes, which produce a local inflammatory response [17].

e) AGOUTI_1 Motif. The AGOUTI_1 Motif is a signaling motif and normally expressed in skin cells and interacts with the first melanocortin receptor (MCR1) to control pigmentation [9].

f) IGFBP_N_1 Motif. Insulin-like growth factor (IGF) 1-binding proteins (IGFBPs) are a group of six homologous, yet distinct proteins (IGFBPs1-6) which bind both IGF-I and IGF-II with high affinity [16].

g) VWFC_1 Motif. VWFC motif has conserved cysteine which was found in many cereal crops like rice [8].

h) EGF_1 Motif. The EGF_1 motif or EGF-like domain signature 1 is an evolutionary conserved protein domain, which derives its name from the epidermal growth factor where it was first described. It comprises about 30 to 40 amino-acid residues and has been found in a large number of mostly animal proteins [15].

i) DEFENSIN Motif. Defensins motifs are small Cysteine-rich cationic proteins found in both vertebrates and invertebrates. They have also been reported in plants. They are, and function as, host defense peptides. They are active against bacteria, fungi and many enveloped and nonenveloped viruses [18].

Discussion:

This computational analysis focuses on identified a number of motifs structure and conserved domains in TaWdhn13 gene. In silico analysis provides an efficient way to indicating motifs sequence and conserved domains in genome [11,12]. However, by using the in silico analysis we can predicating and identified the motifs structure and conserved domain in gene sequence.

In this study a total of 9 motifs structure and one conserved domain identified in TaWdhn13 gene sequence.

Conclusion:

Our results showed in TaWdhn13gene, motifs structure includes: 2FE2S_FER_1 Motif, INTEGRIN_BETA Motif, CTCK_1 Motif, ANAPHYLATOXIN_1 Motif, AGOUTI_1 Motif, IGFBP_N_1 Motif, VWFC_1 Motif, EGF_1 Motif and DEFENSIN Motif. Also conserved domain in this gene include: Dehydrin superfamily.

References

[1.] Kobayashi, F., M. Ishibashi, S. Takumi, 2012. Transcriptional activation Cor/Lea genes and increase stress tolerance through expression of a wheat DREB2 homolog in transgenic tobacco. Transgenic Research, 17(5): 755-767.

[2.] Zhengxin, C.H., 2012. Development of a Database Course for Bioinformatics. Procedia Computer Science, 9: 532-539.

[3.] Mario, C., W. Rodrigo, S. Joakim, 2012. Biomedical and Bioinformatics Challenges to Computer Science. Procedia Computer Science, 1: 931-933.

[4.] Shalini, L., K.R. Acharya, 2011. Tying the knot the cystine signature and molecular-recognition processes of the vascular endothelial growth factor family of angiogenic cytokines. FEBS Journal., 278: 4304-4322.

[5.] Marwa, N.M.E., A.A. E-seuodi, A.A. Abd-Elhady, S.E.A. Edris, N.R. Abdelhamid, A.H.M. Hassan, 2011. Utilization of Some EST Derived SSR Markers to Detect Glutenin Gene Loci in Wheat. Journal of Applied Sciences Research, 7(12): 2147-2155.

[6.] Ti-Cao, Z., Q. Qiao, Y. Zhong, 2012. Detecting adaptive evolution and functional divergence in aminocyclopropane-1-carboxylate synthase (ACS) gene family. Computional Biology and chemistry, 38: 10-16.

[7.] Cannataro, M., R.W. dos Santos, J. Sundnes, 2009. Bioinformatics' challenges to computer science: Bioinformatics tools and biomedical modeling,in: G. Allen, J. Nabrzyski, E. Seidel, G. D. van Albada, J. Dongarra, P. M. A. Sloot (Eds.), ICCS (1), Vol. 5544 of Lecture Notes in Computer Science, Springer, pp: 807-809.

[8.] Fan, C.H., Y.Z. Xing, H.L. Mao, T.T. Lu and B. Han, 2006. GS3, a major QTL for grain length and weight and minor QTL for grain width and thickness in rice, encodes a putative transmembrane protein. Theor. Appl. Genet., 112: 1164-1171.

[9.] McNulty, J.C., P.J. Jackson, D.A. Thompson, B. Chai, I. Gantz, G.S. Barsh, P.E. Dawson and G.L. Millhauser, 2005. Structures of the agouti signaling protein. J Mol Biol., 346: 1059-1070.

[10.] Adam, L.F., K. Heidi, C. Tresa, 2004. Cellular integrins function as entry receptors for human cytomegalovirus via a highly conserved disintegrin-like domain. PANS, 101: 15470-15475.

[11.] Zhu, J.K., 2002. Salt and drought stress signal transduction in plants. Annu. Rev. Plant. Biol., 53: 247-273.

[12.] Lloyd, G., P. Landini, S. Bushby, 2001. Activation and repression of transcription initiation in bacteria. Essays Biochem., 37: 17-31.

[13.] Gray, J., P.S. Close, S.P. Briggs, G.S. Johal, 1997. A novel suppressor of cell death in plants encoded by the Lls1 gene of maize. Cell, 89: 25-31.

[14.] Rathinasabapathi, B., M. Burnet, B.L. Russell, D.A. Gage, P.C. Liao, G.J. Nye, P. Scott, J.H. Golbeck, A.D. Hanson, 1997. Choline monooxygenase, an unusual iron-sulfur enzyme catalyzing the first step of glycine betaine synthesis in plants: prosthetic group characterization and cDNA cloning. Proc Natl Acad Sci USA., 94: 3454-3458.

[15.] Downing, A.K., V. Knott, J.M. Werner, C.M. Cardy, I.D. Campbell, P.A. Handford, 1996. Solution structure of a pair of calcium-binding epidermal growth factor-like domains: implications for the Marfan syndrome and other genetic disorders. Cell., 85(4): 597-605.

[16.] Rechler, M.M., 1995. In Molecular Endocrinology: Basic Concepts and Clinical Correlations (Weintraub, B. D., ed) pp. 155-180, Raven Press, Ltd., New York

[17.] Hugli, T.E., 1986. Biochemistry and Biology of Anaphylatoxins. Complement., 3(3): 111-27.

[18.] Selsted, M.E., S.S. Harwing, T. Ganz, J.W. Schiling and R.I. Lehrer, 1985. Primary structure of three human neutrophil defensins. J.Clin. Invest., 76: 1436-1439.

(1) Hassan Rasouli, (1) Danial Kahrizi, (2) Parivash Ghadernia

(1) Agronomy and Plant Breeding and Biotechnology Department (APBBD), College of Agriculture and Natural Resources, Razi University, Kermanshah, Iran.

(2) Department of Microbiology in Bruojerd Islamic Azad University

Corresponding Author

Hassan Rasouli, Agronomy and Plant Breeding and Biotechnology Department (APBBD), College of Agriculture and Natural Resources, Razi University, Kermanshah, Iran.

Tell: +989385436058

E-mail address: hassanrasouli1978@yahoo.com

Table 1: Location and sequence to identified motifs in the
TaWdhn13 gene.

Motif             Motif       Sequence                  Symbol
                  location

2FE-2S FER 1      1491..149   CAGGTCGGC                   A
Motif             9           CTAGTCGGC
                  1579..158   CTGGACAGC
                  7
                  2123..213
                  1
INTEGRIN_BETA     856..870    CCGCCGCCTCCTCCC             B
Motif             1771..178   CAGGGGCACGGCGC
                  4
CTCK_1 Motif      1602..164   CCACTCACAAGAGCACACGTGGT     C
                                GCTTTCTCCACCCTCC
ANAPHYLATOXIN     869..901    CCGCGCGATCACGGCGCCGA        D
                                CGCGCCGCCAGCC
_1 Motif          1063..109   CCGAGTGCACCGATCTCGGAGT
                                GGATCGAGTAGCC
                  7           CCCCACTTTATGAGCTAGTCGGC
                                AGTCACCTGCCCACC
                  1565..160
                  2
AGOUTI1 Motif     836..878    CCTAGCGCCTCTCACCACCGCC      E
                                GCCGCCTCCTCCCGCGCGATC
IGFBP_N_1 Motif   890..905    GCGCCGCCAGCCGCGC            F
VWFC_1 Motif      564..616    CCACTCGGGAGCAGCTTGAC        G
                                GAGTTCTACCAACACTTTCC
                                AGACATCCAGCT
                  805..859    C
                  806..859    CCGACTCCCCTTAGGAGCCAGA
                                ACCCTAAACCCTAGCGCCT
                                CTCACCACCGC
                  841..891    CGC
                  843..897    CGACTCCCCTTAGGAGCCAGAA
                                CCCTAAACCCTAGCGCCTCTC
                                ACCACCGCC
                  844..901    GC
                  848..905    CGCCTCTCACCACCGCCGCCG
                                CCTCCTCCCGCGCGATCACG
                                GCGCCGACGC
                  859..915    CCTCTCACCACCGCCGCCGCC
                                TCCTCCCGCGCGATCACGG
                                CGCCGACGCGCC
                  860..915    GCC
                  862..915    CTCTCACCACCGCCGCCGCCTCC
                                TCCCGCGCGATCACGGCG
                                CCGACGCGCCG
                  863..915    CCAGCC
                  874..928    CACCACCGCCGCCGCCTCCTCCC
                                GCGCGATCACGGCGCCGAC
                                GCGCCGCCAG
                  901..945    CCGCGC
                  907..945    CCGCCTCCTCCCGCGCGATCAC
                                GGCGCCGACGCGCCGCCAG
                                CCGCGCTCAAC
                  910..968    CTCTC
                  911..968    CGCCTCCTCCCGCGCGATCACG
                                GCGCCGACGCGCCGCCAG
                                CCGCGCTCAACC
                  922..975    TCTC
                  923..975    CCTCCTCCCGCGCGATCA
                                CGGCGCCGACGCGCCGC
                                CAGCCGCGCTCAACCTC
                  925..975    TC
                  1499..154   CTCCTCCCGCGCGATCACGG
                                CGCCGACGCGCCGCCAG
                                CCGCGCTCAACCTCT
                  6           C
                  1502..154   CGATCACGGCGCCGACGCG
                                CCGCCAGCCGCGCTCA
                                ACCTCTCACCAACCCAC
                  6           CTC
                  1511..156   CGCGCTCAACCTCTCACCA
                                ACCCACCTCTCATCCCTAC
                                AACCTAC
                  8           CAACCTCTCACCAACCCACC
                                TCTCATCCCTACAACCTAC
                  1527..157   CCTCTCACCAACCCACCTCT
                                CATCCCTACAACCTACTGTT
                                GAGGCCCGGTGAC
                  0           CCTAGC
                  1528..157   CTCTCACCAACCCACCTCTCAT
                                CCCTACAACCTACTGTTGA
                                GGCCCGGTGACC
                  0           CTAGC
                  1565..160   CCACCTCTCATCCCTACAA
                                CCTACTGTTGAGGCCCGG
                                TGACCCTAGCTCCTAC
                  7           C
                  1587..164   CACCTCTCATCCCTACAACC
                                TACTGTTGAGGCCCGGT
                                GACCCTAGCTCCTACC
                  0           CCTCTCATCCCTACAACC
                                TACTGTTGAGGCCCGGT
                                GACCCTAGCTCCTACC
                  1599..164   CAGCCACTCATGCGAGCA
                                CACGTCGCGCCCTGCA
                                CTGCATGCCGCGGC
                  3           CCACTCATGCGAGCACACG
                                TCGCGCCCTGCACTG
                                CATGCCGCGGC
                  1601..164   CGAGCACACGTCGCGCC
                                CTGCACTGCATGCCGCG
                                GCGATTCGTCCATCTAAC
                  3           CACCCC
                  1602..164   CCTGCACTGCATGCCGC
                                GGCGATTCGTCCATCTAA
                                CCACCCCAC
                  3           CTGCACTGCATGCCGCG
                                GCGATTCGTCCATCTAAC
                                CACCCCAC
                  1657..170   CCCCACTTTATGAGCTA
                                GTCGGCAGTCACCT
                                GCCCACCCACTC
                  8           CAGTCACCTGCCCACCCACT
                                CACAAGAGCACACGTG
                                GTGCTTTCTCCACCCTC
                  1666..170   C
                  8           CACCCACTCACAAGA
                                GCACACGTGGTGCTTTC
                                TCCACCCTCCAAC
                  1812..186   CCCACTCACAAGAGCACA
                                CGTGGTGCTTTCTCCACC
                                CTCCAAC
                  0           CCACTCACAAGAGCAC
                                ACGTGGTGCTTTCT
                                CCACCCTCCAAC
                  1980..203   CGCCTCGTGCTGCACTTG
                                CTTTACACAGCCACC
                                TTCCTCACACAACCAGGAC
                  4           CTGCACTTGCTTTACACA
                                GCCACCTTCCTCACACAA
                                CCAGGAC
                  1981..203   CATCACGGAGAAGCTCC
                                CCCGTGGCCATGGTG
                                ATCACCAGCAGGCCACC
                  4           CCAGCACACCACTGGAA
                                TGAGCGGCTCGAAGACG
                                CATGCCACCACAGCCAC
                  1986..203   CACC
                  4           CAGCACACCACTGGAAT
                                GAGCGGCTCGAAGACG
                                CATGCCACCACAGCCACC
                  2128..217   ACC
                  5           CACCACTGGAATGAGCGG
                                CTCGAAGACGCATGCCA
                                CCACAGCCACCACC
                              CAGCACTAAGCCCAGCC
                                GGTCTGCCCACGCC
                                CGCGCCCGACCCGCTAC
EGF_1 Motif       344..355    CGCGCCCTGGCC                H
                  410..421    CACCAGCGGTGC
                  461..472    CACCAGTAGTGC
                  811..822    CCCCTTAGGAGC
                  1568..157   CACTTTATGAGC
                  9           CACACGTGGTGC
                  1615..162   CACAACCAGGAC
                  6           CACCAGCAGGCC
                  1697..170
                  8
                  1846..185
                  7
DEFENSIN Motif    2131..215   CACTAAGCCCAGC               I
                  9             CGGTCTGCCCACGCCC
COPYRIGHT 2013 American-Eurasian Network for Scientific Information
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2013 Gale, Cengage Learning. All rights reserved.

 
Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Original Article
Author:Rasouli, Hassan; Kahrizi, Danial; Ghadernia, Parivash
Publication:Advances in Environmental Biology
Article Type:Report
Geographic Code:7IRAN
Date:Apr 1, 2013
Words:1734
Previous Article:Degradation of crude oil in the presence of lead (Pb) and cadmium (Cd) by a metal-adapted consortium culture.
Next Article:Evaluation of antioxidant activity, free radical scavenging and cuprac of two compounds isolated from Scorzonera undulata ssp deliciosa.
Topics:

Terms of use | Privacy policy | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters