Printer Friendly

Identification of SNPs in beta 2 microglobulin ([beta]2M) gene and their association with IgG concentration in neonatal buffalo calves.

Calves are the future of livestock industry. Calf management plays an important role in the development of the dairy sector of the country. The success of the dairy industry depends on appropriate calf management. Calf care is not only essential for sustenance of the dairy industry but is also essential in the wake of preserving and maintaining our good quality germplasm. Important aspects in the calf rearing are health management and proper nutrition to the calves especially during the first few hours of life. These calves are born with a predetermined genetic potential, which may be permanently affected by management decisions implemented throughout the rearing period. It is essential that farm owners take proper care of calves so that they develop into healthy adult animals and achieve a high lifetime milk production. Proper management of young stock, particularly during the neonatal period, could markedly reduce morbidity and mortality, whereas improper management would lead to economic losses from increased cost of veterinary intervention, death losses, reduced growth and suboptimal productive and reproductive performance. Diseases of new born calf and neonatal calf mortality are the major causes of economic losses in livestock production. 25 % average early calf mortality hardly provides any chance for regular replacement of low production animals. It is roughly estimated that a calf mortality of 20 per cent can reduce net profit to 38 per cent (1). Keeping the facts in mind like severity of pathogens on calf mortality during early period of its life and economic losses due to calf mortality on dairy industry, early immunity of neonatal calves is highly essential. The neonatal calf immunity during early period is only due to passive transfer of immunoglobulins from mother through colostrum. Health and nutrition in the neonatal calves depends on the availability of good quality colostrum in adequate quantity. The environmental as well as genetic control of passive transfer of immunity is a well established fact. Therefore, identification of these genetic causes will eventually lead a way forward to increase in neonatal calf immunity and decrease in calf morbidity and mortality. FcRns are neonatal Fc receptors which are present in neonatal calf intestine, kidneys, lungs, mammary glands and vascular endothelial cells (2). They play an important role in absorption of IgG and are also known to prolong their half life. FcRn is a heterodimer of two polypeptides i.e., a MHC class I homolog encoded by FCGRT gene and beta 2 microglobulin encoded by [beta]2M gene. More than 50 % cases of FPT are due to defective structure of FcRn which could be due to polymorphism in genes coding FcRn i.e., FCGRT and [beta]2M (3). Due to dearth of information on variants in [beta]2M gene and their possible role in influencing IgG levels in buffaloes, this study was taken up to identify SNPs in [beta]2M gene and their association with immunoglobulin G concentration in serum of neonatal buffaloes calves.

MATERIALS AND METHODS

Experimental animals and collection of blood

Forty new born Murrah buffalo calves, maintained at Livestock Production Management (LPM) Section of IVRI, Izatnagar, were included in the present study. Approximately, 5ml of blood was collected under sterile conditions, from the jugular vein of buffalo calves in a 15ml polypropylene centrifuge tube containing 0.5ml of 2.7% EDTA solution as anticoagulant. Additionally from new born buffalo calves, 12 to 18 hrs after the first feeding of colostrum, 3ml blood was collected in vaccutainer tubes without anticoagulant for serum isolation. These were then transported to laboratory in an icebox and serum was stored at 20[degrees]C till estimation of IgG concentration.

Isolation of Genomic DNA from blood

Genomic DNA was isolated from the frozen blood samples of calves using phenol-chloroform extraction method (4) with minor modifications. The genomic DNA isolated was checked for its quality, purity and concentration by routine methods. DNA samples of good quality, purity and concentration were used for further analysis.

Amplification of different regions of [beta]2M gene

Seven pairs of primers for amplification of both exonic and intronic regions of [beta]2M gene in the DNA samples of Murrah buffaloes were designed on the basis of sequences of cattle (Bos taurus) in public database at NCBI (AC_000167.1) with the help of Primer3 online computer software. The primers were intended to amplify seven fragments corresponding to all the four exons (full coding regions) and three introns (partial noncoding regions) of [beta]2M gene in buffalo. Sequences of primers designed for amplification of fragment are given in Table 1.

Various combinations of reaction mixture were tried to optimize the concentration of each component. The optimized concentration of the components used in the reaction mixture for amplification of fragment I through fragment VII was 2.5 [micro]l 10 X PCR buffer (1 X), 2.5 [micro]l dNTP mix (0.2 mM), 2.0 [micro]l MgCl2 (1.5 mM), 0.5 [micro]l F- primer (0.2 [micro]M), 0.5 [micro]l R- primer (0.2[micro]M), 0.2 [micro]l Taq DNA polymerase (1U/25[micro]L), 2.0 [micro]l gDNA (80-100 ng) and 14.80 [micro]l Nuclease free water. Samples were amplified by initial denaturation at 95[degrees]C for 3 min, 35 cycles of 95[degrees]C for 30 sec, X[degrees]C for 30 sec and 72[degrees]C for 20 sec; followed by final extension at 72[degrees]C for 10 min. The annealing temperature was 57, 59.3, 55, 55, 51, 55 and 55 [degrees]C for fragments I through VII respectively.

Identification of allelic variants

Single strand conformation polymorphism (SSCP) analysis was performed on all PCR products/DNA samples for determination of allelic variants by standard procedure with slight modifications (5), followed by sequencing. In order to optimize SSCP resolution on gel, several factors viz. amount of PCR product, denaturing solution, acrylamide concentration, percentage cross-linking, glycerol, voltage, running time, temperature etc. were tested for each fragment. Each PCR product was diluted in denaturing solution (95 % formamide, 10 mM NaOH, 0.05 % xylene cyanol and 0.05% bromophenol blue, 20 mM EDTA), denatured at 95 [degrees]C for 5 min, chilled on ice and resolved on 15 % poly- acrylamide gel. The electrophoresis was carried out in a vertical electrophoresis unit, in 1X TBE buffer. The gels were stained with silver nitrate6 and the band patterns were scored for each amplified product. Variants detected by PCR-SSCP of seven fragments of [[beta].sub.2]M gene corresponding to 4 exons and 3 introns were sequenced by outsourcing. Both forward and reverse sequencing were carried out for each allelic pattern which was sent as triplicate for each pattern. Resulting sequences were analysed by DNASTAR (Lasergene, USA) software. By aligning observed sequences of different patterns, the nucleotide variabilities in terms of SNPs, were identified. These SNPs were combined to form various haplotypes.

Estimation of IgG concentrations

Indirect ELISA was performed to determine the Immunoglobulin-G (IgG) concentration in serum samples of calves by kit method (Koma Biotech, Korea) with some modifications. Degree of colour development was measured as absorbance (OD) at 450nm wave length. The IgG values of known samples and their OD values were used to generate a regression equation, to predict the IgG values of unknown samples using GraphPad Prism 6 software.

Association of haplotypes with IgG concentrations

The association of [[beta].sub.2m] haplotypes with Immunoglobulin G (IgG) concentration was ascertained by PROC GLM procedure of S AS 9.3 programme. The model used was [Y.sub.ij] = [mu] + [H.sub.i] + [e.sub.ij], where, [Y.sub.ij] = [j.sup.th] observation of IgG concentration for [i.sup.th] haplotype; [H.sub.i] = effect of [i.sup.th] haplotype; [mu] = over all mean, and [e.sub.ij] = error term attached with [i.sub.jth] subclass.

RESULTS

SNP identification in [[beta].sub.2]M gene of buffalo calves by SSCP analysis

Seven fragments, covering all the four coding regions as well as representative region from noncoding regions, i.e. fragment I (206 bp: full exon 1), fragment II (296 bp: partial intron 1), fragment III (287 bp: full exon 2), fragment IV (227 bp: partial intron 2 and full exon 3), fragment V (226 bp: partial intron 3), fragment VI (201 bp: initial partial exon 4) and fragment VII (405 bp: remaining partial exon 4) of [[beta].sub.2]M gene of calves were amplified and the amplicons were subjected to PCR-SSCP analysis to identify the allelic variants in all the calves. The fragment I (206 bp) of [[beta].sub.2]M gene (encompassing partial 5' UTR region, exon1 and partial intron1) was amplified and the PCR products were subjected to SSCP analysis which revealed two alleles, A and B (Accn No. KM261591 and KM261592). The sequence analysis confirmed the presence of 16 bp 5' UTR (outside exon 1), 119 bp exon 1 (52 bp 5' UTR + 67 bp coding exon 1) and 71 bp partial intron 1. The two alleles A and B differed (C/G) at nucleotide positions 45 and lied in 5'UTR region. This SNP viz. C45G transversion was located in untranslated region. The PCR-SSCP of fragment II covering 296 bp of intron 1 also revealed two alleles (viz. A and B, Accn No. KM261600 and KM261601). The sequence analysis confirmed 296 bp partial intron 1. The alleles A and B, differed at nucleotide positions 22, 23 and 256 in the said fragment yielding to T22A transversion, T23A transversion and G256A transition. The fragment III covering 287 bp (partial intron1, exon 2 and partial intron 2) also exhibited two alleles (viz. A and B, Accn no.KM261593 and KM261594). The sequence analysis confirmed the presence of partial intron 1 (10 bp), exon 2 (276 bp) and 1 bp partial intron 2. The sequence analysis revealed only one SNP at 204 nucleotide position viz. T204C transition which was located in exon 2. A total of 64 amino acids were found for exon 2 of the [[beta].sub.2]M gene in buffalo. This SNP at 204th position (T204C) did not lead to alteration of amino acid (alanine), hence, was a synonymous (silent) mutation. The fragment IV covering 227 bp (comprising of partial intron 2, exon 3 and partial intron 3) revealed monomorphic pattern indicating only one allele (A, Accn no. KM261595). Sequence analysis confirmed the presence of 146 bp intron 2 (partial), 28 bp exon 3 (14 bp coding exon 3 and 14 bp 3' UTR) and 53 bp partial intron 3. The fragment V (226 bp) corresponding to partial intron 3 also yielded a single allele (Accn no. KM261602). Sequence analysis confirmed the presence of 226 bp partial intron 3. The fragment VI (201 bp) corresponding to partial intron 3 and partial exon 4 also yielded one allele. Sequence analysis confirmed the presence of 7 bp intron 3 (partial), 194 bp exon 4 (partial initial). The fragment VII (405 bp) corresponding to partial exon 4 exhibited four alleles (viz. A, B, C and D; Accn no. KM261596, KM261597, KM261598 and KM261599). Sequence analysis confirmed the presence of 348 bp exon 4 (partial remaining) 57 bp 3 'UTR (outside exon 4). Sequence analysis of PCR products for these four patterns also revealed four SNPs viz. G80A transition, A101C transversion and A208G transition and A239G transition. All these four SNPs were present in 3'UTR region. Sequences of all the amplified fragments conformed to the GenBank resource for [[beta].sub.2] M gene in Bos taurus cattle (AC_000167.1). All these SNPs have been presented in Table 2.

Determination of haplotypes

We identified nine SNPs covering exonic and intronic regions of the [beta]2M gene in murrah breed of buffaloes. Before proceeding for any association study, it is imperative to make combination of these SNPs in form of haplotypes. Therefore, on the basis of SNPs, the haplotypes were prepared for all forty buffalo calves under investigation. A total of fourteen haplotypes were observed on the basis of nine SNPs viz. (C/G) (T/ A)(T/A)(G/A)(T/C)(G/A)(A/C)(A/G)(A/G) were CTTGTACAA, CTTGCACAA, CTTGTGAAA, GTTGTGAAA, CTTGTGAAG, CTTGTGAGA, CTTGCGAAG CAAATACAA, GTTGTACAA, GTTGTGAGA, CAAATGAGA, CAAATGAAA, GTTGTGAAG and GAAATGAAG which were designated as H1 to H14.

Estimation of Immunoglobulin G (IgG) concentrations

Immunoglobulin G levels were estimated in serum of new born calves. The regression curve was obtained by plotting standard concentrations against absorbance at 450nm. The regression equation y = 0.001x + 0.897, which was able to explain 99.2 % ([R.sup.2] = 0.992) variation in IgG values, was used to predict the unknown IgG concentration in serum samples. IgG levels in calf serum ranged from 0.25 to 14.88 mg/ml and mean IgG concentration in serum was estimated as 11.69 [+ or -] 0.75 mg/ml.

Association of haplotypes in [[beta].sub.2]M gene with IgG concentration

The effect of calf haplotypes was evaluated on serum IgG concentration. The least square analysis of variance revealed a non-significant effect of calf haplotype on IgG concentrations in serum (Table 3) and the least square means of IgG in various haplotypic groups were non significantly different from each other (Table 4).

DISCUSSION

Bovine neonatal calves get their preliminary immunity through the process of passive transfer i.e. due to feeding of colostrums containing immunoglobulins (mainly IgG). Immunoglobulin concentration in milk has been found to be influenced both by genetic and environmental factors (7). IgG can be selectively transferred from serum to milk in mammary gland and milk to blood in intestinal epithelium of neonates by the Fc receptor (FcRn) mediated mechanism (8). The IgG's transporter receptor molecule is FcRn heterodimer of which, [[beta].sub.2]M acts as an integral component of its cell surface expression (9-10) and in its absence, FcRn is retained in endoplasmic reticulum. Furthermore, in absence of [[beta].sub.2]M, IgG binding is decreased compared with that of native FcRn (11). The [[beta].sub.2]M, a 6 kb gene (357 bp cds), located on 10th chromosome of bovine, is conserved across species, including mammals and birds containing four exons and three introns. It is located outside of the MHC region. In bovines, the cds of [[beta].sub.2]M consist of 357 bp sequence, coding for 118 amino acid residues.

We identified nine unique SNPs located in different exonic and intronic regions of the [[beta].sub.2]M gene in neonatal buffalo calves (Bubalus bubalis). Eight of these SNPs were located in non coding or intronic regions while only one was found in exon 2 of the gene though this too was a synonymous mutation. The previous study on [[beta].sub.2]M gene in multi-breed herd of beef cattle using direct sequencing technique revealed 12 SNPs in exon 2 and 4 (12). Eleven SNPs were present in non coding region and one SNP was present in coding region of exon 2. However, this coding region's SNP was a also silent mutation and did not led to any change in amino acid. The observations on SNPs observed in murrah buffaloes in our study were in high conformity with those of above study which were observed in beef cattle. Though the SNPs reported by them were different as compared to ours. In another study, one SNP (T204C) was observed in exon 2 and flanking intron in buffalo dams (13).

It has been reported that < 10 mg/ml level indicate the failure of passive transfer (FPT) and such calves have shown greater association with morbidity and mortality as compared to those which have > 10 mg/ml of serum IgG (14-15). According to National Dairy Heifer Evaluation Project (16), more than 40 % dairy heifer calves were found to have serum IgG < 10 mg/ml thus have a risk of FPT. In our study, only 7 out of 40 buffalo calves exhibited < 10 mg/ml thus accounted for 17.5 % of FPT cases. The greater variations observed in serum IgG in our calves are in line with other studies in which a wide range of IgG concentrations in colostrum (milking 2 to 6 hrs post calving) varying from 11 to 221 mg/ml was observed (17).

In our studies, the association between calf haplotype and serum IgG concentration could not be observed. The mean serum IgG concentration pertaining to these 14 calf haplotypes were non significantly different from each other. It may imply that either the buffalo [[??].sub.2]M gene may not be playing a role in determining the IgG concentrations of colostrum or serum or their might be some other important gene viz. FCGRT which codes for a bigger component of FcRn molecule, be playing a greater role in determining IgG concentrations of colostrum or serum. The investigation on FCGRT gene are also underway in our laboratory. Recently in another studies, three SNPs in exon 2 and flanking region and two SNPs in exon 3 and flanking introns in FCGRT gene in buffaloes were observed (18,19). There are ample evidences that [[beta].sub.2]M gene has been used by numerous workers as a house keeping gene (reference gene/indigenous control/ internal control) in numerous gene expression studies in a variety of tissues specially sperm (20-27) indicating that [[beta].sub.2]M gene is stable in expression in different conditions across tissues.

On contrary, it has been reported that calves homozygous for one haplotype (out of eight observed haplotypes) of [[beta].sub.2]M gene in multi-breed herd of beef cattle, were found to be at increased risk of failure of passive transfer (12). The difference of our report with that of above report could be attributable to difference in species and /or the much larger sample size in beef cattle. Association between buffalo dam [[beta].sub.2]M gene haplotypes and colostral IgG could also not be observed (28). The lack of association in our study could also be due to the smaller sample size of buffalo calves (n=40) or it may also imply that some other non-genetic factors may be playing a greater role in determining IgG concentrations of colostrum or serum.

CONCLUSIONS

In the present investigation, we observed nine unique SNPs in neonatal buffalo calves that led to formation of 14 haplotypes. The least square analysis of variance could not exhibit a significant effect of calf haplotype on serum IgG concentration. It would also be worthwhile to study the allelic variations of the other gene i.e., FCGRT which codes for the heavier MHC like polypeptide of the obligate heterodimer found in the FcRn molecule with a larger sample size of buffalo calves.

ACKNOWLEDGEMENTS

The authors are thankful to the Director, IVRI, Izatnagar for financial support and Late. Dr. Deepak Sharma, Head, Division of Animal Genetics for being the main driving force behind this work. The authors also pray for his soul to rest in peace: Om Shanti, Shanti, Shanti.

REFERENCES

(1.) Blood D.C., Radostits O.M.: Veterinary Medicine, 7th edn. Oxford: ELBS, 1989.

(2.) Kuo, T.T., Baker, K., Yoshida, M., Qiao, S.W., Aveson, V.G., Lencer, W.I. Neonatal Fc receptor: from immunity to therapeutics. J Clin Immunol., 2010; 30:777-789.

(3.) Simister, N.E., Ahouse, J.C. The structure and evolution of FcRn. Res Immunol., 1996; 147:333-337.

(4.) Sambrook, J., Russell, D.W., Molecular cloning: A laboratory manual, 3rd edn. New York: Cold spring harbor Laboratory Press, 2001;Vol. 3.

(5.) Orita, M., Iwahana, H., Kanazawa, H., Hayashi, K. , Sekiya, T., Detection of polymorphism of human DNA by gel electrophoresis as single strand conformation polymorphisms. Proc Nat'l Acad Sci USA, 1989; 86: 2766-2770.

(6.) Bassam, B.J., Annoles, G.C., Greshoff PM Fast and sensitive silver staining of DNA in polyacrylamide gels. Ani Biochem, 1991; 196: 80-83.

(7.) Liu, G., Zhang, C., Wangemail, J., Bu, D., Zhou, L., Zhao, S. Li, S. Canonical correlation of milk immunoglobulins, lactoferrin concentration and Dairy Herd Improvement data of Chinese Holstein cows. Livestock Science, 2010; 128 (1): 197-200.

(8.) Anderson, M., Bocharova, O. V, Makarava, N., Breydo, L., Salnikov, V V., Baskakov, I. V. Polymorphism and ultrastructural organization of prion protein amyloid fibrils: an insight from high resolution atomic force microscopy. J. Mol. Biol, 2006; 358: 580-596

(9.) Mayer, B., Zolnai, A., Frenyo', L. V., Jancsik, V., Szentirmay, Z., Hammarstro'm, L. and Kacskovics, I. Localization of the sheep FcRn in the mammary gland. Veterinary Immunology. 2002; 87: 327-330.

(10.) Roopenian, D. C. and Akilesh, S. FcRn: the neonatal Fc receptor comes of age. Nature Review Immunology, 2007; 7: 715-725.

(11.) Israel, E. J., Patel, V K., Taylor, S. F., Marshak-Rothstein, A., Simister, N. E. Requirement for a [??]2 microglobulin associated Fc receptor for acquisition of maternal IgG by fetal and neonatal mice. J. Immunol,1995; 154: 6246-6251.

(12.) Clawson, M.L., Heaton, M.P., Chitko-McKnown, C.G., Fox, J.M., Smith, T.P.L., Snelling, W.M., Keele, J.W., Laegreid, W. W. Beta-2-microglobulin haplotypes in U.S. beef cattle and association with failure of passive transfer in newborn calves. Mammalian Genome, 2004; 15: 228-236.

(13.) Chaudhary, R., Kumar, S., Kumar, A., Chauhan, A., Sahoo, N.R. Genetic variability in exon 2 of Beta-2 Microglobulin (B2M) gene in buffaloes and its association with colostral IgG concentration in National symposium on "Policy Planning for Livelihood Security through Domestic Animal Biodiversity" on 11-12 Feb, 2016.

(14.) Pare, J., Thurmond, M. C., Gardner, I. A., Picanso, J. P. Effect of Birthweight, Total Protein, Serum IgG and Packed Cell Volume on Risk of Neonatal Diarrhea in Calves on Two California Dairies. Can J Vet Res, 1993; 57: 241-246.

(15.) Rea, D. E., Tyler, J. W. and Hancock, D. D. Prediction of calf mortality by use of tests for passive transfer of colostral immunoglobulin. Journal of American Veterinary and Medical Association, 1996; 208: 2047-2049.

(16.) Jaster, E.H. Evaluation of Quality, Quantity, and Timing of Colostrum Feeding on Immunoglobulin G1 Absorption in Jersey Calves. J Dairy Sci, 2005; 88: 296-302.

(17.) Kehoe, S.I., Heinrichs, A.J., Moody, M.L., Jones, C.M., Long, M.R. Comparision of immunoglobulin G concentrations in primiparous and multiparous bovine colostrum. Professional Ani Sci, 2007; 27: 176-180.

(18.) Agrawal, S., Kumar, S., Chaudhary, R., Yathish, H.M., Kumar, A., Chauhan, A., Sahoo, N.R., Sivamani, B., Sharma, D. Identification of nucleotide variability in FCGRT gene in buffalo dams in National Seminar on " Translational Research in B iotechnology for Improving Animal Health and Production", Bikaner on 7-8 October, 2015; 81.

(19.) Agrawal, S., Kumar, S., Chaudhary, R., Kumar, A., Chauhan, A., Sahoo, N.R. Polymorphism in intron 2 of FCGRT gene in neonatal buffalo calves and its association with serum IgG concentration in National symposium on "Policy Planning for Livelihood Security through Domestic Animal Biodiversity" on 11-12 Feb, 2016.

(20.) Sire, J., Colle, A., Pinatel, M.C., Fellous, M., Manuel, Y. Beta2-Microglobulin in human seminal fluid (author's transl). Pathol Biol (Paris), 1978; 26:392-394.

(21.) Chard, T., Parslow, J., Rehmann, T., Dawnay, A. The concentrations of transferrin, beta 2-microglobulin, and albumin in seminal plasma in relation to sperm count. Fertil Steril, 1991; 55: 211-213.

(22.) He, X.H., Xu, L.H., Liu, Y, Zeng, Y Y. Cloning of human beta-microglobulin gene and its high expression in Escherichia coli. Sheng Wu Gong ChengXueBao, 2004; 20: 99-103.

(23.) Nikpoor, P, Mowla, S.J., Movahedin, M., Ziaee, S.A.M., Tiraihi, T. CatSper gene expression in postnatal development of mouse testis and in subfertile men with deficient sperm motility. Hum Reprod, 2004; 19: 124-128.

(24.) Asadi, M.H., Mowla, S.J., Nikpoor, P. Gene expression profile of CatSper3 and CatSper4 during postnatal development of mouse testis. Iran Biomed J , 2005; 10(2): 111-115.

(25.) Skinner, P. J., Abbassi, H., Chesebro, B., Race, R.E., Reilly, C., Haase, A.T. Gene expression alterations in brains of mice infected with three strains of scrapie. BMC Genomics, 2006; 7:114.

(26.) Harrington, N.P, Surujballi, O.P, Waters, W.R., Prescott, J.F. Development and evaluation of a real-time reverse transcription PCR assay for quantification of gamma interferon mRNA to diagnose tuberculosis in multiple animal species. Clinic Vaccine Immunol, 2007; 14:1563-1571.

(27.) Nygard, N.B., Jogensen, C.B., Cirera, S., Fredholm, M. Selection of reference genes for gene expression studies in pig tissues using SYBR green qPCR. BMC Mol Bio, 2007; 8:67.

(28.) Chaudhary, R., Kumar, S., Yathish, H. M., Sivakumar, A., Mishra, C., Kumar, A., Chauhan, A., Sivamani, B., Sahoo, N. R. Nucleotide variability in Beta 2 Microglobulin ([[beta].sub.2]M) gene and its association with colostral IgG levels in buffaloes (Bubalus bubalis). Indian Journal of Animal Research, 2016; Accepted.

Rajni Chaudhary [1], Subodh Kumar [2] (*), H.M. Yathish [3], Sivakumar A. [4], Chinmoy Mishra [5], Amit Kumar [6], Anuj Chauhan [6], B. Sivamani [7] and N.R. Sahoo [8]

[1] Division of Animal Genetics, ICAR Indian Veterinary Research Institute, Izatnagar, Bareilly - 243 122, India.

[2] Division of Animal Genetics, ICAR Indian Veterinary Research Institute, Izatnagar, Bareilly - 243122, India.

[3] Division of Animal Genetics, Karnataka Veterinary, Animal and Fisheries Sciences University, Bidar-585401, India.

[4] Veterinary Officer, Government of Tamil Nadu, India.

[5] Division of Animal Genetics, College of Veterinary Science and Animal Husbandry, Orissa University of Agriculture & Technology, Bhubaneswar- 751003, Orissa, India.

[6] Division of Animal Genetics, ICAR Indian Veterinary Research Institute, Izatnagar, Bareilly--243122, Uttar Pradesh, India.

[7] Molecular Biology and Genetics, Central Institute of Brackish water Aquaculture, Chennai, India.

[8] Division of Animal Genetics, ICAR Indian Veterinary Research Institute, Izatnagar, Bareilly--243 122, India.

(Received: 01 February 2016; accepted: 08 March 2016)

* To whom all correspondence should be addressed.

Mob.: +91-9897225710; E-mail: subkum@gmail.com
Table 1. Primers designed for amplification of
different fragments of P2M gene in buffalo

S. No     Primer Name    Primer Sequence                    Product
                                                            Size

1.        Fragment 1-F   5'GAGTGCGGACTATAAAGGCGAGCG3'       206 bp
          Fragment 1-R   5'CAGGGTGCCAAGTGGGTGTGAT3'
2.        Fragment 2-F   5'CACTGAAGCTCGGATTTCTCTT3'         296 bp
          Fragment 2-R   5'CCTACACAGGGAAAGAGCTGA3'
3.        Fragment 3-F   5'CGCTCCTCAGGTCCTCCAAAGATT3'       287 bp
          Fragment 3-R   5'CCCCACTTAACTATCCGGGGTTGTT3'
4.        Fragment 4-F   5'GGATCTCAGGCTGGTAGGAAAGGT C 3'    227 bp
          Fragment 4-R   5'GCTGTCTGTAATGGTCCCCAGG 3'
5.        Fragment 5-F   5'GGCTTTCCCAGCATCACTAA3'           226 bp
          Fragment 5-R   5'GGTGTCTCTGCAGAACCATGT3'
6.        Fragment 6-F   5CCCCCAGGTTTGAAGATGCC '3'          201 bp
          Fragment 6-R   5'CCTCCACTGCGGCTTACTGC 3'
7.        Fragment 7-F   5'GGTCTGTGTTGGCAGTAAGCCGC 3'       405 bp
          Fragment 7-R   5'CACTTCCCTGTTTGAACGAAGGC 3'

Table 2. Distribution of SNPs across different
regions of [[beta].sub.2]M gene in buffalo

Fragment I                   C [right arrow] G,
(Full exon 1 and             45(5'UTR)
partial intron 1)

Fragment II                  T [right arrow] A,     T [right arrow] A,
(Partial intron 1)           22                     23
                             (intron 1)             (intron 1)

Fragment 111                 T [right arrow] C,
(Full exon 2)                204 (exon2)
                             GCT[right arrow]GCC
                             Ala [right arrow]Ala

Fragment IV                  No SNP
(Partial intron 2 and
full exon 3)

Fragment V                   No SNP
(Partial intron 3)

Fragment VI                  No SNP
(Initial partial exon 4)

Fragment VII                 G [right arrow] A,     A [right arrow] C,
(Remaining partial exon 4)   80 (3'UTR)             101 (3'UTR)

Fragment I
(Full exon 1 and
partial intron 1)

Fragment II                  G [right arrow] A,256
(Partial intron 1)           (intron 1)

Fragment 111
(Full exon 2)

Fragment IV
(Partial intron 2 and
full exon 3)

Fragment V
(Partial intron 3)

Fragment VI
(Initial partial exon 4)

Fragment VII                 A [right arrow] G,      A [right arrow] G,
(Remaining partial exon 4)   208 (3'UTR)             239 (3'UTR)

Table 3. Least square analysis of variance for effect of
buffalo calf haplotype on IgG concentration in calf serum

Source       DF   Sum of Squares   Mean Square   F Value   Pr > F

Haplotype    13    278.6647167     21.4357474     0.93     0.5418
Error        26    602.3501233     23.1673124
Corrected    39    881.0148400
Total

Table 4. Least square means of IgG concentrations in
serum with standard error (number of observations)
for different haplotypes

Haplotype ID    Least square mean [+ or -] SE (n)
of Calves                  of Serum IgG

H1                   11.57 [+ or -] 1.51 (12)
H2                   13.99 [+ or -] 0.00 (1)
H3                   14.03 [+ or -] 0.16 (3)
H4                    5.32 [+ or -] 3.90 (2)
H5                   10.95 [+ or -] 1.74 (10)
H6                   13.61 [+ or -] 0.02 (2)
H7                   14.35 [+ or -] 0.00 (1)
H8                   14.026 [+ or -] 0.37 (2)
H9                   14.45 [+ or -] 0.44 (2)
H10                  14.23 [+ or -] 0.00 (1)
H11                  10.88 [+ or -] 0.00 (1)
H12                  1.057 [+ or -] 0.00 (1)
H13                  13.75 [+ or -] 0.00 (1)
H14                  13.92 [+ or -] 0.00 (1)
Total             11.69 (NS) [+ or -] 0.75 (40)
COPYRIGHT 2016 Oriental Scientific Publishing Company
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Chaudhary, Rajni; Kumar, Subodh; Yathish, H.M.; Sivakumar, A.; Mishra, Chinmoy; Kumar, Amit; Chauhan
Publication:Journal of Pure and Applied Microbiology
Article Type:Report
Date:Jun 1, 2016
Words:4712
Previous Article:Hydrolysis of proteins in cheddar cheese whey and utilization as a growth medium for lactic acid bacteria.
Next Article:Standardization of In vitro regeneration protocol for pomegranate (Punica granatum l.) var. Bhagwa using different media composition.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters