Printer Friendly

Identification and haplotype analysis of apolipoprotein B-100 [Arg.sub.3500] [right arrow] Trp mutation in hyperlipidemic Chinese.

The concentration of plasma cholesterol is mainly regulated by the LDL receptor pathway, in which circulating LDL is taken into the cells by receptor-mediated endocytosis (1). Individuals with high LDL concentrations are often predisposed to premature coronary heart disease (CHD) [4] (2). In principle, increased LDL concentrations that result from inefficient clearance of LDL particles by the receptor may derive either from defects in the receptor or from defects in the ligand. The former class of genetic disorder is familial hypercholesterolemia, an autosomal dominant disorder characterized by increased LDL concentrations, the frequent presence of tendon xanthomas, and premature CHD (3). The later class, familial defective apolipoprotein (apo) B-100 (FDB), is also a dominantly inherited genetic disease. A CGG-to-CAG change in apo B-100 codon 3500 (Ar[g.sub.3500][right arrow]Gln) had been established as the cause of FDB (4, 5). The change, which disrupts binding to the LDL receptor, increases the concentration of LDL bearing the altered apo B-100 relative to the unaffected LDL (4, 6). Because the rate of removal of VLDL remnants by the LDL receptor was not affected (7), such a defect was expected to lead to less severe hypercholesterolemia than in familial hypercholesterolemia (812). The incidence of FDB heterozygotes is 1:500-1:700 in individuals of European and North American descent (8,13,14).

Two other genetic forms of FDB has been described: a CGC-to-TGC change in codon 3531 (Ar[g.sub.3531][right arrow]Cys) (15,16) and a CGG-to-TGG change in codon 3500 (Ar[g.sub.3500][right arrow]Trp) (17,18). The two mutations affect the function of apo B-100 by decreasing LDL receptor binding affinity (15,17). Haplotype analysis of the affected alleles, using markers within and / or flanking the apo B-100 gene, suggests that Ar[g.sub.3500][right arrow]Gln alleles are inherited from a common ancestor in several Western populations (16,17,19-22); on the other hand, different haplotypes were found in one German and two Chinese subjects (23-25). When chromosomal backgrounds were different, Ar[g.sub.3531][right arrow]Cys alleles were associated with different haplotypes (15). That different haplotypes have been shown in two subjects of Asian and Scottish descent (17) also indicates that Ar[g.sub.3500][right arrow]Trp mutations arose independently in different ethnic backgrounds.

In the present study, 373 unrelated hyperlipidemic Chinese were screened by PCR and single-strand conformation polymorphism (SSCP) analysis to detect any changes in the apo B-100 gene segment surrounding codons 3500 and 3531. Nine heterozygotes with the Ar[g.sub.3500][right arrow]Trp mutation were identified. In addition, the apo B-100 haplotype at six polymorphic sites was examined to establish the origin of the founder carrying the mutation.

Materials and Methods

SUBJECTS

Blood samples were collected after an overnight fast from 373 unrelated hyperlipidemic patients, ages 30-80 years (mean, 60 years), attending the lipid clinic of the Wei Gong Memorial Hospital and Veterans General Hospital, Taipei. Of these subjects, 258 (173 men and 85 women) had primary type IIa hyperlipidemia, and 115 (75 men and 40 women) had type IIb hyperlipidemia. These patients had cholesterol concentrations >5.17 mmol/L (range, 5.19-11.16 mmol/L) without tendon xanthomas. Type IIa patients had triglyceride values <2.27 mmol/L, and type IIb patients had concentrations above this value. The 309 individuals (223 men and 86 women) in the control group, ages 25-70 years (mean, 52 years), were volunteers for lipid estimations at an outpatient clinic. All of them had cholesterol concentrations <5.17 mmol/L. The procedures followed were in accordance with the current revision of the Helsinki Declaration of 1975.

DNA PREPARATION

Nuclei were separated after lysis of blood samples by centrifugation and digested in buffer containing 50 mg/L proteinase K, 10 mmol/L Tris, pH 7.8, 5 mmol/L EDTA, and 5 g/L sodium dodecyl sulfate. Genomic DNA was extracted using an automatic nucleic acid extractor (Genepure, 341 Nucleic Acid Purification Systems, Applied Biosystems). The DNA was quantified as described (26) and diluted to a concentration of 100 mg/L.

PCR AMPLIFICATION

Regions of the apo B-100 gene were amplified by PCR. Genomic DNA (250-500 ng) was used for a 50-[micro]L PCR reaction containing 10 mmol/L Tris, pH 8.3, 50 mmol/L KCI, 1 mL/L Triton X-100, 0.2 mmol/L deoxynucleotide triphosphates, 0.4 [micro]mol/L of each primer, and 1 U Taq DNA polymerase (Promega). Specific PCR conditions are listed in Table 1. PCR analyses were performed in an automated thermal cycler (1605 Air Thermal Cycler, Idaho).

NONISOTOPIC SSCP ANALYSIS

The primer pair apoB-5' and apoB-3' (Table 1) flanks 345 by of the apo B-100 sequence from nucleotide 10 551 to nucleotide 10 895 (27). The PCR-amplified products were restricted into 141- and 204-bp fragments by EcoRI to optimize SSCP fragment size. Ten microliters of the restricted products were mixed with an equal volume of formamide buffer (950 mL/L formamide, 10 mmol/L EDTA,1 g/L bromphenol blue, and 1 g/L xylene cyanol). The mixture was denatured for 10 min at 95 [degrees]C and then cooled rapidly on ice and held for 5-10 min. For each sample, 15 [micro]L were loaded onto nondenaturing polyacrylamide gels [0.5 X Hydrolink MDE (J.T. Baker) in 0.6 X Tris-borate-EDTA] and run at 4 [degrees]C for 2.5 h at 250 V (Novex Xcell II). Gels were stained with ethidium bromide (0.5 mg/L) for 20 min, destained for 15 min, and photographed under ultraviolet light.

DNA SEQUENCING

Aberrant SSCP products from individual 95-020 were gel purified, subcloned into pGEM-T (Promega), and sequenced by the dideoxynucleotide chain termination method (28). The sequencing products were then separated on a 6% polyacrylamide gel containing 7 mol/L urea, and the separation was monitored on-line with an automated laser fluorescent DNA Sequencer (A.L.F.; Pharmacia LKB Biotechnology AB). Four to six independent clones were sequenced.

RESTRICTION ANALYSIS OF THE R3500W MUTATION

The R3500W mutation is caused by a C-to-T transition at nucleotide 10 707 of the apo B-100 gene. The mutation creates a NlaIII restriction site (CATG). The 345-bp PCR-amplified products were digested with NlaIII and separated on a 2.0% agarose gel.

HAPLOTYPE MARKERS

Six markers were analyzed to establish haplotypes at the apo B-1001ocus. These markers were as follows: polymorphic XbaI (27), MaeI (29), and MspI (30) sites in exon 26; polymorphic EcoRI (31) and Eco57I (32) sites in exon 29; and a hypervariable repeat region (HVR) downstream of the apo B-100 gene (33, 34). For restriction fragment length polymorphism markers in exons 26 and 29, PCR-amplified products were digested with the appropriate restriction enzyme and subsequently separated on 2.0% agarose gel. The 3'HVR marker was detected by 1.6% agarose gel electrophoresis of MnlI-restricted PCR products. The MnlI restriction reduces the hypervariable fragment size by 168 by (for example, from 739 to 571 by for a fragment with 36 repeats). The number of 15-bp repeats in the fragment with 30 repeats was further confirmed by DNA sequencing. All of the restriction endonucleases were obtained from New England Biolabs.

LIPID MEASUREMENTS

Lipid measurements were performed according to the standard Lipid Research Clinics Program protocol (35).

Results

IDENTIFICATION OF THE R3500W MUTATION

A region of 345 by in exon 26 of the apo B-100 gene was amplified and screened for mutations. A photo of DNA screening by SSCP analysis in a Hydrolink MDE mini gel is shown in Fig. 1. Of the hyperlipidemic patients examined, most showed two intensely stained bands (Fig. 1, lanes 3 and 5, arrows a and c), representing the major conformers of the two single strands from an EcoRI-restricted 204-bp fragment. Conversely, subjects with aberrant SSCP bands were found (Fig. 1, lanes 1, 2, and 4; arrow b). Sequencing of the cloned aberrant band from one subject revealed a C-to-T transition at nucleotide 10 707, producing the substitution of glutamine for tryptophan in the codon 3500 of the apo B-100 gene (R3500W; data not shown). The recurrent R3500W mutation (17, 18) creates a new NlaIII site on the PCR products so that, on digestion in heterozygotes, 189- and 156-bp fragments appeared in addition to the wild-type 345-bp fragment (Fig. 2, lanes 1-3). Among 373 hyperlipidemic patients examined, 9 unrelated subjects heterozygous for R3500W mutation were identified. No R3500W mutation was found in 309 individuals in the control group (data not shown). When examined by the Fisher Exact test, a significant association was found between R3500W mutation and hyperlipidemia (P = 0.004).

[FIGURE 1 OMITTED]

A total of 13 family members of R3500W heterozygotes 95-020 and 95-026 gave consent to be screened for the mutation. In the 95-020 family, the proband (II-2) inherited the mutation from his father (I-1). Three of his siblings (II-4, II-5, and II-7) also carry the mutation (Fig. 3, upper panel). In the 95-026 family, one of the sons (II-4) inherited the mutation from the proband (I-1; Fig. 3, lower panel).

HAPLOTYPE ANALYSIS ON THE MUTANT ALLELE

The genotypes at six polymorphic loci were examined. The results of genotyping of the 95-020 and 95-026 families are shown in Table 2. A total of 30 chromosomes yielded six independent haplotypes, including a new one generated from unequal crossing-over or replication error (haplotype E). R3500W alleles were associated with haplotype B: XbaI-/MaeI+/MspI+/EcoRI+/Eco57I+/34 3'HVR repeats in the two families.

[FIGURE 2 OMITTED]

[FIGURE 3 OMITTED]

Seven other subjects (95-040, 95-129, A46, D10, D47, D53, and D149), heterozygous for the same mutation, were genotyped. The lack of DNA from family members precluded unambiguous resolution of each of their haplotypes. When an unequivocal haplotype was deduced, one of the two alleles could be haplotype B (Table 3). The results suggest that their mutant alleles are identical to those of subjects 95-020 and 95-026. Thus, all R3500W alleles are likely identical by descent in our population.

LIPOPROTEIN CONCENTRATIONS

The clinical and biochemical features of the nine Ar[g.sub.3500][right arrow]Trp heterozygotes and 13 members of 95-020 and 95-026 families are shown in Table 4. The cholesterol concentrations of the eight index cases (95-020, 95-026, 95-040, 95-129, D10, D47, D53, and D149) were moderately increased (7.16-8.37 mmol/L), similar to those >40 years old reported for R3500W heterozygotes (6.6-8.6 mmol/L) (17,18). On the other hand, the index case A46 and five identified heterozygous relatives of probands 95-020 and 95-026 had serum cholesterol concentrations close to or only slightly >5.17 mmol/L (5.04-5.92 mmol/L).

Discussion

A total of 373 unrelated hyperlipidemic individuals were screened for the presence of apo B-100 mutations. Nine Ar[g.sub.3500]-to-Trp index cases were found, seven classified as having type IIa and two as having type IIb hyperlipidemia (Table 4). One type IIa index case (A46) had a history of CHD. Of these, together with the four cases described, one was of Scottish descent and the others were of Asian descent (17,18), a total of 13 index cases of this new mutation was reported. The recurrent arginine-to-tryptophan substitution is dysfunctional in that it allows only poor growth of a LDL-cholesterol-dependent U937 cell line (17). From the sample of patients examined here, the mutation is estimated to occur at a frequency of ~1:42 in hyperlipidemic Chinese. The mutation appears to be a significant factor contributing to moderate hypercholesterolemia in Chinese (P = 0.004).

R3500W alleles reported were associated with different haplotypes of different chromosomal backgrounds: haplotype XbaI+ /MspI- /EcoRI+ in a Scottish descendant and haplotype XbaI- /MspI+ /EcoRI+ in three Asians (17, 18). In addition, 35 3'HVR repeats (according to the nomenclature by Boerwinkle et al. (36)) were found associated with the haplotypes of two Asians (a Chinese and a Malay) (18). Compared with our studies, the haplotype associated with R3500W alleles in Chinese, XbaI-/MspI+/EcoRI+/34 3'HVR repeats (according to the nomenclature by Ludwig et al. (37); Table 3) concurs with that reported previously for other Asians with FDB (17,18). The results suggest that Ar[g.sub.3500][right arrow]Trp alleles are inherited from a common ancestor in Asian populations.

In Caucasians, different haplotypes are associated with the R3500W allele (XbaI+/MspI-/EcoRI+) (17) and the majority of R3500Q alleles (XbaI-/MspI+/EcoRI-) (16,17,19-22), thus suggesting an independent origin of the two mutations. The R3500Q alleles in Chinese were reported to occur on two different haplotypes: XbaI-/ MspI+/EcoRI+/30 3'HVR repeats (23) and XbaI+/ MspI+/EcoRI+/44 3'HVR repeats (25). In our studies, the haplotype associated with R3500W alleles in Chinese, XbaI-/MspI+/EcoRI+/34 3'HVR repeats, was different from those with R3500Q alleles. Thus, independent origins of the two mutations in Chinese are also suggested.

In general, haplotype markers are ancient and predate human racial divergence. Because R3500W and R3500Q mutations occurred on different haplotypes in both Caucasians and Chinese, relatively recent independent mutations of the CG dinucleotide to TG or CA are therefore indicated. By considering the geographical distribution of the R3500Q mutation in relation to what is known about early human migrations, an origin for the ancestral CG-to-CA mutation in continental Western Europe was suggested (38). When the amount of recombination between the apo B-100 gene and markers on chromosome 2 in 34 R3500Q probands in which the mutation was on the same haplotype was estimated, the ancestral CG-to-CA mutation was estimated to occur ~6000-7000 years ago (38). The hypermutable CG dinucleotide is frequently associated with point mutations of various genes (39).

The R3500W mutation is the result of a C-to-T transition at nucleotide 10 707, a base pair adjacent to the previously described R3500Q mutation, a G-to-A transition at nucleotide 10 708. The analogous substitution of the Arg residue with Gln or Trp was also found in codon 441 of the sterol 27-hydroxylase gene (40). The substitution of arginine by tryptophan or glutamine at apo B-100 codon 3500 affects its ability to bind to the LDL receptor (4, 6,17). That two independent mutations are associated with the same phenotype suggests that the loss of the arginine residue rather than the appearance of glutamime or tryptophan is causing the impaired binding.

The 3'HVR locus in II-3 had 34/38 repeats; on the other hand, 34/36 repeats were found in her parents (Table 2). The sample identity was verified by examining other polymorphic loci in the 5' region of the apo B-100 gene (data not shown). The discrepancy observed in 3'HVR repeats is likely to be attributed to slippage during DNA replication with the HVR itself. On average, a 5% gain or loss in repeat number was observed in studies of spontaneous change to new-length alleles within pedigrees for a variety of hypervariable loci (41). The postulated change from 36 (in haplotype A) to 38 (in haplotype E) HVR repeats is consistent with this view.

In conclusion, apo B-100 R3500W heterozygotes were identified in hyperlipidemic Chinese subjects. The Ar[g.sub.3500][right arrow]Trp alleles in Asians appear to have originated in a common ancestor many years ago. In view of the potential association of the mutation with CHD, screening for it is therefore of value in determining the potential risk of premature atherosclerosis.

We thank F.H. Su, LY. Huang, and H.C. Chou for excellent technical assistance. We extend gratitude to W.H. Tseng and K. Fang for helpful discussions and comments. This work was supported by grant NSC86-2313-B-003-001 from the National Science Council, Executive Yuan, Republic of China.

References

(1.) Brown MS, Goldstein JL. A receptor-mediated pathway for cholesterol homeostasis. Science (Washington DC), 1986;232:34-47.

(2.) Vega GL, Grundy SM. In vivo evidence for reduced binding of low density lipoproteins to receptors as a cause of primary moderate hypercholesterolemia. J Clin Investig 1986;78:1410-4.

(3.) Goldstein JL, Brown MS. Familial hypercholesterolemia. In: Scriver ER, Beaudet AL, Sly WS, Valle D, eds. The metabolic basis of inherited diseases, 6th ed. New York: McGraw-Hill Book Co., 1989:1215-50.

(4.) Innerarity TL, Weisgraber KH, Arnold KS, Mahley RW, Krauss RM, Vega GL, Grundy SM. Familial defective apolipoprotein B-100: low density lipoproteins with abnormal receptor binding. Proc Natl Acad Sci U S A 1987;84:6919-23.

(5.) Soria LF, Ludwig EH, Clarke HRG, Vega GL, Grundy SM, McCarthy BJ. Association between a specific apolipoprotein B mutation and familial defective apolipoprotein B-100. Proc Natl Acad Sci U S A 1989;86:587-91.

(6.) Weisgraber KH, Innerarity TL, Newhouse YM, Young SG, Arnold KS, Krauss RM, et al. Familial defective apolipoprotein B-100: enhanced binding of monoclonal antibody MB47 to abnormal low density lipoproteins. Proc Natl Acad Sci U S A 1988;85:9758-62.

(7.) Gallagher JJ, Myant NB. The affinity of low density lipoproteins and of very low density lipoprotein remnants for low density lipoprotein receptor in homozygous familial defective apolipoprotein B-100. Atherosclerosis 1995;115:263-72.

(8.) Tybjaerg-Hansen A, Gallagher J, Vincent J, Houlston R, Talmud P, Dunning AM, et al. Familial defective apolipoprotein B-100: detection in the United Kingdom and Scandinavia, and clinical characteristics of ten cases. Atherosclerosis 1990;80:235-42.

(9.) Kotze MJ, Peeters AV, Langenhoven E, Wauters JG, Van-Gaal LF. Phenotypic expression and frequency of familial defective apolipoprotein B-100 in Belgian hypercholesterolemics. Atherosclerosis 1994;111:217-25.

(10.) Miserez AR, Keller U. Differences in phenotypic characteristics of subjects with familial defective apolipoprotein B-100 and familial hypercholesterolemia. Arterioscler Thromb Vasc Biol 1995;15: 1719-29.

(11.) Hansen PS, Defesche JC, Kastelein JJP, Gerdes LU, Fraza L, Gerdes C, et al. Phenotypic variation in patients heterozygous for familial defective apolipoprotein B (FDB) in three European countries. Arterioscler Thromb Vasc Biol 1997;17:741-7.

(12.) Pimstone SN, Defesche JC, Clee SM, Bakker HD, Hayden MR, Kastelein JJP. Differences in the phenotype between children with familial defective apolipoprotein B-100 and familial hypercholesterolemia. Arterioscler Thromb Vasc Biol 1997;17:826-33.

(13.) Innerarity TL, Mahley RW, Weisgraber KH, Bersot TP, Krauss RM, Vega GL, et al. Familial defective apolipoprotein B-100: a mutation of apolipoprotein B that causes hypercholesterolemia. J Lipid Res 1990;31:1337-49.

(14.) Tybjaerg-Hansen A. Rare and common mutations in hyperlipidemia and atherosclerosis [Review]. Stand J Clin Lab Investig 1995; 55(Suppl 220):57-76.

(15.) Pullinger CR, Hennessy LK, Chatterton JE, Liu W, Love JA, Mendel CM, et al. Familial ligand-defective apolipoprotein B: identification of a new mutation that decreases LDL receptor binding affinity. J Clin Investig 1995;95:1225-34.

(16.) Rabes JP, Varret M, Saint-Jore B, Erlich D, Jondeau G, Krempf M, et al. Familial ligand-defective apolipoprotein B-100: simultaneous detection of the ARG3500[right arrow]GLN and ARG3531[right arrow]CYS mutations in a French population. Hum Mutat 1997;10:160-3.

(17.) Gaffney D, Reid JM, Cameron IM, Vass K, Caslake MJ, Shepherd J, Packard CJ. Independent mutations at codon 3500 of the apolipoprotein B gene are associated with hyperlipidemia. Arterioscler Thromb Vasc Biol 1995;15:1025-9.

(18.) Choong ML, Koay ESC, Khoo KL, Khaw MC, Sethi SK. Denaturing gradient-gel electrophoresis screening of familial defective apolipoprotein B-100 in a mixed Asian cohort: two cases of arginin[e.sub.3500][right arrow]tryptophan mutation associated with a unique haplotype. Clin Chem 1997;43:916-23.

(19.) Ludwig EH, McCarthy BJ. Haplotype analysis of the human apolipoprotein B mutation associated with familial defective apolipoprotein B100. Am J Hum Genet 1990;47:712-20.

(20.) Rauh G, Schuster H, Fischer J, Keller C, Wolfram G, Zollner N. Familial defective apolipoprotein B-100: haplotype analysis of the arginine(3500)[right arrow]glutamine mutation. Atherosclerosis 1991;88: 219-26.

(21.) Leren TP, Roldningen OK, Tonstad S, Rolsby 0, Urdal P, Ose L. Identification of the apo B-3500 mutation in the Norwegian population. Stand J Clin Lab Investig 1995;55:217-21.

(22.) Wenham PR, Bloomfield P, Blundell G, Penney MD, Rae PWH, Walker SW. Familial defective apolipoprotein B-100: a study of patients from lipid clinics in Scotland and Wales. Ann Clin Biochem 1996;33:443-50.

(23.) Bersot TP, Russell SJ, Thatcher SR, Pomernacki NK, Mahley RW, Weisgraber KH, et al. A unique haplotype of the apolipoprotein B-100 allele associated with familiar defective apolipoprotein B-100 in a Chinese man discovered during a study of the prevalence of this disorder. J Lipid Res 1993;34:1149-54.

(24.) Rauh G, Schuster H, Schewe CK, Stratmann G, Keller C, Wolfram G, Zollner N. Independent mutation of arginin[e.sub.3500][right arrow]glutamine associated with familial defective apolipoprotein B-100. J Lipid Res 1993;34:799-805.

(25.) Abdel-Wareth L0, Pimstone SN, LagardeJP, RaisonnierA, Benlian P, Pritchard H, et al. Familial defective apolipoprotein B-100 in hypercholesterolemic Chinese Canadians: identification of a unique haplotype of the apolipoprotein B-100 allele. Atherosclerosis 1997;135:181-5.

(26.) Sambrook J, Fritsch F, Maniatis T. Molecular cloning: a laboratory manual. New York: Cold Spring Harbor Laboratory, 1989:E5.

(27.) Ludwig EH, Blackhart BD, Pierotti VC, Caiati L, Fortier C, Knott T, et al. DNA sequence of the human apolipoprotein B gene. DNA 1987;6:363-72.

(28.) Sanger F, Nicklen S, Coulson AR. DNA sequencing with chaintermination inhibitors. Proc Natl Acad Sci U S A 1977;74:5463-7.

(29.) Wu MJ, Butler E, Butler R, Schumaker VN. Identification of the base substitution responsible for the Ag (x/y) polymorphism of apolipoprotein B-100. Arterioscler Thromb 1991;11:379-84.

(30.) Xu C, Nanjee N, Tikkanen MJ, Huttunen JK, Pietinen P, Butler R, et al. Apolipoprotein B amino acid 3611 substitution from arginine to glutamine creates the Ag (h/i) epitope: the polymorphism is not associated with differences in serum cholesterol and apolipoprotein B levels. Hum Genet 1989;82:322-6.

(31.) Ma Y, Schumaker VN, Butler R, Sparker RS. Two DNA restriction fragment length polymorphisms (RFLPs) associated with Ag (t/z) and Ag (c/g) antigenic sites of human apolipoprotein B. Arteriosclerosis 1987;7:301-5.

(32.) Dunning AM, Renges HH, Xu CF, Peacock R, Brasseur R, Laxer G, et al. Two amino acid substitutions in apolipoprotein B are in complete allelic association with the antigen group (x/y) polymor phism: evidence for little recombination in the 3' end of the human gene. Am J Hum Genet 1992;50:208-21.

(33.) Knott TJ, Wallis SC, Pease RJ, Powell LM, Scott J. A hypervariable region 3' to the human apolipoprotein B gene. Nucleic Acids Res 1986;14:9215-6.

(34.) Huang LS, Breslow JL. A unique AT-rich hypervariable minisatellite 3' to the ApoB gene defines a high information restriction fragment length polymorphism. J Biol Chem 1987;262:8952-5.

(35.) Lipid Research Clinics Program. Manual of laboratory operations, Vol. 1. Lipid and lipoprotein analysis. NIH publication 75-628. Bethesda, MD: US Department of Health, Education, and Welfare, 1974.

(36.) Boerwinkle E, Xiong W, Fourest E, Chan L. Rapid typing of tandemly repeated hypervariable loci by the polymerase chain reaction: application to the apolipoprotein B 3' hypervariable region. Proc Natl Acad Sci U S A 1989;86:212-6.

(37.) Ludwig EH, Friedl W, McCarthy BJ. High-resolution analysis of a hypervariable region in the human apolipoprotein B gene. Am J Hum Genet 1989;45:458-64.

(38.) Myant NB, Forbes SA, Day IN, Gallagher J. Estimation of the age of the ancestral arginine3500[right arrow]glutamine mutation in human apo B-100. Genomics 1997;45:78-87.

(39.) Cooper DN, Youssoufian H. The CpG dinucleotide and human genetic disease [Review]. Hum Genet 1988;78:151-5.

(40.) Kim KS, Kubota S, Kuriyama M, Fujiyama J, Bjorkhem I, Eggertsen G, Seyama Y. Identification of new mutations in sterol 27hydroxylase gene in Japanese patients with cerebrotendinous xanthomatosis (CTX). J Lipid Res 1994;35:1031-9.

(41.) Jeffreys AJ, Royle NJ, Wilson V, Wong Z. Spontaneous mutation rates to new length alleles at tandem repetitive hypervariable loci in human DNA. Nature 1988;332:278-81.

DER-YAN TAI, [1] JU-PIN PAN, [2] AND GUEY-JEN LEE-CHEN [3] *

[1] Department of Internal Medicine, Wei Gong Memorial Hospital, Tou Fen, Miaoli, Taiwan 351, Republic of China.

[2] Division of Cardiology, Department of Medicine, Veterans General Hospital-Taipei, National Yang-Ming University, School of Medicine, Taipei, Taiwan 112, Republic of China.

[3] Department of Biology, National Taiwan Normal University, Taipei, Taiwan 117, Republic of China.

[4] Nonstandard abbreviations: CHD, coronary heart disease; apo, apolipoprotein; FDB, familial defective apolipoprotein B-100; SSCP, single-strand conformafion polymorphism; and HVR, hypervariable repeat.

* Author for correspondence. Fax 886-2-29312904; e-mail t43019@ cc.ntnu.edu.tw.

Received September 25, 1997; revision accepted May 18, 1998.
Table 1. Specific PCR conditions.

Amplified Primer pairs Annealing Conditions Product
fragment and temperature, size, by
 positions [degrees]C

Exon 26 Xbal-5' 55 1.5 mmol/L 349
 (7461-7483) Mg[Cl.sub.2]
 Xbal-3'
 (7809-7787)
Exon 26 Mael-5' 55 1.5 mmol/L 613
 (8142-8168) Mg[Cl.sub.2]
 Mael-3'
 (8754-8725)
Exon 26 apoB-5' 65 2.0 mmol/L 345
 (10551-10574) Mg[Cl.sub.2]
 apoB-3'
 (10895-10872)
Exon 26 Mspl-5' 57 1.0 mmol/L 386
 (10832-10857) Mg[Cl.sub.2]
 Mspl-3'
 (11217-11193)
Exon 29 EcoRl-5' 55 1.5 mmol/L 376
 (12410-12434) Mg[Cl.sub.2]
 ECORI-3'
 (12785-12761)
Exon 29 Eco571-5' 55 2.0 mmol/L 281
 (12982-13011) Mg[Cl.sub.2]
 ECO571-3'
 (13262-13232)
3' flanking HVR-5' (b) 60 1.5 mmol/L 650~860
region Mg[Cl.sub.2]
 HVR-3' (b)

(a) The nucleotide positions were referred to Ludwig et al. (2).

(b) HVR-5', ggcacagcaaaacctctagaacacatagtg;
HVR-3', ccttctcacttggcaaatagaattcctgag.

Table 2. Hyplotype of 95-020 and 95-026 family members

 Haplotype markers (a)

Subject Haplotype Xba I Mae I 3500W Msp I

Family
95-020
 I-1 (b) A/B -/- +/+ -/+ +/+

 I-2 A/C -/- +/+ -/- +/+
 II-1 C/D -/- +/- -/- +/+
95-020 (b) A/B -/- +/+ -/+ +/+
 II-3 C/E -/- +/+ -/- +/+
 II-4 (b) B/C -/- +/+ +/- +/+
 II-5 (b) B/C -/- +/+ +/- +/+
 II-6 A/A -/- +/+ -/- +/+
 II-7 (b) B/C -/- +/+ +/- +/+
 III-1 A/D -/- +/- -/- +/+

Family
95-026
95-026 (b) B/F -/+ +/- +/- +/+
 II-1 C/F -/+ +/- -/- +/+
 II-2 C/F -/+ +/- -/- +/+
 II-3 C/F -/+ +/- -/- +/+
 II-4 (b) B/C -/- +/+ +/- +/+

 Haplotype markers (a)

Subject Eco Rl Eco571 3'HVR

Family
95-020
 I-1 (b) +/+ +/+ 36/34
 (b)
 I-2 +/+ +/+ 36/34
 II-1 +/+ +/- 34/36
95-020 (b) +/+ +/+ 36/34
 II-3 +/+ +/+ 34/38
 II-4 (b) +/+ +/+ 34/34
 II-5 (b) +/+ +/+ 34/34
 II-6 +/+ +/+ 36/36
 II-7 (b) +/+ +/+ 34/34
 III-1 +/+ +/- 36/36

Family
95-026
95-026 (b) +/+ +/- 34/36
 II-1 +/+ +/- 34/36
 II-2 +/+ +/- 34/36
 II-3 +/+ +/- 34/36
 II-4 (b) +/+ +/+ 34/34

(a) + or -, presence or absence of restricted site; 3'HVR,
number of 15-bp repeats.

(b) R3500W heterozygotes.

(c) Nomenclature according to Ludwig et al. (37).

(d) Haplotype associated with the mutation.

Table 3. Genotypes of R3500W heterozygotes without unequivocal
haplotypes. (a)

 Haplotype marker

 Xba I Mae I FDB Msp I Eco RI Eco571 3'HVR

Subject
 95-040 -/- +/- +/- +/+ +/+ +/- 34/44
 95-129 -/- +/- +/- +/+ +/+ +/- 34/30
 A46 -/- +/+ +/- +/+ +/+ +/+ 34/30
 D10 -/- +/+ +/- +/+ +/+ +/+ 34/30
 D47 -/- +/+ +/- +/+ +/+ +/+ 34/30
 D53 -/- +/+ +/- +/+ +/+ +/+ 34/30
 D149 -/- +/+ +/- +/+ +/+ +/+ 34/36
Haplotype
 B - + + + + + 34

(a) One of the two alleles could be haplotype B (boldface symbols),
as in the case where an unequivocal haplotype was deduced.

Table 4. Lipid characteristics of R3500W heterozygotes
and the 95-020 and 95-026 families.

Subject apo B Sex Age, Cholesterol,
 3500W years mmol/L

95-020 + M 56 7.16
95-026 + M 46 7.34
95-040 + F 70 8.27
95-129 + F 72 7.21
A46 + M 66 5.19
D10 + M 70 7.70
D47 + F 50 8.37
D53 + M 47 7.91
D149 + F 52 7.75

Family
95-020
 I-1 + M 76 5.30
 I-2 - F 76 4.70
 II-1 - F 47 9.82
 II-3 - F 54 4.75
 II-4 + M 47 5.92
 II-5 + F 45 5.40
 II-6 - M 39 3.77
 II-7 + M 37 5.19
 III-1 - F 22 3.88

Family
95-026
 II-1 - M 20 3.00
 II-2 - M 18 3.57
 II-3 - M 16 3.18
 II-4 + M 14 5.04

Subject Triglycerides, Clinical
 mmol/L findings
 (a)
95-020 1.75
95-026 1.78 H/T, TIA
95-040 4.84 DM
95-129 0.95
A46 1.39 CHD
D10 1.28 H/T
D47 1.51
D53 3.54 H/T
D149 1.10 H/T

Family
95-020
 I-1 0.90 DM
 I-2 2.74 H/T
 II-1 1.63
 II-3 1.55
 II-4 1.20
 II-5 0.42
 II-6 0.75
 II-7 1.44
 III-1 0.57

Family
95-026
 II-1 0.77
 II-2 1.10
 II-3 1.08
 II-4 1.52

(a) H/T, hypertension; TIA, transient ischemic attack;
and DM, diabetes mellitus.
COPYRIGHT 1998 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 1998 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Lipids and Lipoproteins
Author:Tai, Der-Yan; Pan, Ju-Pin; Lee-Chen, Guey-Jen
Publication:Clinical Chemistry
Date:Aug 1, 1998
Words:4663
Previous Article:Assessment of current national cholesterol Education Program guidelines for total cholesterol, triglyceride, HDL-cholesterol, and LDL-cholesterol...
Next Article:Radioreceptor assay of an endothelin A receptor antagonist in plasma and urine.
Topics:


Related Articles
Absence of apolipoprotein B-3500 mutation in Turkish patients with coronary and cerebrovascular atherosclerosis/Koroner ve serebrovaskuler...
Lipid disorders and mutations in the APOB gene.
Evaluation of the apo E genotyping kit on the LightCycler.
Flow cytometric assessment of LDL ligand function for detection of heterozygous familial defective apolipoprotein B-100.
Multiple minisequencing screen for seven Southeast Asian nondeletional [alpha]-thalassemia mutations.
Genetic analysis of the CYP2D6 locus in a Hong Kong Chinese population.
Mutations in the apolipoprotein (apo) B-100 receptor-binding region: detection of apo B-100 ([Arg.sup.3500] [right arrow] Trp) associated with two...
Detection of mutations in the apolipoprotein CII gene by denaturing gradient gel electrophoresis. Identification of the splice site variant...
Detecting familial defective apolipoprotein B-100: three molecular scanning methods compared.
Denaturing gradient-gel electrophoresis screening of familial defective apolipoprotein B-100 in a mixed Asian cohort: two cases of...

Terms of use | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters