Printer Friendly

Identificacion Molecular de Salmonella Typhimurium en Cuyes al Primer Parto mediante la Tecnica de PCR Multiple.

MOLECULAR IDENTIFICATION OF SALMONELLA TYPHIMURIUM AND ENTERITIDIS IN GUINEA PIGS AT FIRST PARTURITION BY MULTIPLEX PCR

INTRODUCCION

El cuy (Cavia porcellus) es una especie consumida tradicionalmente por el poblador andino y, en muchos casos, es la base de su economia domestica, pues la especie tiene grandes cualidades alimenticias y productivas. Ademas, es un animal rustico de ciclo de vida corto, por lo que puede ser criado a bajo costo (Ordonez, 2003), adaptandose a zonas frias y calidas (Chauca, 1997).

La produccion de cuyes ha cambiado de crianza familiar a comercial. Sin embargo, se sabe que el indice de produccion en cuyes se ve mermada por la presencia de enfermedades, como es el caso de la salmonelosis. Bacterias del genero Salmonella son comunmente aisladas de cuyes y su presencia esta asociada a un amplio rango de morbilidad y mortalidad en estos animales (Pivnick et al., 1966). Esta enfermedad afecta a todos los estratos etarios y normalmente se relaciona con eventos de estres, pudiendo alcanzar mortalidades de hasta 95% y morbilidad entre 0.9 y 53%, ocasionando signos clinicos muy variados (Morales et al., 2007). Se dispone de un reporte sobre un brote de salmonelosis ocasionada por Salmonella Typhimurium, que afecto a un criadero de 5000 cuyes causando una mortalidad de 100 animales por dia (Morales et al., 1995).

Salmonella se engloba dentro de la familia Enterobacteriaceae y su habitat principal es el tracto intestinal del hombre y los animales. Los miembros de este genero destacan por su gran capacidad de adaptacion, lo que les permite infectar a un amplio rango de hospedadores. De acuerdo a la nomenclatura actual, el genero Salmonella esta conformado por dos especies: S. enterica y S. bongori. S. enterica esta dividida en seis subespecies (enterica, salamae, arizonae, diarizonae, houtenae e indica). Se han descrito 2579 serovariedades de Salmonella, perteneciendo la mayoria de ellas a S. enterica subsp enterica, serotipo responsable de infecciones en humanos y animales de abasto (Grimont y Weill, 2007; OIE, 2010).

Los dos serotipos mas frecuentemente aislados de cuyes son Salmonella Typhimurium y Salmonella Enteritidis (Fish et al, 1968; Morales, 2012; Bartholomew et al., 2014). Perez (1975) reporto en cuyes sin evidencia de signos clinicos la presencia de 1.9% de positivos a Salmonella Typhimurium en el departamento de Lima. Ortega et al. (2015) tomo muestras de hisopados vaginales dentro de las 24 horas del parto, encontrando 11 cuyes positivos a Salmonella spp en una poblacion de 129 hembras con historia de mortinatos. En forma similar, Morales (2012), a partir de hisopados rectales de 38 reproductores machos, los cuales iban a ser introducidos en el distrito de San Marcos, Ancash (en ese momento libre de salmonelosis en centros de crianza familiar comercial), aislo 60 cepas bacterianas, de las cuales 10 resultaron ser Salmonella Typhimurium.

La amplificacion in vitro de ADN mediante la tecnica de reaccion en cadena de la polimerasa (PCR) es una herramienta util en el diagnostico microbiologico (Malorny et al., 2003a). Existen metodos de PCR para detectar cepas de Salmonella mediante secuencias especificas de genes como marcadores (Manzano et al., 1998). El gen invA contiene secuencias unicas para Salmonella (Rahn et al., 1992), de alli que su amplificacion ha sido reconocida como un estandar internacional para la deteccion de Salmonella (Malorny et al., 2003b). Asimismo, el gen fliC codifica la mayoria de los componentes del flagelo de Salmonella enterica serovar Typhimurium (Aldridge et al., 2006).

Salmonella Enteritidis alberga en su genoma un plasmido unico de virulencia de 60 kb (Chu et al., 1999). Este plasmido posee un gen llamado prot6E, el cual probablemente codifica una proteina de superficie unica fimbrial especifica a Salmonella Enteritidis (Clavijo et al., 2006). Actualmente, se viene implementando una tecnica molecular (PCR multiple) empleando estos tres genes, para la identificacion de Salmonella spp, Typhimurium y Enteritidis (Marcelo, 2015).

La salmonelosis usualmente requiere de la intervencion de algun factor que genere estres en el animal (Ramirez, 1972; Radostits et al., 2002). El parto, al igual que la prenez y la lactancia son considerados como factores estresantes para el animal (Radostits et al., 2002), de modo que, si se establece la presencia del agente infeccioso, se podrian generar condiciones favorables para el desarrollo de la salmonelosis despues del primer parto. Por ello, el presente estudio tuvo como objetivo evaluar la presencia de Salmonella Typhimurium y Enteritidis en cuyes hembras primerizas aparentemente sanas de un centro de crianza comercial del distrito de Pachacamac, Lima.

MATERIALES Y METODOS

Lugar del Estudio

La toma de muestras tuvo lugar en un criadero comercial sin registro de brote de salmonelosis en los ultimos cuatro anos. La granja esta ubicada en el distrito de Pachacamac, Lima, Peru. El muestreo se realizo entre mayo a septiembre de 2015 y el procesamiento de las muestras se llevo a cabo en el laboratorio de genetica y biologia molecular de la Facultad de Medicina Veterinaria de la Universidad Nacional Mayor de San Marcos, Lima.

Los cuyes eran criados en pozas, donde se colocaba un macho por 10 hembras bajo un sistema de empadre continuo.

Toma de Muestras

Se realizaron hisopados vaginales y rectales en cuyes reproductoras clinicamente sanas, seleccionandose una hembra por poza. La toma de las muestras fue dentro de la primera semana posparto. El hisopado vaginal se realizo con hisopos esteriles, previa limpieza de la zona con suero fisiologico, en tanto que el hisopado rectal se realizo frotando el hisopo contra la pared de la cavidad rectal. Los hisopos fueron almacenados en tubos con agua peptonada tamponada (APT) y conservados a 4 [grados]C para su inmediato transporte al laboratorio.

Procesamiento de las Muestras

Se evaluaron 272 muestras pareadas (hisopado vaginal y rectal por animal).

Los hisopados contenidos en caldo APT fueron incubados a 37 [grados]C por 18 h. Posteriormente 1 ml de cada muestra fue cultivada en caldo Rappaport Vassiliadis Soya (RVS) siguiendo la proporcion de 1:9 e incubados a 42 [grados]C por 24 h. Luego, se cultivo en agar Xilosa Lisina Desoxicolato (XLD) por 24 h, para seleccionar a los aislados sospechosos y ser sometidos a cinco pruebas bioquimicas: agar hierro lisina (LIA), agar hierro tres azucares (TSI), medio SIM, agar urea, agar citrato de Simmons. El metodo microbiologico utilizado se baso en protocolos del Laboratorio de Global Salm Surv de la Organizacion Mundial de la Salud (WHO, 2010), siguiendo la norma ISO:6579 (2007)

La extraccion de ADN se hizo de los aislados sospechosos utilizando un kit de extraccion de ADN bacteriano GF-1 (Vivantis, EEUU). Se siguio el protocolo de Marcelo (2015), donde se realizo una PCR multiple utilizando tres pares de cebadores, los cuales codifican las secuencias de los genes inv A, fliC y prot6E para la identificacion de genero como de los serotipos Typhimurium y Enteritidis, respectivamente (Cuadro 1). Los productos de PCR multiple fueron separados mediante electroforesis en gel de agarosa al 2% en la camara de electroforesis horizontal. Para evidenciar las bandas de ADN amplificadas, el gel fue tenido con bromuro de etidio y visualizado en un transiluminador de luz ultravioleta (Cleaver Scientific).

RESULTADOS

Salmonella spp fue aislada en el 2.9% de los cuyes (8/272). Ocho cuyes fueron positivos en el hisopado rectal y de estos, cuatro fueron, ademas, positivos en hisopado vaginal. Los 12 aislados fueron sometidos al PCR multiple, donde amplificaron el gen inv A correspondiente al genero Salmonella. De estos aislados, 10 resultaron positivos a Salmonella Typhimurium (Figura 1) y los 2 restantes no pertenecian al serovar Typhimurium ni al serovar Enteritidis (Cuadro 2).

DISCUSION

Las reproductoras en estudio provinieron de un solo criadero, donde segun informacion del criador no presentaban brotes de salmonelosis desde hace cuatro anos; sin embargo, ocho cuyes (2.9%) resultaron positivas a Salmonella spp mediante pruebas bacteriologicas. Esta frecuencia es similar al estudio de Ortega et al. (2015), quienes encuentran positivos a Salmonella al 2.3% de cuyes hembras recien paridas y sin antecedentes de problemas reproductivos.

La presencia de Salmonella spp en los animales, especialmente del serotipo Typhimurium, podria indicar la presencia de cuyes que estarian actuando como portadores del agente patogenico y, a la vez, como diseminadores para el desencadenamiento de brotes de salmonelosis. Dado los resultados obtenidos, se sugiere que estos animales podrian ser portadores asintomaticos del serotipo Typhimurium en bajos porcentajes.

En el Peru aun no ha sido reportado el serovar Salmonella Enteritidis en cuyes; sin embargo, fue aislado de un brote en cuyes para produccion en Canada, donde morian 20 a mas animales por dia (Fish et al., 1968) y en cuyes criados como mascotas en EEUU (Bartholomew et al., 2014). En ambos casos, los propietarios fueron infectados por este serovar, determinando asi el riesgo de transmision del animal al ser humano por contacto directo con animales aparentemente sanos, asi como con animales enfermos.

Los resultados del presente estudio confirman la presencia de Salmonella Typhimurium como el serovar predominante en cuyes reproductoras, tal como fue reportado por Perez (1975) en una hembra adulta aparentemente sana de un criadero sin antecedente de brote. Okewole et al. (1989) aislaron Salnonella Typhimurium del utero de cuyes, y al inocular estos aislados por via venosa desarrollaron lesiones en utero; asimismo, tambien se reporta su aislamiento de la glandula mamaria (Perez, 1975; Ramirez, 1972; Matsuura et al., 2010). En el presente estudio, es posible que las hembras hayan podido superar la infeccion tiempo atras y estuvieran comportandose como portadoras; por ello, la expulsion del agente por el tracto reproductivo, encontrado en los hisopados vaginales.

En las pozas de la granja en estudio habia una diversidad de edades y de numero de partos entre las hembras, de alli es que no todas las hembras positivas a Salmonella Typhimurium hayan estado expuestas a este agente en un momento dado, pero al compartir el mismo espacio con hembras portadoras se haya propiciado la transmision de la bacteria. Ademas, los criaderos usualmente introducen reproductores para la mejora de la produccion; sin embargo, no siempre se toman muestran de los animales a ser introducidos. Asi se tiene el caso de cuyes introducidos a centros de sistema de crianza familiar-comercial en el distrito de San Marcos donde se evaluaron los de machos reproductores que iban a ser introducidos aislandose Salmonella Typhimurium (Morales, 2012). Estas experiencias remarcan la importancia de analisis previos de animales a ser introducidos en las granjas.

CONCLUSIONES

* Salmonella Typhimurium fue el serotipo predominante de Salmonella spp en hembras de primer parto y sin signos clinicos de enfermedad, en un criadero de cuyes de la zona de Pachacamac, Lima.

* El porcentaje de prevalencia de Salmonella sp en hisopados vaginales y rectales fue de 2.9% (8/272).

http://dx.doi.org/10.15381/rivep.v28.i3.13288

Agradecimientos

Los autores expresan su agradecimiento al Programa Nacional de Innovacion para la Competitividad y Productividad--Innovate Peru, fuente financiadora del Proyecto "Desarrollo de una vacuna para el control y prevencion de la salmonelosis en la produccion de cuyes", Contrato No 362-PNICP-PIAP-2014. A los propietarios del centro de crianza de cuyes, Sres. Eduardo Lopez y Yenny Castro, por brindar las facilidades para realizar el estudio. A Laura Cordova, Gerardo Diaz y Geraldine Marcelo por su apoyo incondicional durante las tomas de muestra y a Rocio Rimac por su aporte en el desarrollo del estudio.

LITERATURA CITADA

[1.] Aldridge P, Gnerer J, Karlinsey JE, Hughes KT. 2006. Transcriptional and translational control of the Salmonella fliC gene. J Bacteriol 188: 4487-4496.

[2.] Bartholomew M, Heffernan R, Wright J, Klos R, Monson T, Khan S, Trees E, et al. 2014. Multistate outbreak of Salmonella enterica serotype Enteritidis infection associated with pet guinea pigs. Vector Borne Zoonotic Dis 14: 414-421. doi: 10.1089/vbz.2013.1506

[3.] Chauca L. 1997. Produccion de cuyes (Cavia porcellus). Lima: Organizacion de las Naciones Unidas para la Agricultura y la Alimentacion. 80 p.

[4.] Chu C, Hong S, Tsai C, Lin W, Liu T, Ou J. 1999. Comparative physical and genetic maps of the virulence plasmids of Salmonella enterica serovars Typhimurium, Enteritidis, Choleraesuis, and Dublin. Infect Immun 67: 2611-2614.

[5.] Clavijo R, Loui C, Andersen G, Riley L, Lu S. 2006. Identification of genes associated with survival of Salmonella enterica serovar Enteritidis in chicken egg albumen. Appl Environ Microbiol 72: 1055-1064. doi: 10.1128/AEM.72.2. 1055-1064.2006

[6.] Fish NA, Fletch AL, Butler WE. 1968. Family outbreak of salmonellosis due to contact with guinea pigs. Can Med Assoc J 99: 418-420

[7.] Grimont PA, Weill FX. 2007. Antigenic formulae of the Salmonella serovars. 9th ed. Paris, France: WHO Collaborating Centre for Reference and Research on Salmonella. 166 p.

[8.] Habermann R, Williams, F Jr. 1958. Salmonellosis in laboratory animals. J Ntl Cancer Inst 20: 933-947.

[9.] [ISO] International Organization for Standardization. 2012. ISO 6579:2002. Microbiology of food and animal feeding stuffs--Horizontal method for the detection of Salmonella spp. [Internet] Disponible en: http://www.iso.org/iso/ catalogue_detail .htm?csnumber=29315

[10.] Jamshidi A, Kalidari G, Hedayati M. 2010. Isolation and identification of Salmonella Enteritidis and Salmonella Typhimurium from the eggs of retail stores in Mashhad, Iran using conventional culture method and multiplex PCR assay. J Food Safety 30: 558-568. doi: 10.1111/j. 17454565.2010.00225.x

[11.] Malorny B, Hoorfar J, Hugas M, Heuvelink A, Fach P, Ellerbyoek L, Bunge C, et al. 2003a. Interlaboratory diagnostic accuracy of a Salmonella specific PCR-based method. Int J Food Microbiol 89: 241-249. doi: 10.1016/ S0168-1605(03)00154-5

[12.] Malorny B, Hoorfar J, Bunge C, Helmuth R. 2003b. Multicenter validation of the analytic accuracy of Salmonella PCR: toward an international standard. Appl Environ Microbiol 69: 290-296. doi: 10.1128/ AEM.69.1.290-296.2003

[13.] Manzano M, Cocolin L, Astori G, Pipan C, Botta G, Cantoni C, Comi G 1998. Development of a PCR microplate-capture hybridization method for simple, fast and sensitive detection of Salmonella serovars in food. Mol Cell Probes 12: 227-234. doi: 10.1006/ mcpr.1998.0176

[14.] Marcelo G. 2015. Identificacion de Salmonella Enteritidis y Typhimurium aislada de cuyes mediante la tecnica de reaccion en cadena de la polimerasa multiple. Tesis de Medico Veterinario. Lima: Univ Nacional Mayor de San Marcos. 51 p.

[15.] Matsuura A, Morales S, Calle S, Ara M. 2010. Susceptibilidad a antibacterianos in vitro de Salmonella enterica aislada de cobayos de crianza familiar-comercial en la provincia de Carhuaz. Rev Inv Vet Peru 21: 93-99. doi: 10.15381/rivep.v21i1.355

[16.] Morales C, Hung A, Alvarado A. 1995. Mortalidad por salmonelosis en cobayos. En: XVIII Reunion cientifica Anual de la Asociacion Peruana de Produccion Animal (APPA). Lambayeque.

[17.] Morales S, Mattos J, Calle S. 2007. Efecto de la muna (Satureja parvifolia) en la dinamica de la infeccion por Salmonella enterica en cobayos. En: XXX Reunion Cientifica de la Asociacion Peruana de Produccion Animal (APPA). Cusco, Peru.

[18.] Morales S. 2012. Patogenos oportunistas por transmision fecal-oral en cuyes reproductores introducidos al distrito de San Marcos. Cientifica 9(1): 33-36.

[19.] [OIE] World Organisation for Animal Health. 2010. Salmonellosis. [Internet]. Disponible en: http://www.oie.int/ fileadmin/Home/eng/Health_standards/ tahm/2008/pdf/2.09.09_salmonellosis.pdf

[20.] Okewole PA, Uche E, Oyetunde I, Odeyemi P, Dawul PB. 1989. Uterine involvement in guinea pig salmonellosis. Lab Anim 23: 275-277. doi: 10.1258/ 002367789780810518

[21.] Ordonez R. 2003. Plan de introduccion de la carne de cuy en Lima Metropolitana: estudio de mercado y propuesta empresarial. Tesis de Magister. Lima: Pontificia Universidad Catolica del Peru. 213 p.

[22.] Ortega G, Jimenez R, Ara A, Morales S. 2015. La salmonelosis como factor de riesgo de mortinatalidad en cuyes. Rev Inv Vet Peru 26: 676-681. doi: 10.15381/rivep.v26i4.11203

[23.] Perez ZN. 1975. Investigacion de salmonelas en cobayos (Cavia porcellus) aparentemente normales. Tesis en de Biologo. Lima: Univ Nacional Mayor de San Marcos. 19 p.

[24.] Pivnick H, Stuart P, Walcroft M. 1966. Establishment of a Salmonella-free guinea pig colony. The Can J Comp Med Vet Sci 30: 279-281.

[25.] Radostits OM, Gay CC, Blood DC, Hinchcliff KW. 2002. Tratado de enfermedades del ganado bovino, ovino, caprino y equino. 9a ed. Madrid: McGraw-Hill. 959 p.

[26.] Rahn K, De Grandis S, Clarke R, Mcewen S, Galan JE, Ginocchio C, Curtiss R III, Gyles CL. 1992. Amplification of an inv A gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol Cell Probes 6: 271-279. doi: 10.1016/ 0890-8508(92)90002-F

[27.] Ramirez I. 1972. Estudio bacteriologico y epidemiologico de un brote infec cioso en cobayos (Cavia porcellus). Tesis de Medico Veterinario. Lima: Univ Nacional Mayor de San Marcos. 62 p.

[28.] WHO Global Foodborne Infections Network. 2010. Laboratory Protocol "Isolation of Salmonella spp from food and animal faeces". 5th ed. [Internet]. Disponible en: http://www.antimicrobial-resistance. dk/data/images/protocols/ isolation_of_salm_220610.pdf

Ana Chero O. (1), Raul Rosadio A. (1), Geraldine Marcelo M.1, Gerardo Diaz O. (1), Ronald Jimenez A. (3), Yenny Castro G. (1), Lenin Maturrano H. (1,2,4)

(1) Laboratorio de Microbiologia y Parasitologia Veterinaria, (2) Laboratorio de Zootecnia y Produccion Agropecuaria, Facultad de Medicina Veterinaria, Universidad Nacional Mayor de San Marcos, Lima, Peru

(3) Estacion Experimental del Centro de Investigacion IVITA--El Mantaro, Facultad de Medicina Veterinaria, Universidad Nacional Mayor de San Marcos, Huancayo, Peru

(4) E-mail: lenin.maturrano@gmail.com

Recibido: 18 de mayo de 2016

Aceptado para publicacion: 31 de marzo de 2017

Leyenda: Figura 1. Productos de PCR multiple de los aislamientos de Salmonella Typhimurium. M, Marcador de peso molecular 100 pb DNA ladder; SE, control positivo de Salmonella Enteritidis (ATCC 13076); ST, control positivo de Salmonella Typhimurium (ATCC 14028). Carril 1, muestra negativa; carriles 2 al 5, aislados positivos a Salmonella serovar Typhimurium (559 pb)
Cuadro 1. Cebadores empleados en la PCR Multiple para identificar al
genero Salmonella y Salmonella serovar Typhimurium y Enteritidis
(Jamshidi et al., 2010)

Especie / serovar      Gen             Secuencia            Tamano
                                 5' [flecha diestra] 3'      (pb)

Salmonella spp         invA    GTGAAATTATCGCCACGTTCGGGCAA    284
                                 TCATCGCACCGTCAAAGGAACC
Serovar Typhimurium    fliC      CGGTGTTGCCCAGGTTGGTAAT      559
                                 ACTCTTGCTGGCGGTGCGACTT
Serovar Enteritidis   prot6E      ATATCGTCGTTGCTGCTTCC       185
                                 CATTGTTCCACCGTCACTTTG
COPYRIGHT 2017 Universidad Nacional Mayor de San Marcos
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Chero O., Ana; Rosadio A., Raul; Marcelo M., Geraldine; Diaz O., Gerardo; Jimenez A., Ronald; Castro
Publication:Revista de Investigaciones Veterinarias del Peru (RIVEP)
Date:Jul 1, 2017
Words:3145
Previous Article:Dano Cardiaco en Ratones Ovariectomizados y Experimentalmente Infectados con Trypanosoma cruzi.
Next Article:Identificacion de la Microbiota Levaduriforme en Canal Auditivo de Porcinos con y sin Secrecion Otica.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters