Printer Friendly

IL-11 play important role in scoliosis patients.

INTRODUCTION

The aetiology and pathogenesis of adolescent idiopathic scoliosis (AIS) remain unclear [1]. The aetiology is believed to be multifactorial, including such factors as growth, hormonal secretion and gravity [2-5]. However, none of these parameters has been shown individually to play a causative role. Burner, Badger and Sherman [6, 7] first noted an association between osteopenia and AIS using the Singh index [8]. Generalised low bone mass and osteopenia in the axial and the peripheral

Skeleton have been described in AIS12-16 along with abnormal histomorphometric bone cell activity in bone biopsies [9]. As the low bone mass in AIS patients is likely to persist into adulthood [10]. There is increasing concern that adolescents with idiopathic scoliosis might have a lower peak bone mass, thereby increasing the risk of osteoporosis and related complications in later life [14, 15]. However, the precise mechanism and causes of bone loss in AIS have not been identified.

Osteoporosis is defined as a reduction in the microarchitecture of bone, resulting in an increase in fragility and the risk of fracture. It is a complex disorder, with interactions between environmental and genetic factors. The latter account for 50% to 80% of the inter-individual variability in bone mineral density (BMD) and several studies have demonstrated a relationship between polymorphisms of candidate genes with a decrease in BMD and an increased risk of fracture [16, 17].

Several studies have suggested that immunological factors such as interleukins and tumour necrosis factors might influence the development of osteoporosis. Interleukin-11 (IL-11) is a multifunctional cytokine essential in the differentiation and function of osteoclasts 24, 25 and IL-11 and its receptor are possible pathogenic factors in conditions associated with bone loss [26, 27]. Clinical studies have shown that IL-11 mRNA expression in bone is enhanced in 95% of patients with osteoporotic vertebral fracture but in only 50% of postmenopausal controls [26]. Therefore, the genes of any component of IL-11 might be candidates for osteoporosis. Some investigators have evaluated the association between IL-11 gene polymorphisms and BMD in postmenopausal women [14] but there are no reports linking the association between bone mass in patients with AIS and IL-11 gene polymorphism. We examined the association between bone mass in girls with AIS and IL-11 gene polymorphism and compared these with their levels in healthy controls.

MATERIAL AND METHODS

We enrolled 198 girls with a mean age of 12.5 years (11.1 to 13.9), newly diagnosed with AIS and 120 healthy girls recruited from routine school screenings, with a mean age of 12.7 years (11.0 to 13.9) between 07, 2011 till 08.2012 in the 5th hospital of Paris university. The diagnosis of AIS was confirmed through a detailed medical history, physical examination and standard radiographs. The year since menarche and the Risser sign were also evaluated. Those receiving any form of treatment for scoliosis were excluded. Girls with a history of congenital deformities, neuromuscular disease, endocrine disease, skeletal dysplasia, connective tissue abnormalities, mental retardation, inflammatory diseases and use of medication known to affect bone metabolism were also excluded. All subjects and their parents gave informed consent before participating in the study, which was approved by the Clinical Research Ethics Committee of the university and hospital.

For the evaluation of scoliosis, normal standing whole spine anteroposterior radiographs were taken for each patient at their first presentation, using a standard technique to measure the Cobb angle. If more than one curve was found, the most severe was selected for the measurement. Curves < 10[degrees] were excluded.

The BMD of the lumbar spine and that of the neck of the non-dominant proximal femur were measured by dualenergy X-ray absorptiometry (DEXA, XR-36; Norland Corp., Fort Atkinson, Wisconsin). For the measurement of biochemical markers of bone turnover, blood samples were collected between 8:00 am and 10:00 am after an overnight fast. The samples of plasma and serum were analysed in a routine laboratory using standard procedures according to the specifications of the manufacturers. Osteocalcin in heparinised plasma was measured by a solid-phase two-site chemiluminescent enzyme-labelled immunometric assay (Immulite Osteocalcin, Diagnostic Product Corporation, Los Angeles, California). Serum alkaline phosphatase was measured by radioimmuno assay (Tandem-R Ostase, Beckman Coulter, Fullerton, California). Serum 25(OH)[D.sub.3] and 1,25[(OH).sub.2] [D.sub.3] levels were measured by radio immuno-assay (RIA) using the IDS (Immunodiagnostic System Limited, Boldon, United Kingdom). The intra- and inter-assay variabilities for 25(OH)[D.sub.3] and 1,25[(OH).sub.2][D.sub.3] are < 10%.

For genotyping the genomic DNA was extracted from the peripheral blood leucocytes using a QIAamp DNA blood kit (Qiagen GmbH, Hilden, Germany). The polymorphic regions of the IL-11 gene were amplified by polymerase chain reaction (PCR) with the specific forward primers (GCAAAGTCCTCACTGGGAGGA for -597 G [right arrow] A, GCAAAGTCCTCACTGGGAGGA for -572 G [right arrow] C and AATGACGACCTAAGCTGCAC for -174 G [right arrow] C), and with the specific reverse primers (GGGCTGCGATGGAGTCAGA for -597 G [right arrow] A, GGGCTGCGATGGAGTCAGA for -572 G [right arrow] C and TTGATAAATCTTTGTTGGAGGGTG for-174 G [right arrow] C). The PCR was carried out in a mixture of 1.25 pmol of each primer, 50 ng genomic DNA, 250 M dNTPs and 0.15 U TaqMan nuclease method (Applied Biosystems, Foster City, California) provided by the manufacturer. Amplication was carried out in a GeneAmp PCR system 9700 thermal cycler (Applied Biosystems). Their sequences were determined by cycle sequencing using an ABI PRISM Bigdye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems) on an automated DNA sequencer (ABI PRISM 310, Perkin Elmer Applied Biosystems, Foster City, California).

This was performed using SPSS 11.5 software for Windows (SPSS Inc., Chicago, Illinois). The data are expressed as the mean (SD). The Hardy-Weinberg equilibrium was tested for each single nucleotide polymorphism (SNP) and group of participants using the chisquared test. The frequency distributions of genotypes in the AIS and healthy controls were compared for each SNP studied using the chi-squared test. The groups were compared using a t test, ANOVA and non-parametric Kruskal Wallis test, where appropriate. A p-value < 0.05 was considered significant.

RESULTS AND DISCUSSION

The mean Cobb angle for patients with scoliosis was 24.8[degrees] (16[degrees] to 69[degrees]). A total of 16.7% (n = 33) of girls with AIS were premenarchal when their curvature was detected and 165 were post menarchal, with a mean of 1.4 years (0.2 to 4.0) since menarche. In the AIS group, 76.8% (n = 152) were of Risser grades 0 (n = 42), 1 (n = 59), and 2 (n = 51).

There were 131 thoracic, 47 double, ten thoracolumbar and ten lumbar curves. The genotype frequencies of all SNPs studied were determined by screening DNA samples from 318 subjects (AIS group = 198, control = 120). The genotype frequencies of the subgroups are summarised in Table I. The genotype frequency distributions of all three polymorphic SNPs were in Hardy-Weinberg equilibrium. Comparison of genotype frequencies between patients with AIS and controls revealed statistically significant differences in IL11-572 G [right arrow] C polymorphism (p = 0.0305). IL11-597 G [right arrow] A and IL11-174 G [right arrow] C were totally linked together and showed very rare allele frequencies in both groups.

The investigations for the two groups are presented in Table II. For each genotype, the difference in age, BMI, cBMI and biochemical markers between genotype subgroups were compared in AIS and the healthy controls. No statistically significant differences were identified. The mean lumbar spine and femoral neck BMD in patients with AIS were decreased compared with those controls (p = 0.0022 and p = 0.0013, respectively).

The IL11-572 G [right arrow] C polymorphism was significantly associated with lumbar spine BMD but not with femoral neck BMD (Table III). The former in AIS patients with the CC genotype was significantly higher than in the AIS patients with the GC (p = 0.0124) or GG (p = 0.0066) genotypes. However, the loci IL11-597 G [right arrow] A and IL11-174 G [right arrow] A were not analysed statistically because the rare allele frequencies in the AIS group were too low (p = 0.002).

Discussion:

Generalised low bone mass and osteopenia in the axial and peripheral skeleton have been described in patients with AIS [15-18], the precise mechanism of bone loss in these patients in unclear. Recently, many studies have reported that gene polymorphism was related to osteoporosis, but few have linked gene polymorphism and bone mass in AIS [25]. The IL-11 receptor gene is one of the candidate genes for osteopenia and osteoporosis. Several genetic association studies with IL-11 receptor polymorphism have yielded different genetic backgrounds [28-30, 34-38].

It was difficult to study the genetic effects of the IL11 -174 polymorphism because of its very low frequency in the Frence population.

A study using haplotype analysis is believed to be as effective in determining the genetic contributions of common diseases. The SNPs in the IL-11 promoter region are in complete and/or absolute linkage disequilibrium, so that only three haplotypes (ACC, GCG and GGG) of the possible eight are observed. Generally, haplotypes are more informative than single SNPs, but, the case haplotypes in the IL-11 promoter region, are not informative in association studies of complex trait diseases such as osteoporosis because of the very low frequencies of IL11-597 G [right arrow] A and IL11-174 G [right arrow] A in Asians [28, 29]. Our results also revealed the very low frequencies of IL11-597 G [right arrow] A and IL11-174 G [right arrow] A. This study examined the IL11-597 G [right arrow] A, IL11-572 G [right arrow] C and IL11-174 G [right arrow] C polymorphisms in the IL-11 gene promoter region in order to identify the genes involved in the regulation of bone mass in Frence patients with AIS, who represent an ethnically homogeneous population. We compared the frequencies of genotype in AIS with those in healthy controls and observed a significant difference in the genotype frequencies for IL11-572 G [right arrow] C polymorphism, which was associated with lumbar spine BMD in patients with AIS. The prevalence of the three IL11-572 G [right arrow] C genotypes in these subjects were GG 62.6%, GC 32.3% and CC 2.0%. Patients with AIS who had the C allele had a significantly higher lumbar spine BMD but not femoral neck BMD. Our findings are similar to those reported in other studies [28, 29]. There were some limitations to this study. The number of samples tested was relatively small, which diminishes its statistical power and the possibility of detecting correlations. Only some patients had a lumbar curve of > 30[degrees], which can diminish reliability in the measurement of BMD of the lumbar spine. Further studies with a larger and more homogeneous group of patients are recommended. We did not evaluate interactions with other genes, such as the oestrogen receptor gene, or other relevant gene polymorphisms, such as the calcium-sensing receptor gene. The association with other factors, such as the markers of bone metabolism, bone quality and other candidate genes, should also be tested. We examined the association between BMD and IL11-572 G [right arrow] A gene polymorphisms in Frence girls diagnosed with AIS. The IL11-572 G [right arrow] C polymorphism was found to influence lumbar spine BMD, but the definite mechanism for the low bone mass in AIS is unknown.

ARTICLE INFO

Article history:

Received 25 June 2014

Received in revised form 8 July 2014

Accepted 10 August 2014

Available online 30 August 2014

REFERENCES

[1] Mohammad Nasiri, Akbar Asghari, 2013. A Survey of Relationship between scoliosis, lordosis and kyphosis with self-concept, body image and depressive mood among male students of Islamic Azad University of khoy branch, Advances in Environmental Biology, 7(5): 928-937.

[2] Sarina Sulaiman, A.R. Abdul Aziz, Mohamed Kheireddine Aroua, 2014. Biodiesel Production from Solid Coconut Waste, Advances in Environmental Biology, 8(3): 781-786.

[3] Ahn UM., NU. Ahn, L. Nallamshetty, 2002. The etiology of adolescent idiopathis scoliosis. Am J Orthop, 31: 387-95.

[4] Ford, DM., KM. Bagnall, CA. Clements, KD. McFadden, 1988. Muscle spindles in the paraspinal musculature of patients with adolescent idiopathic scoliosis. Spine, 13: 461-5.

[5] Ford, DM., KM. Bagnall, KD. McFadden, BJ. Greenhill, VJ. Raso, 1984. Paraspinal muscle imbalance in adolescent idiopathic scoliosis, 9: 373-11.

[6] Kindsfater, K., T. Lowe, D. Lawellin, D. Weinstein, J. Akmakjian 1994. Levels of platelet calmodulin for the prediction of progression and severity of adolescent idiopathic scoliosis. J Bone Joint Surg [Am], 76A: 1186-92.

[7] Machida, M., J. Dubousset, Y. Imamura, 1994. Pathogenesis of idiopathic scoliosis: SEPs in chicken with experimentally induced scoliosis and in patients with idiopathic scoliosis. J Pediatr Orthop, 14: 329-35.

[8] McCarrey, JR., UK. Abbott, DR. Benson, RS. Riggins, 1981. Genetics of scoliosis in chickens. J Hered, 72: 6-10.

[9] Stiwell, DL. Jr. 1962. Structural deformities of vertebrae: bone adaptation and modeling in experimental scoliosis and kyphosis. J Bone Joint Surg [Am], 44-A: 611-34.

[10] Suh, KT., SS. Lee, SJ. Kim, YK. Kim, JS. Lee, 2007. Pineal gland metabolism in patients with adolescent idiopathic scoliosis. J Bone Joint Surg [Br], 89-B: 66-71.

[11] Wand, ED., DS. Drummond, JP. Dormans, 1997. Scoliosis in patients treated with growth hormone. J Pediatr Orthop, 17: 708-11.

[12] Burner, WL. 3rd, VM. Badger, FC. Sherman, 1982. Osteoporosis and acquired back deformities. J Pediatr Orthop, 2: 383-5.

[13] Singh, M., AR. Magrath, PS. Maini, 1970. Changes in trabecular pattern of the upper end of the femur as an index of osteoporosis. J Bone Joint Surg [Am], 52-A: 457-117.

[14] Cheng, JC., X. Guo, AH. Sher, 1999. Persistent osteopenia in adolescent idiopathic scoliosis: a longitudinal study, 24: 1218-22.

[15] Cheng, JC., L. Qin, CS. Cheung, 2000. Generalized low areal and volumetric bone mineral density in adolescent idiopathic scoliosis. J Bone Miner Res, 15: 1587-95.

[16] Cook, SD., AF. Harding, EL. Morgan, 1987. Trabecular bone mineral density in idiopathic scoliosis. J Pediatr Orthop, 7: 168-74.

[17] Suh, KT., SS. Lee, SH. Hwang, SJ. Kim, JS. Lee, 2007. Elevated soluble receptor activator of nuclear factor-kappaB ligand and reduced bone mineral density in patients with adolescent idiopathic scoliosis. Eur Spine J. 16: 1563-9.

[18] Thomas, KA., SD. Cook, TC. Skalley, 1992. Lumbar spine and femoral neck bone mineral density in idiopathic scoliosis: a follow-up study. J Pediatr Orthop, 12: 235-40.

[19] Cheng, JC., SP. Tang, X. Guo, CW. Chan, L. Qin, 2001. Osteopenia in adolescent idiopathic scoliosis: a histomorphometric study, 26: E19-23.

[20] Fang, Y., JB. van Meurs, AP. Bergink, 2003. Cdx-2 polymorphism in the promoter region of the human vitamin D receptor gene determines susceptibility to fracture in the elderly. J Bone Miner Res. 18: 1632-41.

[21] Ioannidis, JP., SH. Ralston, ST. Bennett, Genomos Study, 2004. Differential genetic effects of ESR1 gene polymorphisms on osteoporosis outcomes, 292: 2105-14.

[22] Murray, RE., F. McGuigan, SF. Grant, DM. Reid, SH. Ralston, 1997. Polymorphisms of the interleukin-11 gene are associated with bone mineral density, 21: 89-92.

[23] Uitterlinden, AG., H. Burger, Q. Huang, 1998. Relation of alleles of the collagen type lalpha1 gene to bone density and the risk of osteoporotic fractures in postmenopausal women. N Engl J Med., 338: 1016-21.

[24] Uitterlinden, AG., HA. Pols, H. Burger, 1996. A large-scale population-based study of the association of vitamin D receptor gene polymorphisms with bone mineral density. J Bone Miner Res., 11: 1241-8.

[25] Van Meurs, JB., SC. Schuit, AE. Weel, 2003. Association of 5' estrogen receptor alpha gene polymorphisms with bone mineral density, vertebral bone area and fracture risk. Hum Mol Genet. 12: 1745-54.

[26] Roodman, GD., 1992. Interleukin-11: an osteotropic factor? J Bone Miner Res, 7: 475-8.

[27] Ralston, SH., 1994. Analysis of gene expression in human bone biopsies by polymerase chain reaction: evidence for enhanced cytokine expression in postmenopausal osteoporosis. J Bone Miner Res., 9: 883-90.

[28] Ota, N., T. Nakajima, I. Nakazawa, 2001. A nucleotide variant in the promoter region of the interleukin-11 gene associated with decreased bone mineral density. J Hum Genet. 46: 267-72.

[29] Chung, HW., JS. Seo, SE. Hur, 2003. Association of interleukin-11 promoter variant with bone mineral density in pre-menopausal women. J Hum Genet, 48: 243-8.

[30] Huang, QY., H. Shen, HY. Deng, 2003. Linkage and association of the CA repeat polymorphism of the IL11 gene, obesity-related phenotypes, and bone mineral density (BMD) in two independent Caucasian populations. J Hum Genet, 48: 430-7.

[31] Bustamante, M., X. Nogues, L. Mellibovsky, 2007. Polymorphisms in the interleukin-11 receptor gene are associated with bone mineral density and body mass index in Spanish postmenopausal women. Eur J Endocrinol, 157: 677-84.

[32] Moffett, SP., JM. Zmuda, JA. Cauley, 2004. SOF Research Group. Association of the G-174C variant in the interleukin-11 promoter region with bone loss and fracture risk in older women. J Bone Miner Res. 19: 1612-18.

[33] Ferrari, SL., P. Garnero, S. Emond, 2001. A functional polymorphic variant in the interleukin-11 gene promoter associated with low bone resorption in postmenopausal women. Arthritis Rheum. 44: 196-201.

[34] Cheng, JC., X. Guo, 1997. Osteopenia in adolescent idiopathic scoliosis: a primary problem or secondary to the spinal deformity? 22: 1716-21.

[35] Eun, IS., WW. Park, KT. Sch, JL Kim, JS. Lee, 2009. Association between osteoprotegerin gene polymorphisim and bone mineral density in patients with adolescent idiopathic scoliosis. Eur Spine J. 18: 1936-40.

[36] Fedetz, M., F. Matesanz, M. Pascual, 2001. The -174/-597 promoter polymorphisms in the interleukin-11 gene are not associated with susceptibility to multiple sclerosis. J Neurol Sci. 190: 69-72.

[37] Helmy, N., FE. Maly, L. Bestmann, 2001. Detection of the single-base substitution -174 G [right arrow] A in the interleukin-11 gene by real-time polymerase chain reaction: comment on the article by Moos et al. Arthritis Rheum, 44: 2213-14.

[38] Zhai, R., G. Liu, C. Yang, 2001. The G to C polymorphism at -174 of the interleukin-11 gene is rare in a Southern Chinese population. Pharmacogenetics, 11: 699-701.

[39] Fishman, D., G. Faulds, R. Jeffrey, 1998. The effect of novel polymorphisms in the interleukin-11 (IL-11) gene on IL-11 transcription and plasma IL-11 levels, and an association with systemic-onset juvenile chronic arthritis. J Clin Invest. 102: 1369-76.

[40] Manolagas, SC., 1998. The role of IL-11 type cytokines and their receptors in bone. Ann N Y Acad Sci., 840: 194-204.

(1) Farshid Moshiri, (2) Mihai Stanciulescu, (3) Julien Serane, (4) Nabil el Koumiti, (5) Edouard Lefevre

(1,2,3,4,5) Department of Orthopedic, the 5th hospital of Paris University-Paris-France

Correspond Author: Farshid Moshiri, Department of Orthopedic, the 5th hospital of Paris University-Paris-France,

E-mail: submission1999@gmail.com
Table 1: Genotype frequency distributions in patients with adolescent
idiopathic scoliosis (AIS) and healthy controls

Genotype                 AIS (n=198)   Controls (n=120)   P-Value

-597 G [right arrow] A
GG                           197             119
GA                            1               1
AA                            0               0
-572 G [right arrow] C
GG                           130              67          0.0305
GC                           64               44
CC                            4               9
-174 G [right arrow] C
GG                           197             119
GA                            1               1
AA                            0               0

Table 2: Genotype frequency distributions in adolescent idiopathic
scoliosis (AIS) and healthy controls

                                          AIS (n=198)

Age (yrs)                             12.5 (11.1 to 13.9)
BMI *                                 18.0 (15.0 to 23.9)
cBMI *                                17.7 (14.8 to 23.6)
25(OH)[D.sub.3] (ng/ml)                14.3 (5.2 to 26.7)
1.25[(OH).sub.2][D.sub.3] (ng/ml)     79.4 (29.4 to 127.5)
Osteocalcin (mg/l)                     25.6 (7.3 to 43.0)
Alkaline phosphatase (mg/l)            12.7 (5.9 to 21.1)
Lumbar spine BMD * (g/[cm.sup.2])    0.717 (0.619 to 0.879)
Femoral neck BMD (g/[cm.sup.2])      0.705 (0.615 to 0.835)

                                        Controls (n=1200      P-Value

Age (yrs)                             12.7 (11.0 to 13.9)     0.1766
BMI *                                 18.2 (14.7 to 29.3)     0.5051
cBMI *                                18.2 (14.7 to 29.3)     0.0582
25(OH)[D.sub.3] (ng/ml)                13.4 (6.6 to 23.4)     0.5700
1.25[(OH).sub.2][D.sub.3] (ng/ml)     81.0 (32.0 to 132.3)    0.3833
Osteocalcin (mg/l)                     21.8 (6.0 to 42.1)     0.3301
Alkaline phosphatase (mg/l)            11.4 (5.0 to 21.7)     0.3725
Lumbar spine BMD * (g/[cm.sup.2])    0.737 (0.619 to 0.897)   0.0022
Femoral neck BMD (g/[cm.sup.2])      0.725 (0.613 to 0.908)   0.0013

* BMI, body mass index

([dagger]) cBMI, corrected body mass index

([double dagger]) BMD, bone mineral density

Table 3: Bone mineral density in different genotype subgroups of
adolescent idiopathic scoliosis

-572 G [right              GG                       GC
arrow] C

BMD *
Lumbar spine     0.713 (0.619 to 0.854)   0.720 (0.631 to 0.879)
Femoral neck     0.706 (0.629 to 0.835)   0.704 (0.615 to 0.807)

-572 G [right              CC             P-Value
arrow] C

BMD *
Lumbar spine     0.804 (0.731 to 0.861)   0.0159
Femoral neck     0.708 (0.690 to 0.732)   0.8865

* BMD, bone mineral density
COPYRIGHT 2014 American-Eurasian Network for Scientific Information
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2014 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Moshiri, Farshid; Lefevre, Edouard; Serane, Julien; Koumiti, Nabil El; Stanciulescu, Mihai
Publication:Advances in Environmental Biology
Article Type:Report
Date:Aug 1, 2014
Words:3478
Previous Article:Examination of the role of piety in environmental protection.
Next Article:The effects of acute administration of zinc oxidenanoparticles on long term memory in the presence and absence of vitamin C in adult male rat.
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |