Printer Friendly

Hypertrophic cardiomyopathy: low frequency of mutations in the [beta]-myosin heavy chain (MYH7) and cardiac troponin T (TNNT2) genes among Spanish patients.

Hypertrophic cardiomyopathy [(HC).sup.4] is a cardiac disease characterized by a sarcomeric disarray that leads to cardiac muscle cell hypertrophy. The prevalence of HC has been estimated in 1 in 500 to 1000 persons, and HC is the most common cause of sudden death in the young (1). The hypertrophy is either primary (essential) or secondary to other clinicopathologic manifestations (such as hypertension or aortic stenosis) or environmental risk factors (such as physical exercise or the use of some drugs). The essential form of HC is frequently familial, transmitted as an autosomal dominant trait (2, 3). Because the clinical manifestations range from severe hypertrophy with sudden cardiac death (SCD) to a benign form (with mutation carriers remaining asymptomatic), it is difficult to identify the familial segregation in some cases. Moreover, the disease seems to be sporadic in ~50% of cases, but the incomplete penetrance of the phenotype in carriers of some mutations could lead to underestimation of the percentage of familial cases (4-6).

The genes involved in HC encode proteins of the sarcomere (5). The first HC locus was mapped to the long arm of chromosome 14 (14q1) (7). The gene encodes the [beta]myosin heavy chain (MYH7) gene, and >50 different mutations have been identified worldwide (8-11). Overall, MYH7 would be mutated in 10-30% of families, whereas the genes encoding cardiac troponin T (TNNT2) on chromosome 1q3, [beta]tropomyosin (TPMA) on chromosome 15q2, and myosin-binding protein C (MYBPC) on chromosome 11p11.2 are responsible for another 15-30% (12-16). Recently, mutations in other genes, such those that encode for the myosin essential and regulatory light chains, cardiac troponin I (TNNI3), and titin, have been identified in some HC patients (17-19).

MYH7 is a large gene, expanding for ~25 kb of the genome, and contains 40 exons. The complete sequencing of MYH7 in HC patients suggests that most mutations are located in exons 8-24, which encode the globular head of the protein. Some of these mutations would be of prognostic significance. Thus, mutations Arg403Gln, Arg719Trp, and Arg453Cys are commonly associated with an unfavorable prognosis, and carriers have a high risk of sudden death with a reduced average lifespan. Carriers of other MYH7 mutations would have a normal (Gly256Glu, Val606Met, Leu908Val) or an intermediate (Arg249Gln, Glu930Lys) risk of premature sudden death (10, 20-22).

The cardiac troponin T protein links the troponin complex to tropomyosin in the sarcomere (23). The TNNT2 gene expands for ~25 kb of the genome and contains 15 exons. The complete sequencing of TNNT2 in HC patients suggests that most mutations are located in exons 8, 9, 11, and 14-16 (11), although the molecular mechanisms by which most of these mutations produce the HC phenotype remain to be elucidated. Some of the TNNT2 mutations were associated with an adverse prognosis, and this raised the possibility that the identification of mutations in this gene may identify individuals at high risk of SCD, who would benefit from the implantation of a cardioverter defibrillator. Because some of the TNNT2 mutations have been associated with a high incidence of SCD in spite of minimal hypertrophy, the analysis of this gene could be of special interest in asymptomatic individuals with a family history of SCD (22, 24-26).

To establish the incidence of MYH7 and TNNT2 mutations in our population, we analyzed the most frequently mutated exons in 30 patients who had an essential form of myocardial hypertrophy.

Materials and Methods

Patients and controls

A total of 30 unrelated patients were evaluated (16 males and 14 females; mean age at diagnosis, 44 years; range, 18-60 years). They were identified through the patient register of the Cardiology Department of Hospital Central Asturias, which is the reference center for the region of Asturias (Northern Spain; total population, 1 million). The main clinicopathologic findings of these patients are summarized in Table 1. The diagnosis of HC was based on the presence of a maximal left ventricular wall thickness of at least 13 mm on two-dimensional echocardiography. The absence of other causes for ventricular hypertrophy, such as hypertension, aortic stenosis, physical exercise, or the use of some drugs, was confirmed in each patient. We also performed electrocardiographic and echocardiographic examinations on the available first-degree relatives of each patient. A total of 25 cases (80%) had at least one first-degree relative who was also diagnosed with HC and/or SCD. All individuals gave informed consent to participate in the study, which was approved by the Ethical Committee of Hospital Central Asturias.

To confirm the absence of any new putative mutation in the MYH7 and TNNT2 in healthy individuals, we genotyped a total of 200 controls. These were blood bank donors and staff personnel of Hospital Central Asturias, younger than 60 years [mean (SD) age, 37 (15) years], and did not have a history of cardiovascular disease, including HC. However, they were not evaluated echocardiographically, and we can not discard the presence of asymptomatic HC in some of them.

MYH7 and TNNT2 SEQUENCING

Genomic DNA was prepared from peripheral blood leukocytes with use of a salting-out method (27). Exons 8, 9, 13-16, 19, 20, 22-24, and 30 of the MYH7 gene, as well as the corresponding intron-exon boundaries (numbered according to the GenBank sequence no. AJ238393), and exons 8, 9, 11, and 14-16 of the TNNT2 gene, as well as the corresponding exon-intron boundaries (GenBank sequence AY044273), were sequenced in the 30 patients. Genomic DNA was PCR-amplified with the primer pairs summarized in Tables 2 and 3. Each amplification was performed in a total volume of 30 [micro]L and consisted of 32 cycles of 30 s at 95 [degrees]C, 1 min at the annealing temperature (Tables 2 and 3), and 1 min at 72 [degrees]C. PCR products were electrophoresed on a 2% low-melting agarose gel, and the fragments were excised from the gel, purified with spin columns (DNA gel extraction Kit; Millipore), and subjected to direct sequencing on an ABI Prism 310 Genetic Analyzer. Both strands were sequenced using the PCR primers and ddRhodamine-Terminator Cycle Sequencing (PE Biosystems).

MYH7 and TNNT2 GENOTYPING

Single-strand conformation analysis (SSCA) was used to genotype the putative mutations in all available relatives of each patient carrying the change, as well as in 200 healthy controls. In addition, the SSCA electrophoretic patterns corresponding to the 12 MYH7 exons and the 6 TNNT2 exons were analyzed in the 30 patients and in 30 healthy controls. Each genomic DNA was amplified in a final volume of 15 [micro]L with the appropriate primer pairs (Tables 2 and 3). After 32 PCR cycles, each reaction was mixed with 30 [micro]L of formamide and denatured at 95 [degrees]C; 5 [micro]L of this mixture was then electrophoresed on 6% polyacrylamide gels (5.8% acrylamide-0.2% bisacrylamide; 50 cm in length) containing 100 mL/L glycerol. Electrophoresis was for 18 h at 20 W and room temperature. The gel was silver-stained, and the electrophoretic patterns were visualized to define each genotype.

Results

We found a previously described MYH7 mutation in a 44-year-old woman with a mild form of HC, mother of a son who had died from sudden death at age 17 years. This mutation (9090 C>T; Arg453Cys) has previously been linked to HC in several families and was identified as an abnormal SSCA pattern in the patient, whereas the 200 healthy controls showed a wild-type electrophoretic pattern.

We found a previously reported TNNT2 mutation in a 60-year-old woman (patient 25) with a severe form of HC (concentric; with a septum of 22 mm). This mutation (19159 C>T; Arg278Cys) has previously been linked to HC. This patient was the only symptomatic patient in the family. However, the mutation was also present in a sister (55 years) and in the patient's daughter (35 years), and the two did not have cardiac hypertrophy. Patient 25 had an abnormal SSCA electrophoretic pattern compared with the 200 healthy controls.

One patient had a mutation in the MYH7 gene not described previously. Patient 23 (a 28-year-old female) had severe cardiac hypertrophy and required a heart transplant. She had an A-to-G change at nucleotide 13103, a missense change at codon 822 (Val>Met) in exon 22 (Fig. 1). This patient was negative for mutations in the TNNT2 gene and did not have a family history of HC or SCD. The two parents and two brothers, the only available relatives, were healthy, and direct sequencing showed that they did not carry the mutation (paternity was confirmed through the analysis of 10 microsatellite markers; data not shown). SSCA showed an abnormal electrophoretic pattern in patient 23 and a wild-type pattern in the 200 healthy controls (Fig. 2). In this way, 822Met would be a de novo mutation linked to a severe form of HC.

[FIGURE 1 OMITTED]

We also found patient with a new putative mutation in the TNNT2 gene: a 60-year-old woman with severe HC (23 mm septum) who had an A-to-G change at nucleotide 17085, a missense mutation at codon 247 (Lys>Arg) in exon 14 (Fig. 1). SSCA identified this mutation as an abnormal electrophoretic pattern in the patient, whereas a wild-type pattern was observed in the 200 healthy controls (Fig. 2). This patient was negative for mutations in the MYH7 gene, was the only available individual in the family, and did not have a recognized family history of cardiac hypertrophy or SCD.

SSCA of the 12 MYH7 exons in the 30 patients and in 30 controls revealed three common polymorphisms: in exon 8 (6511 T/C; a silent change for Phe), exon 24 (14410 T/C; a silent change for Ile), and intron 19 (12215 T/A). Analysis of the six TNNT2 exons showed a common polymorphism in exon 9 (13150 T/C; a silent change for 106 Ile).

[FIGURE 2 OMITTED]

Discussion

We sequenced 12 exons encoding the head and hinge regions of the MYH7 gene, as well as 6 exons in the TNNT2 gene, in 30 unrelated HC patients. According to previous reports, these exons would contain most of the MYH7 and TNNT2 mutations found in HC patients (4-6, 11). Exon 30 of MYH7 encodes amino acids in the rod-like domain and was included in the study because a previous report described a mutation in several patients with a mild form of HC (28). Because the 30 cases had an essential form of HC, not secondary to any other clinico-pathologic condition, they would represent individuals predisposed to develop HC, likely carriers of mutations in any of the genes linked to this disease. A total of 25 cases had at least one affected relative, including 9 patients with a family history of sudden death, and only 5 cases did not have a recognized family history of HC or SCD.

Our work also illustrates the main difficulties in the genetic analysis of this disease. The mutations can be located in one of several very large genes, and most of the affected families do not have sufficient members to allow statistically significant chromosome linkage analysis. It is not currently possible to establish a correlation between the presence of a mutation in one of the sarcomeric genes and a particular phenotype (2, 5). Moreover, the same mutation can be found in individuals with different clinical manifestations (26). However, it is widely accepted that mutations in the MYH7 gene predispose to the development of severe HC, whereas mutations in the TNNT2 are frequently linked to a high risk of SCD in individuals with or without hypertrophy (2, 4).

One patient, a 28-year-old woman with severe HC, had a nonsilent change (Val822Met) in exon 22 of MYH7. This was the only individual affected in the family, and the two parents were healthy and did not have the mutation. This patient did not have TNNT2 mutations, and the MYH7 mutation was absent in 200 healthy controls. In addition, 822Val is conserved among the vertebrates, and a Val>Met mutation in codon 606 of MYH7 has been linked to the disease in several families (10, 29). These data suggest that this is a de novo mutation linked to a severe form of HC. De novo mutations in the MYH7 gene have previously been described in at least two patients (30, 31). In addition to this de novo mutation, we found a previously described mutation in a 44-year-old woman with a mild form of HC and a family history of sudden death. This mutation (Arg453Cys) has been linked to an unfavorable HC outcome (10). We also identified two TNNT2 mutations (Lys247Arg and Arg278Cys). One (K247R), a new putative mutation not previously described, was present in one patient and absent in the 200 healthy controls. The R278C mutation was found in a 60-year-old woman with severe hypertrophy, whereas her sister and her daughter were carriers and showed normal echocardiographic values. Functional analysis showed that this mutation increased the [Ca.sup.2+] sensitivity of the myofibrillar ATPase activity (32). Watkins et al. (13) found the same mutation in a girl who was resuscitated after cardiac arrest at age 17, in spite of having normal ventricular wall measurements. These findings illustrate the dissociation between TNNT2 mutations and the severity of clinically demonstrable HC.

According to previous reports, mutations in the MYH7 exons analyzed in our study would be found in up to 40% of patients, whereas TNNT2 mutations would be responsible for another 10-15% of occurrences (5, 6). However, a very low rate of MYH7 mutations has also been found in other populations, such as a Finnish population (33). Most of the authors of these reports used SSCA to search for mutations in these genes. Approximately 20% of the nucleotide changes are not detected by this technique, and these studies could have underestimated the true incidence of MYH7 and TNNT2 mutations. Because our patients were analyzed through direct sequencing, we can conclude that mutations in the 12 MYH7 exons and in the 6 TNNT2 exons analyzed would be very rare in our patients and would explain <15% of the HC cases in our population. However, we analyzed individuals with a demonstrated hypertrophy, and TNNT2 mutations have been linked to a high risk of SCD without hypertrophy. It is thus possible that we underestimated the true incidence of TNNT2 mutations, which should be revealed through the analysis of genomic DNA from cases who have suffered SCD, even if they do not have a family history of hypertrophy or SCD.

Finally, we sequenced 12 MYH7 exons, representing ~3000 coding nucleotides, and 6 TNNT2 exons, representing ~1500 coding nucleotides. In addition to the patients, we also analyzed the 18 exons in 30 controls through SSCA. Thus, our data would indicate the degree of genetic variability in these regions of MYH7 and TNNT2 in our population. Interestingly, only three silent polymorphisms were identified, in exons 8 and 24 of the MYH7 gene and in exon 9 of the TNNT2 gene. This low variability suggests a strong selective pressure against nucleotide changes that could predispose to the development of HC and is in agreement with a previous report that described a very low incidence of sequence variation in MYH7 (34).

In conclusion, we describe two TNNT2 and two MYH7 mutations among 30 HC patients. Two of these were known mutations, and two were new (not previously described). One of them (MYH7; Val822Met) was a de novo mutation (not present in the parents of the affected patient). In addition, our study illustrates the extreme phenotypic heterogeneity in carriers of MYH7 or TNNT2 mutations and the difficulty in translating to the clinical practice data derived from the genetic analysis of sarcomeric genes.

This work was supported in part by a grant from FICYT-Principado de Asturias (to E.C.) and the Spanish Fondo de Investigaciones Sanitarias-Red Tematica de Centros (Gene tica). M.G.C. was the recipient of a fellowship from Sociedad Asturiana de Cardiologia.

Received January 2, 2003; accepted May 19, 2003.

References

(1.) Maron BJ, Gardin JM, Flack JM, Gidding SS, Kurosaki TT, Bild DE, et al. Prevalence of hypertrophic cardiomyopathy in a general population of young adults. Echocardiographic analysis of 4111 subjects in the CARDIA study. Circulation 1995;92:785-9.

(2.) Bachinski LL, Roberts R. Familial hypertrophic cardiomyopathy: diagnostic and therapeutic implications of recent genetic studies. Mol Med Today 1996;2:387-93.

(3.) Maron BJ, Nichols PF III, Pickle LW, Wesley YE, Mulvihill JJ. Patterns of inheritance in hypertrophic cardiomyopathy: assessment by M-mode and two-dimensional echocardiography. Am J Cardiol 1984;53:1087-94.

(4.) Schwartz K, Carrier L, Guicheney P, Komajda M. Molecular basis of familial cardiomyopathies. Circulation 1995;91:532-40.

(5.) Arad M, Seidman JG, Seidman CE. Phenotypic diversity in hypertrophic cardiomyopathy. Hum Mol Genet 2002;11:2499-506.

(6.) Marian AJ, Roberts R. Recent advances in the molecular genetics of hypertrophic cardiomyopathy. Circulation 1995;92:1336-47.

(7.) Jarcho JA, McKenna W, Pare JA, Solomon SD, Holcombe RF, Dickie S, et al. Mapping a gene for familial hypertrophic cardiomyopathy to chromosome 14q1. N Engl J Med 1989;321:1372-8.

(8.) Geisterfer-Lowrance AA, Kass S, Tanigawa G, Vosberg HP, McKenna W, Seidman CE, et al. A molecular basis for familial hypertrophic cardiomyopathy: a [beta] cardiac myosin heavy chain gene missense mutation. Cell 1990;62:999-1006.

(9.) Epstein ND, Cohn GM, Cyran F, Fananapazir L. Differences in clinical expression of hypertrophic cardiomyopathy associated with two distinct mutations in the [beta]myosin heavy chain gene: a 906Leu-Val mutation and a 403Arg-Gln mutation. Circulation 1992;86:345-52.

(10.) Watkins H, Rosenzweig A, Hwang DS, Levi T, McKenna W, Seidman CE, et al. Characteristics and prognostic implications of myosin missense mutations in familial hypertrophic cardiomyopathy. N Engl J Med 1992;326:1108-14.

(11.) CardioGenomics home page. www.cardiogenomics.org (Accessed December 20, 2002).

(12.) Thierfelder L, Watkins H, MacRae C, Lamas R, McKenna W, Vosberg HP, et al. [beta]Tropomyosin and cardiac troponin T mutations cause familial hypertrophic cardiomyopathy: a disease of the sarcomere. Cell 1994;77:701-12.

(13.) Watkins H, McKenna WJ, Thierfelder L, Suk HJ, Anan R, O'Donoghue A, et al. Mutations in the genes for cardiac troponin T and [beta]tropomyosin in hypertrophic cardiomyopathy. N Engl J Med 1995;332:1058-64.

(14.) Niimura H, Bachinski LL, Sangwatanaroj S, Watkins H, Chudley AE, McKenna W, et al. Mutations in the gene for cardiac myosinbinding protein C and late-onset familial hypertrophic cardiomyopathy. N Engl J Med 1998;338:1248-57.

(15.) Maron BJ, Niimura H, Casey SA, Soper MK, Wright GB, Seidman JG, et al. Development of left ventricular hypertrophy caused by cardiac myosin-binding protein C gene mutations. J Am Coll Cardiol 2001;38:315-21.

(16.) Marian AJ, Roberts R. The molecular genetic basis for hypertrophic cardiomyopathy. J Mol Cell Cardiol 2001;33:655-70.

(17.) Olson TM, Karst ML, Whitby FG, Driscoll DJ. Myosin light chain mutation causes autosomal recessive cardiomyopathy with midcavitary hypertrophy and restrictive physiology. Circulation 2002; 105:2337-40.

(18.) Niimura H, Patton KK, McKenna WJ, Soults J, Maron BJ, Seidman JG, et al. Sarcomere protein gene mutations in hypertrophic cardiomyopathy of the elderly. Circulation 2002;105:446-51.

(19.) Gerull B, Gramlich M, Atherton J, McNabb M, Trombitas K, Sasse-Klaassen S, et al. Mutations of TTN, encoding the giant muscle filament titin, cause familial dilated cardiomyopathy. Nat Genet 2002;30:201-4.

(20.) Charron P, Dubourg O, Desnos M, Isnard R, Hagege A, Bonne G, et al. Genotype-phenotype correlations in familial hypertrophic cardiomyopathy. A comparison between mutations in the cardiac protein-C and the [beta]MHC genes. Eur Heart 1998;19:139-45.

(21.) Havndrup O, Bundgaard H, Andersen PS, Larsen LA, Vuust J, Kjeldsen K, et al. A novel missense mutation, Leu390Val, in the cardiac [beta]myosin heavy chain associated with pronounced septal hypertrophy in two families with hypertrophic cardiomyopathy. Scand Cardiovasc J 2000;34:558-63.

(22.) Ackerman MJ, VanDriest SL, Ommen SR, Will ML, Nishimura RA, Tajik AJ, et al. Prevalence and age-dependence of malignant mutations in the [beta]myosin heavy chain and troponin T genes in hypertrophic cardiomyopathy. A comprehensive outpatient perspective. J Am Coll Cardiol 2002;39:2042-8.

(23.) Sweeney HL, Feng HS, Yang Z, Watkins H. Functional analyses of troponin T mutations that cause hypertrophic cardiomyopathy: insights into disease pathogenesis and troponin function. Proc Natl Acad Sci U S A 1998;95:14406-10.

(24.) Moolman JC, Corfield VA, Posen B, Ngumbela K, Seidman C, Brink PA, et al. Sudden death due to troponin T mutations. J Am Coll Cardiol 1997;29:549-55.

(25.) Koga Y, Toshima H, Kimura A, Harada H, Koyanagi T, Nishi H, et al. Clinical manifestations of hypertrophic cardiomyopathy with mutations in the cardiac [beta]myosin heavy chain or cardiac troponin T gene. J Card Fail 1996;2:97-103.

(26.) Van driest SL, Ackerman MJ, Ommen SR, Shakur R, Will ML, Nishimura RA, et al. Prevalence and severity of benign mutations in the [beta]myosin heavy chain, cardiac troponin T, and [beta]tropomyosin genes in hypertrophic cardiomyopathy. Circulation 2002;106: 3085-90.

(27.) Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215.

(28.) Blair E, Redwood C, de Jesus Oliveira M, Moolman-Smook JC, Brink P, Corfield VA, et al. Mutations of the light meromyosin domain of the [beta]myosin heavy chain rod in hypertrophic cardiomyopathy. Circ Res 2002;90:263-9.

(29.) Havndrup O, Bundgaard H, Andersen PS, Larsen LA, Vuust J, Kjeldsen K, et al. The Val606Met mutation in the cardiac [beta]myosin heavy chain gene in patients with familial hypertrophic cardiomyopathy is associated with a high risk of sudden death at young age. Am J Cardiol 2001;87:1315-7.

(30.) Watkins H, Thierfelder L, Hwang DS, McKenna W, Seidman JG, Seidman CE. Sporadic hypertrophic cardiomyopathy due to the novo myosin mutations. J Clin Invest 1992;92:1666-71.

(31.) Jeschke B, Uhl K, Weist B, Schroder D, Meitinger T, Dohlemann C, et al. A high risk phenotype of hypertrophic cardiomyopathy associated with a compound genotype of two mutated [beta]myosin heavy chain genes. Hum Genet 1998;102:299-304.

(32.) Morimoto S, Nakaura H, Yanaga F, Ohtsuki I. Functional consequences of a carboxyl terminal missense mutation Arg278Cys in human cardiac troponin T. Biochem Biophys Res Commun 1999; 261:79-82.

(33.) Jaaskelainen P, Soranta M, Miettinen R, Saarinen L, Pihlajamaki J, Silvennoinen K, et al. The cardiac [beta]myosin heavy chain gene is not the predominant gene for hypertrophic cardiomyopathy in the Finnish population. J Am Coll Cardiol 1998;32:1709-16.

(34.) Freeman K, Nakao K, Leinwand LA. Low sequence variation in the gene encoding the human [beta]myosin heavy chain. Genomics 2001;76:73-80.

Monica Garcia-Castro, [1] Julian R. Reguero, [2] Alberto Batalla, [3] Beatriz Diaz-Molina, [2] Pelayo Gonzalez, [1] Victoria Alvarez, [1] Arturo Cortina, [2] Gustavo I. Cubero, [2] and Eliecer Coto [1 *]

[1] Genetica Molecular-Instituto de Investigacion Nefrologica (IRSINFRIAT) and [2] Servicio de Cardiologia, Hospital Central de Asturias, 33006 Oviedo, Spain. [3] Servicio de Cardiologia, Hospital de Cabuenes, 33394 Gijon, Spain.

* Address correspondence to this author at: Genetica Molecular, Hospital Central de Asturias (Maternidad), 33006 Oviedo, Spain. Fax 34-985-27-36-57; e-mail ecoto@hcas.sespa.es.

[4] Nonstandard abbreviations: HC, hypertrophic cardiomyopathy; SCD, sudden cardiac death; and SSCA, single-strand conformation analysis.
Table 1. Main characteristics of the 30 patients with
cardiac hypertrophy.

M/F, n 16/14
Mean (range) age at diagnosis, years 46 (18-60)
Left ventricular wall thickness, n
 13-16 mm 5 (16%)
 17-19 mm 7 (23%)
 >19 mm 18 (61%)
Concentric hypertrophy, n 11
Asymmetric septal hypertrophy, n 19
HC with gradient (range, 16-130 mmHg), n 16
Family history of HC, n 16 (54%)
 Mean (range) age, years 44 (24-60)
No family history of HC, n 14 (46%)
 Mean (range) age, years 37 (20-56)
No family history of HC and/or SCD, n 5 (13%)

Table 2. Primers and PCR conditions for analysis of the MYH7 gene.

 Annealing
 temperature,
Exon Primer sequence, 5'-3' [degrees]C

8 + 9 Forward CTCTCACCTGCCTCCTTCTTGG
 Reverse GCTGAGCCTAGCAGATTCATGG 60
13 Forward CAGGCATGAACCACACACCTG
 Reverse TCTCATCCCACCATGCCAGT 66
14 Forward TCACTCTTCCCAACAACCCTG
 Reverse AGAAATAGCTGTTGAATGTGGG 62
15 Forward GCACAGCCCCAATGGCCA
 Reverse ATGTGTTCTTGTTGGTGTCG 62
16 Forward GCAGAATCCATGTCACCTGTGTGA
 Reverse AATTGACCTGGCTCAGAACCTTG 64
19 + 20 Forward ATCAGAACCCAGAACTTCAGTCCAGT
 Reverse AGCATCAGAGGAGTCAATGGAA 60
22 Forward GGTTTCAGGACCTCAGGTAGGAA
 Reverse CTTCTCTAGCGCCTCTTTGAGG 62
23 Forward CAAGAATGGAGGACCTTACCCC
 Reverse CTGAGAGTCCTGATGACCCG 60
24 Forward GCACCAAGCTGGTGACCTTTGA
 Reverse CTGGGCACAGATAGACATGGCATA 63
 Forward GACCAACAGTTCTCCAAGAA
30 Reverse TGGGATCTGCTGAGGCT 65

 Length of the
 amplified
Exon Primer sequence, 5'-3' product, bp

8 + 9 Forward CTCTCACCTGCCTCCTTCTTGG
 Reverse GCTGAGCCTAGCAGATTCATGG 318
13 Forward CAGGCATGAACCACACACCTG
 Reverse TCTCATCCCACCATGCCAGT 250
14 Forward TCACTCTTCCCAACAACCCTG
 Reverse AGAAATAGCTGTTGAATGTGGG 270
15 Forward GCACAGCCCCAATGGCCA
 Reverse ATGTGTTCTTGTTGGTGTCG 290
16 Forward GCAGAATCCATGTCACCTGTGTGA
 Reverse AATTGACCTGGCTCAGAACCTTG 380
19 + 20 Forward ATCAGAACCCAGAACTTCAGTCCAGT
 Reverse AGCATCAGAGGAGTCAATGGAA 560
22 Forward GGTTTCAGGACCTCAGGTAGGAA
 Reverse CTTCTCTAGCGCCTCTTTGAGG 380
23 Forward CAAGAATGGAGGACCTTACCCC
 Reverse CTGAGAGTCCTGATGACCCG 350
24 Forward GCACCAAGCTGGTGACCTTTGA
 Reverse CTGGGCACAGATAGACATGGCATA 284
 Forward GACCAACAGTTCTCCAAGAA
30 Reverse TGGGATCTGCTGAGGCT 350

Table 3. Primers and PCR conditions used for analysis of the
TNNT2 exons.

 Annealing
 PCR primer sequences, temperature, Fragment
Exon 5'-3' [degrees]C size, bp

8 Forward GCCCTGCCTGTCCTGGACAC
 Reverse CCCACCTATGCTCTACCCCAG 68 263
9 Forward GTCTAGCCCACCCATCTCTCCT
 Reverse GAGGTGGGGCCTCACAAAAG 65 265
11 Forward TAAAGACCACAAGCTTCAGC
 Reverse TGCTGCAGTGGACACCTCAT 62 265
14 Forward GGCCGGGACCAGGACGGAG
 Reverse CAGGGACCTGCAGCAGTATTACC 65 252
15 Forward CCTGGACCTGAGCCAGT
 Reverse AAGGTAGGGAAGGAGGGGG 57 161
16 Forward CATGGTGACCTACTACCCTGC
 Reverse GTGTGGGGGCAGGCAGGA 66 263
COPYRIGHT 2003 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2003 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Molecular Diagnostics and Genetics
Author:Garcia-Castro, Monica; Reguero, Julian R.; Batalla, Alberto; Diaz-Molina, Beatriz; Gonzalez, Pelayo;
Publication:Clinical Chemistry
Date:Aug 1, 2003
Words:4149
Previous Article:Counterpoint the vision for a new diagnostic paradigm.
Next Article:Time course of early and late changes in plasma DNA in trauma patients.
Topics:


Related Articles
Doppler finds Hypertrophic Cardiomyopathy. (Permits Early Treatment).
Hypertrophic cardiomyopathy: through a window of 50 years/Hipertrofik kardiyomiyopati: 50 yillik pencereden bir bakis.
Atrial fibrillation in hypertrophic cardiomyopathy: mechanisms, embolic risk and prognosis/ Hipertrofik kardiyomiyopatide atriyal fibrilasyon:...
Syncope, other risk factors, and the implantable defibrillator for sudden death prevention in hypertrophic cardiomyopathy/Hipertrofik...
Asymmetric septal hypertrophy with perimembranous septal defect and obstructive right ventricular outflow tract in a patient with hypertrophic...
Holter monitoring in the prognosis of sudden cardiac death.
Array-based resequencing assay for mutations causing hypertrophic cardiomyopathy.
Different intracellular compartmentations of cardiac troponins and myosin heavy chains: a causal connection to their different early release after...

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |