Printer Friendly

Hybridization based approach for detection of mutated alleles of SCA 2 and SCA 3 subtype in spinocerebellar ataxia.

Introduction

Spinocerebellar ataxia (SCAs) is a group of progressive late onset of neurodegenerative disorder characterized by cerebellar dysfunction alone or in combination with other neurological abnormalities. Spinocerebellar ataxia have become a focus of human genetics research since expansions of coded CAG trinucleotide repeats were shown to cause several dominantly inherited SCAs (SCA 1,2,3,4,6,7 and DRPLA) (1). The molecular event underlying dynamic mutation in SCAs is the amplification of a tandem-arranged DNA sequence that expands until it reaches a pathological size, which is specific for each disorder (2). The expandable motif is generally a trinucleotide (CAG) however, other types of sequence have also been reported, the tract is polymorphic both among patients and in normal individual, and can be located within or outside the coding region of the gene (3). CAG encodes glutamine, and these expanded CAG triplet repeats result in expanded polyglutamine protein, termed ataxin that produce toxic gain of function with autosomal dominant inheritance (4).

A gene responsible for SCA2 has been mapped to human chromosome 12 (12 q 23 -q-24.1) and the disease causing mutation has been identified as an unstable expanded [(CAG).sub.n] trinucleotide repeats (4, 5). It has been described in patients from Cuba and India. Normal alleles of SCA2 contains 15-32 repeats of CAG while mutated alleles have 35-77 repeats. The age of onset ranges from 2-65 years (4).

The genetic basis for Machado-Joseph disease (MJD) is an expansion of trinucleotide CAG repeat near the C terminus of gene encoding ataxin3, a cytoplasmic protein whose normal function is unknown. This autosomal dominant disorder also known as SCA3. Ataxin 3 is ubiquitously expressed throughout the body, pathology occurs only in the brain, where ataxin 3 accumulates in inclusions, along with proteins including molecular Chaperons and components of ubiquitin proteosome degradation pathway (6).

MJD has been found in Brazil, Canada, India, Japan, Italy, and China. In most populations, it is the most common autosomal dominant ataxia (4).

Numbers of genetic tests for known SCA genes are available but their exact clinical role has received much less attention. Currently available DNA (genetic) test can define the genotype of patients with dominantly inherited type. But these test showing SCAs same limitations as the list of DNA test grows the variable and overlapping phenotype manifestations of SCA subtype make it difficult to choose specific genetic / DNA test. Also, there is critical size of repeats for most of the SCAs above which the disease would manifest. However in some SCAS in which disease and normal alleles size overlap in an intermediate range which gives ambiguous results, so existing molecular testing with these limitations can not diagnose all SCA subtype (1).

Thus the given approach is related to detection of SCA2 and 3 subtypes.

Following are the main objective of given study

(1) Design of individual and common primer fore each SCA subtype 2 and 3.

(2) Virtual optimization of amplification condition for designed primer.

(3) Study of amplification efficiency of primer for SCA subtype by ePCR.

(4) Design of hybridization probe common for all the variant of each selected SCA subtype.

(5) Optimization of hybridization condition.

Material and Methods

SCA2 and SCA3 mRNA sequences were obtained in FASTA format from NCBI (8). The obtained sequences were manually checked for significant CAG repeats as well as through string comparison approach. Once the total CAG (Q) were located; the SCA2 and SCA3 variants were aligned by using clustalW (9), CLCBio (10) software separately. The aligned sequences were then screened for conserved region, which was use as the base for designing the primer and probes.

Design of Primer

In order to minimize the complexity of analysis of genotype of the SCA sequences were screened through JaMBW software and the universal primer was designed for SCA2 and SCA3 (for all variants). The designed primers were screened for their efficiency of amplification by using online amplification tool ePCR (8).

Design of probe

The hybridization probes for SCA2 and SCA3 were designed against the conserved region located by using the clustalW alignment tool. Once the conserved region was a located, the unique sequence with significant CAG was selected for designing of probe.

As the selected sequences were of mRNA, to make the hybridization possible the probe sequence was converted to complementary sequence by using the software JaMBW.

For each SCA subtype and its variants, the common primer was designed with a unique probe. The sequence of primer & probe has been sent for custom oligonucleotied synthesis which will be then used for their efficacy testing in wet lab.

Observations

Results

Following are the primers and probes designed for the specific diagnosis of SCA2 and SCA3 Subtypes.

Discussion

There are various methods available for diagnosis of SCA subtype such as test suggested by Gene test laboratory, Reliance life science, etc.

Though these methods are capable of determining the total CAG repeats in each subtype of SCA. The result revealed by those methods cannot be taken as a base for further specific treatment of SCA abnormalities. There seems to be critical size of repeats for most of the SCAs above which the disease would manifest. However this is not absolute in some SCAs in which diseased and normal allele size overlap in an intermediate range, thus result reveled by these methods are not significant (1).

In one of the case study done by the authors it was observed that the total number of CAG repeats for SCA 2: normal (14-32), mutated (33-77) and subtype 3: normal (12-40) and mutated (51-86), which is overlapping. Thus the results revealed by above study are not significant with reference to specific diagnosis of SCA subtype. Because of such limitations, it becomes important to have such a diagnostic technology that will specifically diagnose each SCA subtype.

In present study we are concerning with diagnostic test for SCA2 and 3. For this we have developed the common primers (Table 3), out of which one will amplify the SCA2 gene and another will amplify the SCA3 gene. Also we have synthesized the probe specific for SCA2 and SCA3 (for all its variants) ( Table 4). These probes will help to identify the specific SCA subtype (2 or 3) by using hybridization approach. These probes are designed against the region with significant CAG repeats. The probe of SCA2 belongs to region from exon 1 and probes of SCA3 belong to region from exon 8, 9, 10.

The primers are reverse primer that will amplify the SCA2 and SCA3 (normal, mutants and variants). This will reduce the complexity of whole genome sequence analysis. The amplified product further hybridized with unique probe designed for SCA2 and 3 for detection of particular subtype. The development of primer and probe related hybridization approach for diagnosis of SCA2 and 3 and its variants is one of the unique approaches of its nature.

Presently we are investigating the efficacy of suggested primer and probe for diagnosis of SCA subtype 2 and 3 in wet lab and also optimizing the amplification and hybridization conditions.

References

[1] Eng-King Tan, MD; Tetsuo Ashizawa, MD,2001; Genetic testing in spinocerebellar ataxias, defining a clinical role Arch Neurol;58: 191-195

[2] C.J. Cumming and Huda Y. Zoghbi, 2000, Dynamic Mutation in SCAs Human Molecular Genetics, vol.9, No.6, 909-916

[3] Stenio F.P. Duarte, Raquel S. Gestinari et.al.,2003; Genetic polymorphism at spinocerebellar ataxia 1 and 2 loci in Brazil, Genet. Mol. Res. 2 (4):360-365

[4] Anthony S. Fauci, Eugene Braunwald et al: Harrison's Principles of internal medicine (17th edition) Mc Grow Hill publication vol.2, pg no. 2567-2570

[5] Riess O, Laccone FA, et. al. Neurogenetics 1997 May; trinucleotide expansion in German SCA patients, 1(1):59-64 SCA2.

[6] Ellen W. Doss-Pepe, Edward S. Stenroos, et. al. molecular and Cellular biology, Sep 2003, Ataxin 3 interaction with Rad23 and valosin containing protein and its association with ubiquitin chain and the proteosome are consistant with a role in ubiquitin mediated proteolysis, vol. 23: 6469-6483.

[7] www.ataxia.org

[8] www.ncbi.nlm.nih.gov

[9] www.ebi.ac.uk/clustalw

[10] www.macupdate.com/info.php/id/21137/CLC-main-workbench

[11] www.bioinformatics.org/JaMBW/

Sachin S. Kulkarni, Vrushali C. Hingane and Vishwas S. Shembekar

Department of Biotechnology, Rajarshi Shahu Mahavidyalaya, Latur. MS India
Table 1: Specifications of Primer.

Sr.No. Type of SCA Primer position Tm % GC

1 SCA2 From 1127th bp 68.21 61.11
2 SCA3 From 1985th bp 64.89 66.66

Table 2: Specifications of Probe.

Sr.No. Types of SCA Probe position Position on exon

1 SCA2 From 690th bp 1
2 SCA3 Varient1 From 960th bp 10
 Varient2 From 789th bp 8
 Varient3 From 915th bp 9
 Varient4 From 762nd bp 8

Table 3: Primer sequence for SCA2 and SCA3.

Sr.No SCA Primer Tm GC Self
 subtype pairing

1 SCA2 5'TTCACGTTTCGGCCCCGA 3' 68.21 61.11 0
2 SCA3 5'GGCGCAGGAAGAAGGGGT 3' 66.67 72 0

Table 4: Probe sequence for SCA2 and SCA3.

Sr.No SCA Probe % GC
 subtype

1 SCA2 GTCGTCGTTGTCGTCGTC 69%
 GTCGTCGTCGTCGTCGTCGGCGGC
2 SCA3 GTCGTCGTCGTCGTCGTC 64%
 GTCGTCCCCCTGGATAGTCCTGTC
COPYRIGHT 2010 Research India Publications
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2010 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Kulkarni, Sachin S.; Hingane, Vrushali C.; Shembekar, Vishwas S.
Publication:International Journal of Biotechnology & Biochemistry
Date:May 1, 2010
Words:1507
Previous Article:DNA fingerprinting of the freshwater mud Eel, monopterus cuchia (Hamilton) by randomly amplified polymorphic DNA (RAPD) marker.
Next Article:Analog designing & target idendification of collagenase in wound healing.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters