Printer Friendly

Hybrid & El Tor variant biotypes of Vibrio cholerae O1 in Thailand.

Vibrio cholerae, the causative agent of severe watery diarrhoeal disease cholera, comprises 206 serogroups (O1-O206) based on antigenic diversity of their outer membrane lipopolysaccharides (1,2). Strains of the O1 serogroup are divided into two biotypes i.e., classical and El Tor, according to their phenotypic differences. The classical strains are sensitive to 50 units of polymyxin B and Mukerjee's type IV bacteriophage while the El Tor strains are generally dually resistant with the exception of some strains isolated in southern Bangladesh (3,4). The El Tor strains are more adapted and resilient in environment, and cause higher infection to case ratio and more asymptomatic carriers than the classical counterpart (5). Clinical manifestations of cholera caused by classical V. cholerae are more severe and prolonged than those caused by the El Tor (6,7). This is attributable to the subtle difference of cholera toxin (CT) encoded by ctxAB genes of V. cholerae. Each of the V. cholerae O1 biotype can be divided into three serotypes i.e., Ogawa, Inaba, and Hikojima. Since 1817, the world has experienced seven cholera pandemics caused by V. cholerae O1. Strains of classical biotype were considered as the causative agents for the first six pandemics while the 7th cholera pandemic which started in 1961 from Sulawesi Island, Indonesia, was caused by El Tor V. cholerae O1. Since then, the El Tor V. cholerae had replaced the classical biotype as the sole cause of cholera epidemics until 1982 when there was a re-emergence of the classical V. cholerae isolated from patients during an epidemic in Bangladesh (8-10). Both biotypes co-existed in Bangladesh until the classical vibrios became extinct in 1993. Until 1991, only toxigenic V. cholerae O1 strains caused cholera epidemic and pandemics. In 1992, a large cholera outbreak was reported from southern India and subsequently spread rapidly to neighbouring countries in several countries in Asia but did not spread to any other continent. The epidemic organism was non-O1 V. cholerae which could not be allocated into any of the pre-existing non-O1 serogroups. Subsequently, the organism was designated as serogroup O139 synonym Bengal in recognition of the place of origin (11-13).

New V. cholerae O1 variants carrying mixed classical and El Tor phenotypes

were first isolated from hospitalized patients with severe watery diarrhoea in Matlab, Bangladesh, in 2002 (3). These isolates could not be allocated into the classical or El Tor biotype using conventional biotyping tests. Genotypically, these were found to carry the El Tor genome backbone including El Tor specific gene clusters: VSP-I and -II and RTX, indicating that these belonged to El Tor lineage. These isolates carried different combinations of alleles of tcpA and CTX prophage repressor gene (rstR) (4). Their classical biotype characteristic was due to the presence of the classical CTX prophage and the deduced amino acids of the nucleotide sequence coding for cholera toxin B subunit belonged to classical biotype. Similar strains were isolated in Mozambique in 2004 (14). Subsequently, V. cholerae O1 El Tor variants have been reported from several Asian countries including China, Japan, Hong Kong, Sri Lanka, and Vietnam and Africa (Zambia) (15). In a retrospective study of V. cholerae strains isolated in Kolkata, India, during a 17 year period (1989-2005), using mis-match amplification mutation assay (MAMA)-PCR for determining ctxB alleles, it was revealed that the El Tor strains carrying ctxB allele of the classical biotype ([ctxB.sup.C]) have emerged since 1991 and co-existed with the prototype El Tor strains until 1995 when these completely replaced the typical El Tor biotype. Arbitrarily, the V. cholerae O1 strains carrying mixed phenotypes of classical and El Tor biotypes [polymyxin B (50 units) susceptibility and positive for chicken erythrocyte agglutination (CCA) and Voges-Proskauer (VP) test] are designated hybrid biotype where as the V. cholerae O1 with typical El Tor phenotypes (resistant to 50 units of polymyxin B, and positive for CCA and VP test) but carrying [ctxB.sup.C] are designated El Tor variant (16). This nomenclature has been followed in this study.

The 7th pandemic cholera arrived in Thailand in 1963, when the El Tor strains completely replaced the classical vibrios and established endemicity (17). The O139 Bengal was first isolated from hospitalized patient with severe watery diarrhoea in Thailand in 1993 (18). The O139 serogroup completely disappeared from Thailand since 1996 (17). Because it is known that classical V. cholerae strains with [ctxB.sup.C] inflicted more severe symptoms than the typical El Tor infection (6,16) and because there had been a resurgence of cases of severe watery diarrhoea that required hospitalization during 1999-2002, it was of interest to make an insight into both phenotypic and genotypic characteristics of V. cholerae O1 isolated from cholera patients in different years in Thailand.

Material & Methods

Bacterial strains: A total of 330 V. cholerae O1 strains (248 Ogawa, 82 Inaba) isolated from hospitalized patients with cholera in various regions of Thailand from 1986 to 2009 (Table I) were investigated. Nineteen V. cholerae O1 strains collected from Australia, Bangladesh, India, Peru, Romania and Thailand in different years were used as reference strains (4,19) (Table II). Among them, 16 strains were obtained from the collection of the Laboratory Science Division, the International Centre for Diarrhoeal Disease Research of Bangladesh, Dhaka, Bangladesh; two strains (G27875 and SC11) were provided by Dr T. Ramamurthy, the National Centre of Cholera and Enteric Diseases, Kolkata, India; and one strain (295/33) was from the Department of Microbiology and Immunology, Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand. All strains were subjected to conventional biotyping methods (susceptibility to 50 units of polymyxin B, CCA and VP test) (20) using strains 569B and N16961 as the classical and El Tor reference strains, respectively.

Conventional- and MAMA-PCRs: All V. cholerae strains were examined for the presence of ctxA, ctxB, zot, ace, toxR, [tcpA.sup.C], [tcpA.sup.E], [hlyA.sup.C] and [hlyA.sup.E] by conventional PCR using strains AR15493 and AR15425 from Bangladesh as positive controls for zot, ace, toxR, and hlyA genes and strain C6706 as positive control for ctxAB and tcpA (19). Conventional biotyping methods and a combination of MAMA-and conventional- PCRs were used for classifying the strains into prototype El Tor, hybrid, or El Tor variant biotypes, based on their ctxB and rstR genes (21-23). Strains MJ1485 from Bangladesh and B33 from Mozambique served as hybrid biotype reference strains while G27875 and SC11 from NICED, India, were El Tor variant reference strains.

Primer sequences used in PCRs are shown in Table III (19). Amplification mixture (25 [micro]l) for ctxB-MAMA-PCR and rstR-PCR composed of 1 [micro]l bacterial genomic DNA template, 2.5 [micro]l 10x PCR buffer, 2 ul each of 2.5 mM deoxynucleotide triphosphate (Fermentas, Vilnius, Lithuania), 2 [micro]l of 25 mM Mg[Cl.sub.2], 2 [micro]l of 10 [micro]M of individual forward and reverse primers (Bio Basic Inc., Toronto, Canada), 0.5 units Taq DNA polymerase (Fermentas) and sterile ultra pure distilled water. Amplification of other genes was essentially the same as described previously (19). The PCR products were analyzed by using 1.5 per cent agarose (Seakem LE, BMA, Glendate, CA, USA) gel electrophoresis and ethidium bromide staining (Sigma Chemical Co., USA). A Gel Doc 2000 (Bio-Rad, CA, USA) was used for DNA band documentation.

Results & Discussion

All of the 330 V. cholerae O1 Thai clinical strains collected over 24 years (1986-2009) were found to carry ctxA, ctxB, zot, ace, toxR, [tcpA.sup.E] and [hlyA.sup.E] which verified genetically their toxin producing capacity and epidemic potential. Two hundred and sixty six strains were prototype El Tor (resistant to the polymyxin B, and positive for CCA and VP test) and the remaining 64 strains were not biotypable (Table I).

Identification of rstR by conventional PCR showed that the 36 strains of 1986-1992 carried either the El Tor rstR ([rstR.sup.E]) or combination of the El Tor and classical rstR ([rstR.sup.E/C]) (Table I). MAMA-PCR for cttxB of these isolates revealed that 18 (50%) carried [ctxB.sup.E]. Only 15 of these 18 strains had prototype El Tor phenotype (resistant to 50 units of polymyxin B, and positive for CCA and VP test) indicating that they were typical El Tor biotype. The other 3 strains, although carrying [ctxB.sup.E], appeared to be hybrid biotype as they possessed mixed phenotypes (Tables I and IV). There were 11 strains of 1986-1992 (31%) that carried [ctxB.sup.E]/C. Among these only one strain had mixed classical and El Tor phenotypes implying that this was hybrid biotype. The remaining 10 with [ctxB.sup.E]/C, however, could not be assigned into any of the redefined biotype scheme (16) although these showed conventional El Tor phenotype (Tables I and IV). The remaining seven (19%) of the 1986-1992 (all were isolated in 1992) strains carried [ctxB.sup.C]; four of these had conventional El Tor phenotypes implying that these were El Tor variant while the other three had mixed phenotypes, and were hybrid (Table I). These data indicate the presence of hybrid biotype of V. cholerae O1 in Thailand since 1986 or even before and these co-existed with the typical El Tor strains. The V. cholerae O1 Thailand strains that carried [ctxB.sup.E]/ [rstR.sup.E] i.e., typical El Tor strains, were found for the last time in 1992 in this V. cholerae O1 collection which was the same year when the strains of El Tor variant biotype (strains 30-33) carrying [ctxB.sup.C]/[rstR.sup.E/C] emerged in the country (Table I). It is noteworthy that in 1992 the epidemic V. cholerae O139 strains emerged in Southern India (11). The Fig. shows MAMA-PCR results of representative strains of V. cholerae chronologically isolated in Thailand i.e., [ctxB.sup.C] (Fig. A) and [ctxB.sup.E] (Fig. B).

The V. cholerae O1 Thailand strains of 1993-2009 (294) were all found to carry [ctxB.sup.C] and either [rstR.sup.C] or [rstR.sup.E/C]. Majority of these strains (237 strains), however, were El Tor variants as their phenotypes were typical El Tor. The minority (57 strains) belonged to hybrid biotype because these had mixed phenotypes of classical and El Tor (Table I). The 1986-2009 Thailand strains with hybrid biotype could be arbitrarily classified into 13 different hybrid groups, 1-13 (Table IV). During 1986-1992, the biotypes of the 36 V. cholerae O1 Thailand strains were 15 prototype El Tor, 7 hybrid (groups 1-5), 4 El Tor variant, and 10 unclassified (unclassified groups 1 and 2) (Tables I and IV). The 294 strains of 1993-2009 belonged to hybrid groups 6-13 (57 strains) and El Tor variants (237 strains) (Tables I and IV).

The V. cholerae O1 of hybrid biotype was isolated from patients in India in 1991 when typical V. cholerae classical and El Tor biotypes co-existed suggesting the horizontal CTX prophage exchange between strains of the two principal biotypes in order for the infecting strains to be more adapted to the host hostile intestinal environment (15) which conformed to the more severe cholera symptoms in the afflicted hosts in the recent years (3,22,24). It is noteworthy, however, that the classical V. cholerae O1 disappeared from Thailand since 1963 (25) when the 7th cholera pandemic caused by typical El Tor strains first hit the Kingdom's population. There has been no report on the period of co-existing classical and El Tor strains during 1986-2009 within Thailand. Our finding that the V cholerae hybrid biotype could be detected among strains of 1986 suggested that there might be a re-emergence of the classical V. cholerae before or during 1986 or there might be other confounding molecular mechanism(s) in the shifting of the characteristics of V. cholerae bacteria in Thailand.

[FIGURE OMITTED]

The speculations warrant detail investigation. In 1992, the epidemic O139 strains emerged in India concurrent with the finding of El Tor variant in Thailand for the first time in this series of strain collection (Table I). Between 1992 and 1993, the V. cholerae O1 strains carrying [ctxB.sup.C] predominated in Kolkata, India (15) and Thailand (this study). Thus, there seemed to be incomprehensible event of genetic evolution of the V. cholerae yielding strains of mixed traits/phenotypes of the two authentic biotypes during this period. After 1994, isolates of V. cholerae O1 in Kolkata, India, seemed to carry only [ctxB.sup.C]; thus these were El Tor variants or hybrids (no phenotypes were given to define the biotype) (16). Similarity was found among the Thailand strains of this study, however, two years earlier than the Kolkata's series. All of the Thai strains after 1992 carried [ctxB.sup.C] of which 57 (19%) were hybrid biotype and 237 strains (81%) were El Tor variants according to the conventional biotyping method and MAMA-and conventional- PCR determinations. In Punjab and Haryana, northern India, where a re-emergence of classical V. cholerae has not been reported, the V. cholerae hybrid biotype were also found in 2007 (80% of the isolates) (26). As has been mentioned earlier, many V. cholerae isolates of several other countries in Asia and Africa were also found to be biotype hybrid/El Tor variant (15) indicating that the El Tor V. cholerae bacteria, regardless of the geographical areas, tend to evolve for acquisition of the classical CTX prophage. This phenomenon will have impact, more or less, on the treatment of cholera, public health measures, as well as vaccine development.

Acknowledgment

The work was co-supported by the National Research University project of Thailand Office of Higher Education Commission (CHE) through Center for Biopharmaceutical Development and Innovative Therapy, Mahidol University and CHE RG 490329, the Thailand Research Fund (TRF; DPG5380001) and the Japan Health Science Foundation, Japan. P. Srimanote, N. Indrawattana, and N. Sookrung received research support from TRF.

Received February 12, 2010

References

(1.) Shimada T, Arakawa E, Itoh K, Okitsu T, Matsushima A, Asai Y, et al. Extended serotyping scheme for Vibrio cholerae. Curr Microbiol 1995; 28 : 175-8.

(2.) Yamai S, Okitsu T, Shimada T, Katsube Y. Distribution of serogroups of Vibrio cholerae non-O1 non-O139 with specific reference to their ability to produce cholera toxin, and addition of novel serogroups. Kansenshogaku Zasshi 1997; 71 : 103745.

(3.) Nair GB, Faruque SM, Bhuiyan A, Kamruzzaman M, Siddique AK, Sack DA. New variants of Vibrio cholerae O1 biotype El Tor with attributes of the classical biotype from hospitalized patients with acute diarrhea in Bangladesh. J Clin Microbiol 2002; 40 : 3296-9.

(4.) Safa A, Bhuyian NA, Nusrin S, Ansaruzzaman M, Alam M, Hamabata T, et al. Genetic characteristics of Matlab variants of Vibrio cholerae O1 that are hybrids between classical and El Tor biotypes. J Med Microbiol 2006; 55 : 1563-9.

(5.) Sack DA, Sack RB, Nair GB, Siddique AK. Cholera. Lancet 2004; 363 : 223-33.

(6.) Kaper JB, Morris JG Jr, Levine MM. Cholera. Clin Microbiol Rev 1995; 8 : 48-86.

(7.) Faruque SM, Albert MJ, Mekalanos JJ. Epidemiology, genetics, and ecology of toxigenic Vibrio cholerae. Microbiol Mol Biol Rev 1998; 62 : 1301-14.

(8.) Bart KJ, Huq Z, Khan M, Mosley WH. Seroepidemiologic studies during a simultaneous epidemic of infection with El Tor Ogawa and classical Inaba Vibrio cholerae. J Infect Dis 1970; 121 (Suppl 121) : S17-S24.

(9.) Barua D. History of cholera. In: Barua D, Greenough WB, editors. Cholera, 3rd ed. New York: Plenum Medical Book Co.; 1992. p. 1-36.

(10.) Samadi AR, Huq MI, Shahid N, Khan MU, Eusof A, Rahman AS, et al. Classical Vibrio cholerae biotype displaces El Tor in Bangladesh. Lancet 1983; 1 : 805-7.

(11.) Albert MJ, Siddique AK, Islam MS, Faruque AS, Ansaruzzaman M, Faruque SM, et al. Large outbreak of clinical cholera due to Vibrio cholerae non-O1 in Bangladesh. Lancet 1993; 341 : 704.

(12.) Large epidemic of cholera-like disease in Bangladesh caused by Vibrio cholerae O139 synonym Bengal Cholera Working Group. International Centre for Diarrhoeal Diseases Research, Bangadesh. Lancet 1993; 342 : 387-90.

(13.) Ramamurthy T, Garg S, Sharma R, Bhattacharya SK, Nair GB, Shimada T, et al. Emergence of novel strain of Vibrio cholerae with epidemic potential in southern and eastern India. Lancet 1993; 341 : 703-4.

(14.) Lee JH, Han KH, Choi SY, Lucas ME, Mondlane C, Ansaruzzaman M, et al; Mazambique Cholera Vaccine Demonstration Project Coordination Group. Multilocus sequence typing (MLST) analysis of Vibrio cholerae O1 El Tor isolates from Mozambique that harbour the classical CTX prophage. J Med Microbiol 2006; 55 : 165-70.

(15.) Safa A, Sultana J, Dac Cam P, Mwansa JC, Kong RY. Vibrio cholerae O1 hybrid El Tor strains, Asia and Africa. Emerg Infect Dis 2008; 14 : 987-8.

(16.) Raychoudhuri A, Mukhopadhyay AK, Ramamurthy T, Nandy RK, Takeda Y, Nair GB. Biotyping of Vibrio cholerae O1: time to redefine the scheme. Indian J Med Res 2008; 128 : 695-8.

(17.) Ministry of Public Health, Thailand. Bureau of Epidemiology and the Department of Disease Control. Disease Notification Report 2000.

(18.) Chongsa-nguan M, Chaicumpa W, Moolasart P, Kandhasingha P, Shimada T, Kurazono H, et al. Vibrio cholerae O139 Bengal in Bangkok. Lancet 1993; 342 : 430-1.

(19.) Tapchaisri P, Na-Ubol M, Jaipaew J, Srimanote P, Chongsa-Nguan M, Yamasaki S, et al. Virulence genes of clinical Vibrio cholerae O1 isolates in Thailand and their ribotypes. J Infect 2007; 55 : 557-65.

(20.) World Health Organization, Geneva. Manual for laboratory investigations of acute enteric infections. WHO document CDD/83.3/Rev.1.113. Geneva: WHO; 1987.

(21.) Morita M, Ohnishi M, Arakawa E, Bhuiyan NA, Nusrin S, Alam M, et al. Development and validation of a mismatch amplification mutation PCR assay to monitor the dissemination of an emerging variant of Vibrio cholerae O1 biotype ElTor. Microbiol Immunol 2008; 52 : 314-7.

(22.) Chatterjee S, Patra T, Ghosh K, Raychoudhuri A, Pazhani GP, Das M, et al. Vibrio cholerae O1 clinical strains isolated in 1992 in Kolkata with progenitor traits of the 2004 Mozambique variant. J Med Microbiol 2009; 58 : 239-47.

(23.) Nair GB, Mukhopadhyay AK, Safa A, Takeda Y. Emerging hybrid variants of Vibrio cholerae O1. In: Faruque SM, Nair GB, editors. Vibrio cholerae : Genomics and molecular biology. Norwich, UK: Horizon Scientific Press; 2008. p. 179-90.

(24.) Tapchaisri P, Na-Ubol M, Tiyasuttipan W, Chaiyaroj SC, Yamasaki S, Wongsaroj T, et al. Molecular typing of Vibrio cholerae O1 isolates from Thailand by pulsed-field gel electrophoresis. J Health Popul Nutr 2008; 26 : 79-87.

(25.) Department of Disease Control, Ministry of Public Health, no. ICD-10: A00. Bureau of Epidemiology, The Ministry of Public Health, Thailand. Available from: http://epi.moph.go.th/fact/ Cholera.htm, accessed on January 10, 2010.

(26.) Taneja N, Mishra A, Sangar G, Singh G, Sharma M. Outbreaks caused by new variants of Vibrio cholerae O1 El Tor, India. Emerg Infect Dis 2009; 15 : 352-4.

M. Na-Ubol, P. Srimanote [1], M. Chongsa-nguan, N. Indrawattana, N. Sookrung [2], P. Tapchaisri [1], S. Yamazaki [3], L. Bodhidatta [4], B. Eampokalap [5], H. Kurazono [6], H. Hayashi [7], G.B. Nair [8], Y. Takeda [8] & W. Chaicumpa [9]

Department of Microbiology & Immunology, Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand; [1]Graduate Studies, Faculty of Allied Health Sciences, Thammasat University, Pathumthani, Thailand, [2] Office for Research & Development, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand, [3] Department of Veterinary Science, Graduate School of Life & Environmental Sciences, Osaka Prefecture University, Osaka, Japan, [4] Department of Enteric Diseases, Armed Force Research Institute of Medical Science, US Army Component, Bangkok, Thailand; [5] Bamrasnaradura Institute, Nonthaburi, Thailand, [6] Obihiro University of Agriculture & Veterinary Medicine, Department of Animal & Food Hygiene, Hokkaido, Japan, [7] Department of Microbiology & Nutrition, Chugoku-gakuen University, Okayama, Japan, [8] National Institute of Cholera & Enteric Diseases, Kolkata, India & [9] Department of Parasitology & Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand

Reprint requests: Dr Wanpen Chaicumpa, Emeritus Professor, Department of Parasitology, Faculty of Medicine Siriraj Hospital Mahidol University, Bangkok 10700, Thailand e-mail: tmwcc@mahidol.ac.th
Table I. V. cholerae O1 strains isolated from Thailand during 1986-2009

Year of        Strain no.  Serotype       Phenotype Genotype
isolation (n)
                                     PB   CCA  VP   ctxB  rstR

1986 (5)          1-2      Inaba     R    +    +    E     E
                   3       Inaba     R    +    +    E     E+C
                   4       Inaba     S    -    +    E     E
                   5       Inaba     R    +    +    E+C   E
1987 (1)           6       Inaba     R    +    +    E     E
1989 (2)           7       Inaba     R    -    +    E+C   E+C
                   8       Inaba     S    +    +    E     E+C
1990 (13)         9-12     Inaba     R    +    +    E     E+C
                 13-16     Ogawa     R    +    +    E     E
                 17-18     Inaba     R    +    +    E+C   E+C
                 19-21     Ogawa     R    +    +    E+C   E
1991 (4)           22      Ogawa     R    +    +    E     E
                 23-25     Ogawa     R    +    +    E+C   E
1992 (11)          26      Inaba     R    +    +    E     E+C
                   27      Inaba     S    +    +    E     E
                   28      Ogawa     R    +    +    E     E
                   29      Ogawa     R    +    +    E+C   E
                 30-33     Ogawa     R    +    +    C     E+C
                 34-36     Ogawa     R    -    +    C     E+C
1993(9)          37-38     Inaba     R    +    +    C     E+C
                 39-43     Ogawa     R    +    +    C     E+C
                   44      Ogawa     R    +    -    C     E+C
                   45      Ogawa     R    +    +    C     C
1994 (7)           46      Inaba     R    +    -    C     E+C
                 47-51     Ogawa     R    +    +    C     E+C
                   52      Ogawa     S    +    +    C     E+C
1995 (11)        53-62     Ogawa     R    +    +    C     E+C
                   63      Ogawa     R    +    -    C     E+C
1996 (3)         64-65     Ogawa     R    +    +    C     E+C
                   66      Ogawa     S    +    +    C     E+C
1997 (3)           67      Ogawa     R    +    +    C     E+C
                 68-69     Ogawa     R    +    +    C     C
1998(2)          70-71     Ogawa     R    +    +    C     C
1999 (179)       72-78     Inaba     R    +    +    C     C
                 79-83     Ogawa     R    +    +    C     E+C
                 84-85     Ogawa     R    +    -    C     E+C
                 86-115    Ogawa     R    +    -    C     C
                116-247    Ogawa     R    +    +    C     C
                  248      Ogawa     R    -    +    C     C
                  249      Ogawa     R    -    -    C     C
                  250      Ogawa     S    +    +    C     C
2000 (21)       251-270    Ogawa     R    +    +    C     C
                  271      Ogawa     R    +    -    C     C
2001 (27)       272-294    Inaba     R    +    +    C     C
                295-298    Inaba     R    +    -    C     C
2002 (13)       299-306    Inaba     R    +    +    C     C
                  307      Inaba     R    +    -    C     C
                308-310    Inaba     S    +    +    C     C
                  311      Ogawa     R    +    +    C     C
2003 (8)        312-315    Inaba     R    +    +    C     C
                  316      Inaba     R    +    -    C     C
                  317      Inaba     S    +    +    C     C
                  318      Inaba     S    +    -    C     C
                  319      Inaba     S    -    +    C     C
2004 (9)        320-324    Inaba     R    +    +    C     C
                325-327    Inaba     R    +    -    C     C
                  328      Inaba     S    +    -    C     C
2009 (2)        329-330    Ogawa     R    +    +    C     C

Year of        Strain no.  Biotype                  Number of
isolation (n)              (see also Table IV)   strain(s)/total
                                                    number of
                                                  strain(s) of
                                                    the year

1986 (5)          1-2      El Tor                      2/5
                   3       El Tor                      1/5
                   4       Hybrid group 1              1/5
                   5       Unclassified group 1        1/5
1987 (1)           6       El Tor                      1/1
1989 (2)           7       Hybrid group 2              1/2
                   8       Hybrid group 3              1/2
1990 (13)         9-12     El Tor                     4/13
                 13-16     El Tor                     4/13
                 17-18     Unclassified group 2       2/13
                 19-21     Unclassified group 1       3/13
1991 (4)           22      El Tor                      1/4
                 23-25     Unclassified group 1        3/4
1992 (11)          26      El Tor                     1/11
                   27      Hybrid group 4             1/11
                   28      El Tor                     1/11
                   29      Unclassified group 1       1/11
                 30-33     El Tor variant             4/11
                 34-36     Hybrid group 5             3/11
1993(9)          37-38     El Tor variant              2/9
                 39-43     El Tor variant              5/9
                   44      Hybrid group 6              1/9
                   45      El Tor variant              1/9
1994 (7)           46      Hybrid group 6              1/7
                 47-51     El Tor variant              5/7
                   52      Hybrid group 7              1/7
1995 (11)        53-62     El Tor variant             10/11
                   63      Hybrid group 6             1/11
1996 (3)         64-65     El Tor variant              2/3
                   66      Hybrid group 7              1/3
1997 (3)           67      El Tor variant              1/3
                 68-69     El Tor variant              2/3
1998(2)          70-71     El Tor variant              2/2
1999 (179)       72-78     El Tor variant             7/179
                 79-83     El Tor variant             5/179
                 84-85     Hybrid group 6             2/179
                 86-115    Hybrid group 8            30/179
                116-247    El Tor variant            132/179
                  248      Hybrid group 9             1/179
                  249      Hybrid group 10            1/179
                  250      Hybrid group 11            1/179
2000 (21)       251-270    El Tor variant             20/21
                  271      Hybrid group 8             1/21
2001 (27)       272-294    El Tor variant             23/27
                295-298    Hybrid group 8             4/27
2002 (13)       299-306    El Tor variant             8/13
                  307      Hybrid group 8             1/13
                308-310    Hybrid group 11            3/13
                  311      El Tor variant             1/13
2003 (8)        312-315    El Tor variant              4/8
                  316      Hybrid group 8              1/8
                  317      Hybrid group 11             1/8
                  318      Hybrid group 12             1/8
                  319      Hybrid group 13             1/8
2004 (9)        320-324    El Tor variant              5/9
                325-327    Hybrid group 8              3/9
                  328      Hybrid group 12             1/9
2009 (2)        329-330    El Tor variant              2/2

n, total number of strain(s) of the indicated year; PB,
susceptibility to 50 units of polymyxin B; CCA, chicken red blood
cell agglutination; VP, Voges-Proskauer test; MAMA, mismatch
amplification mutation assay; R, resistant; S, sensitive; +,
positive; -, negative; C, classical; E, El Tor

Table II. V. cholerae O1 reference
strains isolated from various countries

No.  Name of   Year of    Country of     Serotype  Phenotype
     isolate   isolation  origin
     (n = 19)                                      PB  CCA  VP

1    569B      1948       India          Inaba     S   -    -
2    GP71      1971       India          Ogawa     R   +    +
3    N16961    1975       Bangladesh     Inaba     R   +    +
4    2463-78   1978       Australia      Inaba     R   -    -
5    GP156     1979       Australia      Ogawa     R   +    -
6    2164-88   1988       United states  Inaba     R   +    +
7    295/33    1990       Thailand       Ogawa     R   -    +
8    C6706     1991       Peru           Inaba     R   +    +
9    C7754     1991       Romania        Ogawa     R   +    -
10   MJ1485    1994       Bangladesh     Inaba     R   -    +
11   B33       2004       Mozambique     Ogawa     R   +    -
12   AR15493   Unknown    Bangladesh     Inaba     R   +    +
13   AR15425   Unknown    Bangladesh     Inaba     R   +    +
14   G27875    Unknown    India (NICED)  Ogawa     R   +    +
15   SC11      Unknown    India (NICED)  Ogawa     R   +    +
16   GP12      Unknown    India          Ogawa     R   +    -
17   AS230     Unknown    India          Ogawa     R   +    +
18   AS231     Unknown    India          Ogawa     R   +    +
19   AS233     Unknown    India          Ogawa     R   -    +

No.  Genotype    Biotype         Originally
                                 identified
     ctxB  rstR                  biotype

1    C     C     Classical       Classical
2    C     E     El Tor variant  El Tor
3    E     E     El Tor          El Tor
4    C     C     Hybrid          El Tor
5    C     E     Hybrid          El Tor
6    C     C     El Tor variant  El Tor
7    E+C   E     Hybrid          El Tor
8    E+C   E     Hybrid          El Tor
9    C     E+C   Hybrid          El Tor
10   C     C     Hybrid          El Tor
11   C     C     Hybrid          El Tor
12   C     E     El Tor variant  El Tor
13   C     E     El Tor variant  El Tor
14   C     E     El Tor variant  El Tor
15   C     E     El Tor variant  El Tor
16   C     E     Hybrid          El Tor
17   C     E     El Tor variant  El Tor
18   C     E     El Tor variant  El Tor
19   C     E     Hybrid          El Tor

PB, susceptibility to 50 units of polymyxin B; CCA, chicken red
blood cell agglutination; VP, Voges-Proskauer test; R, resistant;
S, sensitive; +, positive; -, negative; C, classical; E, El Tor

Table III. PCR primers for the study of V. cholerae O1 genes

Gene (s)    Primer sequence                               Size of PCR
                                                           amplicon
                                                             (bp)

Simple PCR

rstRE       Forward: GCACCATGATTTAAGATGCTC                    501
            Reverse: TCGAGTTGTAATTCATCAAGAGTG              (El Tor)

rstRC       Forward: CTTCTCATCAGCAAAGCCTCCATC                 474
            Reverse: TCGAGTTGTAATTCATCAAGAGTG             (Classical)

MAMA-PCR

ctxB        Forward: ACTATCTTCAGCATATGCACATGG
            Reverse for El Tor: CTGGTACTTCTACTTGAAACA
            Reverse for classical: CTGGTACTTCTACTTGAAACG

Gene (s)                   PCR condition

               Initial     Denaturation     Annealing
            denaturation
Simple PCR

rstRE       94[degrees]C,  94[degrees]C,  58[degrees]C,
                5 min          60 s           60 s

rstRC       94[degrees]C,  94[degrees]C,  64[degrees]C,
                5 min          60 s           60 s

MAMA-PCR

ctxB        96[degrees]C,  96[degrees]C,  55[degrees]C,
                2 min          l0 s           l0 s

Gene (s)                   PCR condition          Reference

              Extension        Final      No. of
                             extension    cycles
Simple PCR

rstRE       72[degrees]C,  72[degrees]C,    30       22
                90 s           7 min

rstRC       72[degrees]C,  72[degrees]C,    30       22
                90 s           7 min

MAMA-PCR

ctxB        72[degrees]C,  72[degrees]C,    25       2l
                30 s           2 min

MAMA-PCR, mismatch amplification mutation assay-PCR

Table IV. Biotypes of the 330 V. cholerae Thailand clinical
strains

Biotype               Genotype        Phenotype

                      ctxB  rstR  PB    CCA   VP

Classical              C     C     S     -     -
El Tor                 E     E     R     +     +
El Tor                 E    E+C    R     +     +
Hybrid group 1         E     E     S     -     +
Hybrid group 2        E+C   E+C    R     -     +
Hybrid group 3         E    E+C    S     +     +
Hybrid group 4         E     E     S     +     +
Hybrid group 5         C    E+C    R     -     +
Hybrid group 6         C    E+C    R     +     -
Hybrid group 7         C    E+C    S     +     +
Hybrid group 8         C     C     R     +     -
Hybrid group 9         C     C     R     -     +
Hybrid group 10        C     C     R     -     -
Hybrid group 11        C     C     S     +     +
Hybrid group 12        C     C     S     +     -
Hybrid group 13        C     C     S     -     +
El Tor variant         C     C     R     +     +
El Tor variant         C    E+C    R     +     +
Unclassified group 1  E+C    E     R     +     +
Unclassified group 2  E+C   E+C    R     +     +

PB, susceptibility to 50 units of polymyxin B; CCA, chicken red
blood cell agglutination; VP, Voges-Proskauer test; R, resistant; S,
sensitive; +, positive; -, negative; C, classical; E, El Tor
COPYRIGHT 2011 Indian Council of Medical Research
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2011 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Na-Ubol, M.; Srimanote, P.; Chongsa-nguan, M.; Indrawattana, N.; Sookrung, N.; Tapchaisri, P.; Yamaz
Publication:Indian Journal of Medical Research
Article Type:Report
Geographic Code:9THAI
Date:Apr 1, 2011
Words:4769
Previous Article:Correlation of cyclin D1 expression with aggressive DNA pattern in patients with tobacco-related intraoral squamous cell carcinoma.
Next Article:Rapid situation & response assessment of diarrhoea outbreak in a coastal district following tropical cyclone AILA in India.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters