Printer Friendly

Huaiqihuang may protect from proteinuria by resisting MPC5 podocyte damage via targeting p-ERK/CHOP pathway.

INTRODUCTION

Proteinuria is a typical symptom of chronic kidney disease, which is caused by the dysfunction of glomerulus filtration membrane [1]. The glomerulus filtration membrane consists of endothelial cells, basement membrane, and podocytes [2]. Previous studies have demonstrated that the pathological changes in podocytes remain to be the major cause of proteinuria [3,4]. So far, the major treatment methods for proteinuria are medications, including adrenal cortical hormones and immune inhibitors [5,6]. However, some of these medications are prohibitive and they may produce large side effects such as high blood pressure, slow growth, diabetes, and femoral head necrosis [7,8]. Hence, it is necessary to develop useful and inexpensive medications for the proteinuria control.

Huaiqihuang (HQH) granules, a kind of Chinese herbal medicine, are composed of tree ear fungus, medlar, and Huang Jing [9]. The mechanisms of HQH in treating diseases are complex, and include the activation of macrophages, neutrophils, or natural killer cells, promotion of the proliferation and differentiation of T cells, and improvement in humoral immunity [10]. HQH is mainly applied when treating childhood diseases, including infantile respiratory infections and primary nephrotic syndrome [11]. In addition, a recent study has reported the application of HQH in treating adult primary IgA nephrotic syndrome [12]. Previous evidence shows that a possible mechanism of proteinuria is complex, and may be linked to glomerular podocyte protection, inflammation associated with podocyte damage, cell adhesion, and space conformation of cytoskeletal proteins [2,13].

Increasing evidence shows that the application of HQH in glomerular-related and immune inhibitor-induced autoimmune diseases demonstrate good effects [11,14]. Recently, other studies reported that HQH functions as a protector in nephrotic syndrome patients by reducing proteinuria and shortening the course of the disease [15,16]. Additionally, Liu et al. reported that HQH reduces proteinuria by enhancing nephrin expression and regulating the necrosis factor kB signaling pathway in adriamycin-induced nephropathy [17].

Extracellular signal-regulated kinases (ERK), also known as mitogen-activated protein kinases (MAPK), act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, and development [18]. DNA damage-inducible transcript 3 (DDI[T.sub.3]), also known as C/EBP homologous protein (CHOP), functions as a dominant-negative inhibitor by forming heterodimers with other C/EBP members, and preventing their DNA biding activity [19]. Previous studies showed that the activation of ERK or CHOP (p-ERK/CHOP) may result in the damage of podocytes [20].

Although various papers have demonstrated the protective role of HQH in proteinuria and glomerular-related diseases, these mechanisms are still unclear.

In this study, we cultured podocytes in vitro, induced the proteinuria model using tunicamycin (TM), and analyzed the potential effects of HQH on the biological processes of [MPC.sub.5] podocytes. Comprehensive experimental methods were used to detect the effects of HQH on the [MPC.sub.5] podocyte cell proliferation, apoptosis, and associated protein expression. This study was aimed to investigate the possible molecular mechanism of HQH in treating proteinuria. Our study may provide theoretical basis for the application of combined traditional Chinese and Western medicine in clinical treatment of proteinuria.

MATERIALS AND METHODS

Podocyte culture in vitro

The cell culture plates were pretreated with 50 pg/ml of type I collagen for 1h at 37[degrees]C. After that, the [MPC.sub.5] podocytes were cultured in RPMI 1640 medium supplemented with 10 U/ml of [gamma]-interferon and 10% fetal bovine serum (FBS) (Sigma, USA) at 33[degrees]C in an atmosphere of 5% C[O.sub.2]. After 24h of incubation, the cultured cells were washed with sterile PBS buffer, two time each, then 1 ml of Trypsin-EDTA (0.25%: 0.02%) was added into the cells for tens of seconds at room temperature. When the cells were characterized with increased intercellular space and retracting round cell bodies, 2 ml of fresh medium was added into the cells. After that, cells were centrifuged at 1000 rpm for 5 min before the cell collection. The collected cells were diluted (1:2) with the fresh medium for the generation preparation.

Model construction and HQH treatment

The [MPC.sub.5] podocytes were transferred onto 96-well plates with RPMI 1640 containing 1% FBS. After 24h of incubation, the cells were separated into 6 groups, followed by the subsequent treatment [21,22]: control group (cells treated without TM), experimental group 1 (cells treated with 0.5 [micro]mol/l of TM), experimental group 2 (cells treated with 1 [micro]mol/l of TM), experimental group 3 (cells treated with 5 [micro]mol/l of TM), experimental group 4 (cells treated with 10 [micro]mol/l of TM), and experimental group 5 (cells treated with 50 [micro]mol/l of TM). The cells in each group were cultured for 24h and 48h before the cell collection.

The HQH (Batch number: 20070302, Qidong

GAITIANLI co., LTD, China) was dissolved in purified water to prepare the mixture with the concentration of 200 mg/ml. The mixtures were then added to the cultured cells to adjust the appropriate concentration for the following assay. For HQH treatment, MTT and LDH toxicity assays were used as previously described [23, 24], to determine the optimal concentration when applying HQH to [MPC.sub.5] cells. Briefly, the cells were washed with PBS buffer, two time each. Then, 20 pl of MTT was added into the cells and they were incubated for 4h at 37[degrees]C. After that, 150 [micro]l of dimethylsulfoxide (DMSO) was mixed with the cells for 10 min. The absorbance of the cells in each well was observed at 570 nm under an absorption spectrophotometer (Olympus, Japan). In addition, for LDH toxicity assay [25], the necrotic cells were collected and 10 pl of the cells was mixed with NAD I (v: v, 5:1). After that, 60 pl of the cell mixtures was treated with 2,4-DNPH at 37[degrees]C for 15 min. Then, 150 [micro]l of stop buffer was used to stop the reaction. The percentage of LDH release was calculated using the form: the LDH activity unit in medium/(the LDH activity unit in medium + the LDH activity unit in cell lysis solution) X 100.

Quantitative reverse transcription PCR (qRT-PCR)

The total RNA extraction from the [MPC.sub.5] cells, collected at 48 h, was performed using TRIzol Reagent (Invitrogen, USA), as previously described [26], and RNase-free DNase I (Promega Biotech, USA). The concentration and purity of the isolated RNA were measured with SMA 400 UV-VIS (Merinton, Shanghai, China). The purified RNA (density of 0.5 pg/pl), dissolved in nuclease-free water, was used for cDNA synthesis with the PrimerScript 1st Strand cDNA Synthesis Kit (Invitrogen). The expression was detected in an Eppendorf Mastercycler (Brinkman Instruments, Westbury, NY) using the SYBR ExScript RT-PCR Kit (Takara, China). Phosphoglyceraldehyde dehydrogenase (GAPDH) was used as the internal control. Primers used for the amplification are shown in Table 1.

Western blotting

Cells cultured at 48h in each group were treated with RIPA assay (radioimmunoprecipitation; Sangon Biotech, China) lysate containing PMSF (phenylmethanesulfonyl fluoride; Sigma), and then were centrifuged at 12 000 rpm for 10 min at 4[degrees]C. The supernatant was collected for the measurement of protein concentration using the BCA Protein Assay Kit (Pierce, Rochford, IL). For Western blotting [27], 40 pg of proteins per cell lane was subjected to 12% sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE), then the proteins were transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, MA, USA). The PVDF membranes were blocked in Tris-Buffered Saline Tween (TBST) containing 5% non-fat milk for 1h at room temperature. Then the membranes were incubated with rabbit anti-human antibodies (Cullin-5, Bip, p-ERK, ERK, and CHOP, 1:100 dilution, Invitrogen) overnight at 4[degrees]C. After that, the membranes were incubated with horseradish peroxidase-labeled goat anti-rat secondary antibody (1:1000 dilution) at room temperature for 1h. Finally, the PVDF membranes were washed 3 times with 1x TBST buffer for 10 min each. The signals were detected after the incubation with a chromogenic substrate using the enhanced chemiluminescence (ECL) method. Additionally, [beta]-actin was used as the internal control.

Statistical analysis

All the experiments were conducted three times independently. The data are expressed as mean [+ or -] standard deviation (SD). The data were analyzed using the SPSS13.0 software and the statistical analysis between two groups was calculated using the Student's t test. The value of p < 0.05 was considered as statistically significant.

RESULTS

The TM-induced MPC5 endoplasmic reticulum stress model construction

The rat [MPC.sub.5] cells were cultured at 33[degrees]C and 37[degrees]C to induce the cell proliferation and differentiation respectively for the endoplasmic reticulum stress model construction (Figure 1A). The Western blotting showed that the expression of Cullin-5, a cell proliferation indicator, was higher in the [MPC.sub.5] cells treated at 33[degrees]C compared to the cells treated at 37[degrees]C (Figure 1B). Additionally, the immunofluorescence results showed that the [MPC.sub.5] cells were successfully constructed (Figure 1C). Furthermore, the cell viability assay revealed that the optimal concentration of TM for the [MPC.sub.5] cells was around 1-10 [micro]mol/l (Figure 1D).

Effects of HQH on the TM-treated [MPC.sub.5] cells

The influence of HQH on the TM-induced [MPC.sub.5] cells was analyzed based on the MTT and LDH assays. The results showed that the optimal concentration of HQH for [MPC.sub.5] cell viability was 0.2 mg/ml and the optimal concentration of HQH for [MPC.sub.5] cell toxicity was 2 mg/ml (Figure 2A and 2B). The number of apoptotic and necrotic [MPC.sub.5] cells was increased when the TM concentration was increased (Figure 2C). In addition, we observed that the protective effect of HQH on the [MPC.sub.5] cells was more apparent with longer HQH application. Figure 2D shows that when the [MPC.sub.5] cells were pretreated with HQH for 6h and another 30 h, the damage induced by TM on the [MPC.sub.5] cells was less severe.

Effects of HQH on proteinuria-related protein expression

We further analyzed the influence of HQH on proteinuria-related protein expression, including the cytoskeletal proteins, adhesion molecules, and foot process-related proteins (Figure 3). The results showed that the protein expression of synaptopodin, podocin, and nephrin was decreased with increased TM concentrations (from 0.5 to 5 [micro]mol/l) (Figure 3A and 3B). Interestingly, integrin-a3 and integrin-[beta]1 levels were increased by 0.5 [micro]mol/l of TM, while they were decreased by 5 [micro]mol/l of TM (Figure 3C). Furthermore, the Cullin-5 and Bip were down-regulated by the TM treatment in the [MPC.sub.5] cells, but their levels were increased after the HQH application for 6h (Figure 3D).

The possible mechanism of HQH in treating proteinuria

The effects of HQH on the protein expression related to p-ERK/CHOP signaling pathway were analyzed using Western blotting and qRT-PCR (Figure 4). The results showed that there was no significant difference in the protein and mRNA levels of ERK in the [MPC.sub.5] cells before or after the TM treatment, as well as after treatment with combined TM and HQH (Figure 4A and 4D). Nevertheless, the mRNA and protein expression of p-ERK and CHOP were all significantly increased by the TM treatment, in a dose independent manner, but this effect was suppressed by HQH (p < 0.01; Figure 4B, 4C, and 4D).

DISCUSSION

Increasing evidence has showed that podocyte damage is the major cause of glomerular proteinuria [2,4]. Therefore, timely prevention or alleviation of podocyte damage would help blocking the progression and development of chronic nephrosis. Numerous studies have demonstrated the pivotal protecting role of HQH in proteinuria and podocyte damage, but the mechanism still remains unclear. In this study, we constructed the podocyte damage model in vitro using [MPC.sub.5] cells induced with TM, and analyzed the potential protective effects of HQH in podocyte damage. The results showed that the podocyte damage model was successfully constructed, and HQH could recover the damage caused by TM on the [MPC.sub.5] cells, including the cell proliferation and apoptosis. Moreover, the HQH treatment could reverse the effects of TM on proteinuria and the expression of proteins related to the podocyte damage.

Since podocytes are terminally differentiated cells [28], the cultivation of podocytes in vitro is difficult. In this study, we cultured rat [MPC.sub.5] podocytes at 33[degrees]C or 37[degrees]C. Cullin-5 is a core component of Elongin-Cullin 2/5-SOCS-box protein E3 ubiquitin-protein ligase complexes, which mediates the ubiquitination and subsequent proteasomal degradation of target proteins [29]. Braun et al. proved that renal edema, glomerular structure changes, and proteinuria were observed in Zebrafish after the CUL5 knockdown [30], suggesting the pivotal role of Cullin-5 in maintaining the physiological function of glomerular epithelial cells. In addition, the CUL5 knockdown is correlated with low cell proliferation ability [31]. Our results showed that Cullin-5 levels were highly detected in the [MPC.sub.5] cells (Figure 1), indicating that the [MPC.sub.5] podocytes were successfully cultivated in vitro.

The endoplasmic reticulum stress is the major cause of diabetic nephropathy damage, and TM has been proved to be an inducer of the endoplasmic reticulum stress [32], In this study, when the [MPC.sub.5] cells were induced by TM (Figure 2), the cell proliferation was inhibited and the number of apoptotic cells was increased, Previous studies have showed that mutations in nephrin, podocin, and synaptopodin genes are the major cause of congenital nephrotic syndrome [33], Our results showed that the TM treatment significantly decreased the expression of nephrin, podocin, and synaptopodin with increasing concentrations while the expression of integrin-a3 and integrin-[beta]1 was suppressed by a high dose of TM (Figure 3), suggesting that the [MPC.sub.5] podocyte damage model was successfully constructed,

We further detected the expression of proteins related to podocyte damage in the [MPC.sub.5] cells treated by HQH, Sun et al, proved that HQH promotes the nephrin and podocin protein expression in rat renal tissues with Adriamycin-induced nephrosis [9], In this study, the results showed that the HQH treatment promoted the cell proliferation, suppressed the cell apoptosis, and increased the expression of nephrin, podocin, and synaptopodin proteins (Figure 2 and 3), implying the protective role of HQH in the [MPC.sub.5] damage,

Previous studies indicated that the activation of ERK or CHOP might result in the damage of podocytes, Anzai et al, proved that the endoplasmic reticulum stress effector, CHOP, could regulate chronic kidney disease-induced vascular calcification [20], Zhang et al, showed that the ERK activation resulted in the RPC6 up-regulation in angiotensin Il-induced podocyte apoptosis [34], Also, Fujita et al, demonstrated that ERK mediated the high-glucose-induced hypertrophy in renal tubular cells [35], In this study, the p-ERK and CHOP expression was up-regulated by the TM treatment in the [MPC.sub.5] cells (Figure 4), implying the p-ERK/CHOP signaling pathway activation, However, their expressions were decreased after the HQH application (Figure 4), Based on our results, we speculate that HQH may protect podocytes from damage by suppressing the p-ERK/CHOP signaling pathway activation.

Although our study revealed the crucial protective roles of HQH in podocyte damage, several limitations remained, Firstly, further experimental studies should be conducted in the animal model of glomerular proteinuria by using adult rats. Secondly, the protective effects of HQH on proteinuria may be mediated by all three components instead of one. Therefore, we will try to isolate one of the components from HQH to determine which has the main role. Thirdly, further experimental studies are still needed to explore the potential molecular mechanism of HQH in resisting the podocyte damage at transcriptional level, and to provide the theoretical basis for HQH application in adult glomerular proteinuria.

In conclusion, the data presented in this study showed that the Chinese medicine HQH may function as a protector in podocyte damage induced by TM, by suppressing the p-ERK/ CHOP signaling pathway. Our study may provide theoretical basis for the possible application of HQH in the clinical treatment of podocytes and proteinuria.

DECLARATION OF INTERESTS

The authors declare no conflict of interests.

ACKNOWLEDGMENTS

This study was supported by Research Program in Public Technology Application of Zhejiang Province (No. 2012C33048) and General Program of National Natural Science Foundation of China (No.81170664).

REFERENCES

[1] Jafar TH, Stark PC, Schmid CH, Landa M, Maschio G, De Jong PE, et al. Progression of chronic kidney disease: the role of blood pressure control, proteinuria, and angiotensin-converting enzyme inhibition. Ann Intern Med. 2003039(4)044-52. http://dx.doi.org/10.7326/0003-4819-139-4-200308190-00006.

[2] Harita Y. Tyrosine kinase signaling in kidney glomerular podocytes. J Signal Transduct. 2011;2011:317852. http://dx.doi.org/10.1155/2011/317852.

[3] Asanuma K, Yanagida-Asanuma E, Takagi M, Kodama F, Tomino Y. The role of podocytes in proteinuria. Nephrology 2007;12(Supplement s3):S15-20. http://dx.doi.org/10.1111/).1440-1797.2007.00876.x.

[4] Harita Y. The Mechanisms of proteinuria: The role of signaling in podocytes. Nihon Shoni Jinzobyo Gakkai Zasshi 2007;20:176-81. http://dx.doi.org/10.3165/jjpn.20.176.

[5] Silva C, Ines LS, Nour D, Straub RH. Differential male and female adrenal cortical steroid hormone and cortisol responses to interleukin-6 in humans. Ann N Y Acad Sci. 2002;966(1):68-72. DOI: 10.1111/j.1749-6632.2002.tb04203.x.

[6] Dong Y Gao G, Jiao X, Wang X. HPLC-MS Determination of adrenal cortical hormone in traditional chinese medicine. Chinese Pharmaceutical Affairs. 2013.

[7] Salama ZB. Pharmaceutical agent comprising blood components <10 Kda and their use for prophylaxis and treatment of defects of the immune system. United States patent US20080220083. 2008.

[8] Carlotti AP, Franco PB, Elias LL, Facincani I, Costa EL, Foss N, et al. Glucocorticoid receptors, in vitro steroid sensitivity, and cytokine secretion in idiopathic nephrotic syndrome. Kidney Int. 2004;65(2):403-8. DOI:10.1111/j.15230755.2004.00392.x.

[9] Wen S, Zhi Z, Jian Y Wang YH, Man X, Xia G, et al. Effects of Chinese herbal medicine Huaiqihuang Granule on nephrin and podocin expressions in renal tissues of rats with adriamycin-induced nephrosis. Chin J Integr Med. 2011;9(5):546-52. http://dx.doi.org/10.3736/jcim20110513.

[10] Cao GH, Liu CH, Yun Y Impacts of Huaiqihuang granules on humoral immunity and cellular immunity in children nephrotic syndrome. World Journal of Integrated Traditional & Western Medicine. 2013.

[11] Wang X, Luan J, Tao LI, Wang X. Clinical study on Huaiqihuang granule on infantile nephropathy palindromia and its mechanism. Journal of Hubei University of Chinese Medicine. 2011.

[12] Li LT, Shi MY, Wei SY, Li T, Li B. Huai Qi. Huang ameliorates proteinuria and hematuria in mild IgA nephropathy patients: a prospective randomized controlled study. J Formos Med Assoc. 2013012(12)766-72. http://dx.doi.org/10.1016/j.jfma. 2013.10.019.

[13] Huber T. Molekulare pathogenese der proteinuria [In German]. Dtsch med Wochenschr 2008; 133(18): 954-58. http://dx.doi.org/10.1055/s-2008-1075673.

[14] Ying MC, Miner JH. Glomerular basement membrane and related glomerular disease. Transl Res. 2012;160(4):291-7. http://dx.doi.org/10.1016/j.trsl.2012.03.004.

[15] Zhang B, Ning NI. Effect of Huaiqihuang particles on serum TNF-a, IL-18 and IL-10 in children with primary nephrotic syndrome. Chinese Journal of Practical Pediatrics. 201005(1).

[16] Zhao CG, Yang YC, Wu YB, Zhang B. Changes of T regulatory cells and interleukin-10 in children with primary nephrotic syndrome before and after treatment assisted with Huaiqihuang particles. Journal of Applied Clinical Pediatrics. 2011;26(n):859-68.

[17] Liu H, Sun W, Gu L, Tu Y Yu B, Hu H. Huaiqihuang Granules reduce proteinuria by enhancing nephrin expression and regulating necrosis factor kB signaling pathway in adriamycin-induced nephropathy. Chin J Integr Med. 2015.

[18] Arbabi S, Maier RV. Mitogen-activated protein kinases. Crit Care Med. 2002;30(1):S74-9. http://dx.doi.org/10.1097/00003246-200201001-00010.

[19] Ma Y, Wei S, Peker D. An extremely rare primary gallbladder myxoid liposarcoma associated with amplification of DDI[T.sub.3] gene. J Gastrointestin Liver Dis. 2014;23:460-1.

[20] Miyazaki-Anzai S, Masuda M, Demos-Davies KM, Keenan AL, Saunders SJ, Masuda R, et al. Endoplasmic reticulum stress effector CCAAT/enhancer-binding protein homologous protein (CHOP) regulates chronic kidney disease-induced vascular calcification. J Am Heart Assoc. 20143(3)0000949. http://dx.doi.org/10.1161/JAHA.114.000949.

[21] Rodriguez-Agudo D, Calderon-Dominguez M, Medina MA, Ren S, Gil G, Pandak WM. ER stress increases StarD5 expression by stabilizing its mRNA and leads to relocalization of its protein from the nucleus to the membranes. J Lipid Res. 2012341(12)586-7.

[22] Reiko I, Masaomi N, Hiroshi O, Hiroshi U, Yasuko K, Kiyokazu N, et al. Involvement of endoplasmic reticulum (ER) stress in podocyte injury induced by excessive protein accumulation. Kidney Int. 2005;68(6):2639-50. http://dx.doi.org/10.1111/j.1523-1755.2005.00736.x.

[23] Du L, Shi P, Zhao ZJ 1, Wu Ge-dun-qi-qi-ge, Zhang XX, Lin R. Effect of Tangshenping on podocytes' proliferation and apoptosis in high glucose and LPS environment. China Journal of Traditional Chinese Medicine & Pharmacy 2013.

[24] Radko L, Minta M, Stypula-Trqbas S. Cellular toxicity of malachite green and leucomalachite green evaluated on two rat cell lines by MTT, NRU, LDH, and protein assays. Bull Vet Inst Pulawy. 2011;55(2):347-53.

[25] Han X, Gelein R, Corson N, Wade-Mercer P, Jiang J, Biswas P, et al. Validation of an LDH assay for assessing nanoparticle toxicity. Toxicology. 2011387(1-3)59-104. http://dx.doi.org/10.1016/j.tox.2011.06.011.

[26] Hummon AB, Lim SR, Difilippantonio MJ, Ried T. Isolation and solubilization of proteins after TRIzol" extraction of RNA and DNA from patient material following prolonged storage. Biotechniques. 2007:42(4)367. http://dx.doi.org/10.2144/000112401.

[27] Mabuchi S, Altomare DA, Cheung M, Zhang L, Poulikakos PI, Hensley HH, et al. RAD001 inhibits human ovarian cancer cell proliferation, enhances cisplatin-induced apoptosis, and prolongs survival in an ovarian cancer model. Clin Cancer Res. 2007;13(14):4261-70. http://dx.doi.org/10.1158/1078-0432.CCR-06-2770.

[28] Hermann PD, Wilhelm K, Matthias K. Cell biology of the glomerular podocyte. Physiol Rev. 2003;83(1):253-307. http://dx.doi.org/10.1152/physrev.00020.2002.

[29] Samant RS, Clarke PA, Paul WE. E3 ubiquitin ligase Cullin-5 modulates multiple molecular and cellular responses to heat shock protein 90 inhibition in human cancer cells. Proc Natl Acad Sci U S A. 2014;111(18):6834-9. http://dx.doi.org/10.1073/pnas.1322412111.

[30] Braun MH, Steele SL, Perry SF. The responses of zebrafish (Danio rerio) to high external ammonia and urea transporter inhibition: nitrogen excretion and expression of rhesus glycoproteins and urea transporter proteins. J Exp Biol. 2009:212(Pt23)3846-56. http://dx.doi.org/10.1242/jeb.034157.

[31] Xu XM, Wang XB, Chen MM, Tao L, Li YX, Jia WH, et al. MicroRNA-19a and -19b regulate cervical carcinoma cell proliferation and invasion by targeting CUL5. Cancer Lett. 2012:322(2)048-58. http://dx.doi.org/10.1016/j.canlet.2012.02.038.

[32] Wu J, Zhang R, Torreggiani M, Ting A, Xiong H, Striker GE, et al. Induction of diabetes in aged C57B6 mice results in severe nephropathy: an association with oxidative stress, endoplasmic reticulum stress, and inflammation. Am J Pathol. 2010:176(5):2163-76. http://dx.doi.org/10.2353/ajpath.2010.090386.

[33] Garovic VD, Wagner SJ, Petrovic LM, Gray CE, Pauline H, Hikaru S, et al. Glomerular expression of nephrin and synaptopodin, but not podocin, is decreased in kidney sections from women with preeclampsia. Nephrol Dial Transplant. 2007:22(4)0136-43. http://dx.doi.org/10.1093/ndt/gfl711.

[34] Zhang H, Ding J, Fan Q, Liu S. RPC6 up-regulation in Ang Il-induced podocyte apoptosis might result from ERK activation and NF-[kappa]B translocation. Exp Biol Med. 2009:234:1029-36. http://dx.doi.org/10.3181/0901-RM-11.

[35] Fujita H, Omori S, Ishikura K, Hida M, Awazu M. ERK and p38 mediate high-glucose-induced hypertrophy and TGF-beta expression in renal tubular cells. Am J Physiol Renal Physiol. 2004:286(1):F120-6. http://dx.doi.org/10.1152/ajprenal.00351.2002.

Tingxia Li (1), Jianhua Mao (1) *, Lei Huang (1), Haidong Fu (1), Shuohui Chen (2), Aimin Liu (1), Yuqin Liang (1)

(1) Department of Nephrology, The Children's Hospital Zhejiang University School of Medicine, Hangzhou, Zhejiang, China, (2) Department of Nursing, The Children's Hospital Zhejiang University School of Medicine, Hangzhou, Zhejiang, China

* Corresponding author: Jianhua Mao, Department of Nephrology, The Children's Hospital Zhejiang University School of Medicine, No. 57 Zhugan Lane, Hangzhou, Zhejiang 310003, P.R. China, Tel: +86-0571-88873701, Email: maojianhua0401@126.com

Submitted: 19 November 2015/Accepted: 08 March 2016

TABLE 1. Primers used for targeted genes in this study

Target    Primer      Sequence (5'-3')

GAPDH     Sense       GGGTGGAGCCAAACGGGTC
          Antisense   GGAGTTGCTGTTGAAGTCGCA

SYNPO     Sense       GCCAGGGACCAGCCAGATA
          Antisense   AGGAGCCCAGGCCTTCTCT

ITGA3     Sense       GCCAAGCTAATGAGACCATC
          Antisense   TCAGCACGAGTGCTCGAGACTTG

1TGB1     Sense       AACGAGGTCATGGTTCATGTTGTG
          Antisense   GCATTCAGTGTTGTGGGATTTGC

ERK       Sense       AAAGAATTCGCCCGTTCATTCCTTTGCT
          Antisense   AAAGCGGCCGCTTCTTCATCGCCTCTTCC

DDIT3     Sense       GAGTTGGAGGCGTGGTATGA
          Antisense   CCTTGGTGGCGATTGGTGAA

ERK: Extracellular signal-regulated kinase
COPYRIGHT 2016 Association of Basic Medical Sciences
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:RESEARCH ARTICLE
Author:Li, Tingxia; Mao, Jianhua; Huang, Lei; Fu, Haidong; Chen, Shuohui; Liu, Aimin; Liang, Yuqin
Publication:Bosnian Journal of Basic Medical Sciences
Date:Aug 1, 2016
Words:4162
Previous Article:Mammary analogue secretory carcinoma (MASC) of the salivary gland: a new tumor entity.
Next Article:Apoptosis in pancreatic [beta]-islet cells in Type 2 diabetes.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |