Printer Friendly

High level aminoglycoside resistant enterococci in hospital-acquired urinary tract infections in Mansoura, Egypt.

Introduction

In recent decades, enterococci have become significant nosocomial pathogens with multiple-drug resistance mechanisms. (1) Urinary tract infection (UTI) is one of the most common type of infections generated by these organisms. (2) UTI is a significant cause of morbidity and mortality among adults. (3)

The treatment of choice for serious enterococcal infections is an aminoglycoside in combination with a cell wall active agent. (4) However, high-level aminoglycoside resistance (HLAR) is responsible for loss of synergy between agents active on the cell wall and aminoglycosides. (5) In enterococci, HLAR is mediated by aminoglycoside-modifying enzymes (AMEs). (6) There are three classes of AMEs: N-acetyltransferases (AAC), O-adenylyltransferases (ANT), O-phosphotransferases (APH). (7)

The rate of enterococci with HLAR and the distribution of AMEs vary across countries. (8) Knowledge of the frequency of these resistance genes is important to inform the management of enterococcal infections. Little is known about the rate of HLAR enterococci in Egypt.

This study was conducted to determine the rate of HLAR and the distribution of AME genes in enterococci isolated from patients with hospital acquired UTI at Mansoura University Hospitals in Egypt.

Methods

A cross-sectional study was conducted in Mansoura University Hospital (MUH), Mansoura, Egypt. Enterococci were isolated from urine samples collected from patients with hospital acquired (HA) UTI for a period of 2 years from August 2014 to July 2016 in MUH. Infections were considered as HA infections when new infection developed after 48 h of patient admission. The study was approved by the institutional research board (MS/16.11.19) at the Faculty of Medicine, Mansoura University.

Identification

Isolates were identified based on black colonies on bile esculin agar media, Gram staining, catalase test and bacterial growth in 6.5% NaCl. (9) Multiplex PCR using specific ddl E.faecalis and ddl E.faecium genes was performed to identify both Enterococcus faecalis and Enterococcus faecium respectively. (10)

Antimicrobial susceptibility testing

The antimicrobial susceptibility tests were performed for enterococcal strains using the disc diffusion in accordance with Clinical and Laboratory Standards Institute (CLSI) criteria. (11) The following antibiotics were used: penicillin 10 U, ampicillin 10 [micro]g, nitrofurantoin 10 [micro]g, tetracycline 30 [micro]g, ciprofloxacin 5 [micro]g, vancomycin 5 [micro]g, linezolid 10 [micro]g and trimethoprim/sulfamethoxazole 25 [micro]g. High level gentamicin (120 [micro]g) and streptomycin (300 [micro]g) discs (Mast Diagnostics, Merseyside, UK) were used to detect high level gentamicin resistance (HLGR) and high level streptomycin resistance (HLSR) respectively. Etests for gentamicin and streptomycin (Liofilchem, Roseto degli Abruzzi, Italy) were used for strains with zones of 7 to 9 mm to prove resistance or sensitivity. (11)

PCR detection of AME

Six aminoglycoside resistance genes were detected in all strains via multiplex PCR conducted as previously reported with certain modifications: two multiplex PCR amplifications were separately performed using 1) aph(2)-Id, aph(3')-IIIa, ant(4')-Ia primers 2) aac(6')-Ie-aph(2")-Ia, aph(2")-Ib, aph(2')-Ic primers, separately. PCR was conducted in a PerkinElmer GeneAmp 2400 thermal cycler with an initial lysis step of 2 min at 94[degrees]C; 35 cycles of 40 s at 94[degrees]C, 60 s at 55[degrees]C, and 80 s at 72[degrees]C; and a final extension step of 5 min at 72[degrees]C. (6) Another PCR was done for detection of aac(6 ')-Ii, ant(6)-Ia genes as previously described. (8)

PCR products were analyzed by electrophoresis in a 2% agarose gel that was stained with ethidium bromide. Primers used in this study and the product sizes of analysed genes are listed in Table 1.

Statistical analysis

Data were statistically analysed using the Statistical Package for Social Sciences (SPSS) version 16 (SPSS Inc., Chicago, IL, USA). Qualitative data are described as numbers and percentages. [chi square] test or Fisher's exact test were used for comparison between groups, as appropriate. Results with p<0.05 were considered significant.

Results

During the study period, eighty enterococcal isolates were isolated from the urine samples of patients suffering from hospital acquired UTI. Seventy-three (91.25%) isolates were identified as E. faecalis and 7 (8.75%) as E. faecium.

All enterococcal isolates were resistant to penicillin and ampicillin, but no isolates were resistant to vancomycin and linezolid. Antibiotic resistance to tetracycline and trimethoprim/sulfamethoxazole were 91.25% and 68.25% respectively. Seventy isolates (87.5%) of enterococcal isolates were multidrug resistant (MDR). There were no significant differences in antibiotic resistance patterns between E. faecalis and E. faecium. Antimicrobial resistance profiles of the enterococcal isolates are presented in Table 2.

Fifty-three (66.3%) enterococcal isolates (48 E. faecalis and 5 E. faecium) exhibited HLAR (both HLGR and HLSR) and 5 (6.3% isolates exhibited HLGR alone. The aph(3')-IIIa and aac(6')-Ie-aph(2)-Ia genes were identified in 53 and 52 HLAR strains respectively, and aph(2')-Id was identified in 4 E. faecium isolates. All isolates with HLSR carried the ant(6)-Ia gene. The aph(2" )-Ib, aph(2')-Ic, ant(4')-Ia and aac(6')-Ii were not detect in any of the HLR isolates. No PCR product was detected in any of the 22 nonHLAR enterococci. Distribution of AME is summarized in Table 3.

Discussion

An increasing incidence of enterococci with high rates of resistance has been noticed in recent decades. (12) Several studies have showed that E. faecalis was the most common enterococcal isolate in clinical samples. (13-15) These findings are consistent with the results of this study, in which 91.25% of enterococcal isolates were E. faecalis. However, another report stated that E. faecium infections are of increasing frequency. (14)

In the present study, 87.5% of enterococci exhibited multidrug resistant (MDR). In previous studies, the rate of MDR varied from 45% to 100%. (15-18) This high rate of MDR among enterococci may be due to the abuse of antibiotics and selective pressure. Although all of our isolates were sensitive to vancomycin, none of the isolates were sensitive to penicillin or ampicillin. This finding is in agreement with previously reported results. (19-21) There was no significant difference in antimicrobial resistance between E. faecalis and E. faecium. In contrast, Celik et al. reported that antibiotic resistance percentages were higher in E. faecium than in E. faecalis. (14)

The rate HLGR in enterococci varies from 1% to 89% in different regions.7'22'23 The most common gene associated with HLGR is aac(6')-Ie-aph(2)-Ia. (5,7,24) In our study the rate of HLGR among enterococci was 72.5%. Both Del Campo and our group found the aph(3')-IIIa gene slightly more often than the aac(6')-Ie-aph(2)-Ia gene. (25)

In this study, HLSR was detected at a lower rate than HLGR. Moreover, HLSR coexisted with HLGR. Prior publications have reported the same findings. (16,21) In contrast, in other studies HLSR was more common than HLGR. (25,26) In the current investigation, the ant(6)-Ia gene was detected in all HLSR isolates as previously reported. (25) However, this gene was detected at a lower rate in another study. (24)

In this work, all isolates with HLAR had multiple AMEs genes. The aac(6')-Ie-aph(2)-Ia gene was associated with the aph(3')-IIIa and ant(6)-Ia gene in 69% of isolates with HLAR. This finding is consistent with previous reports. (24,25) The presence of many AME genes in the isolates indicate that neither gentamicin nor streptomycin can be used to achieve synergy with glycopeptides. (24)

Conclusion

This study showed that enterococci isolated from hospital acquired UTI were resistant to multiple antibiotics. Furthermore, the frequency of HLGR was higher than that of HLSR. The most common AME genes were aph(3')-IIIa and ant(6)-Ia followed by aac(6')-Ie-aph(2)-Ia.

doi: 10.18683/germs.2018.1145

Authors' contributions statement: RE designed the study, carried out the microbiological tests, wrote the manuscript. RE, AM, GE shared in analysis and interpretation of data, drafting of the article and critical revision. All authors read and approved the final manuscript.

Conflicts of interest: All authors--none to declare.

Funding: None to declare.

Note: Presented in part at ICPIC 2017

References

(1.) Simonsen GS, Smabrekke L, Monnet DL, et al. Prevalence of resistance to ampicillin, gentamicin and vancomycin in Enterococcus faecalis and Enterococcus faecium isolates from clinical specimens and use of antimicrobials in five Nordic hospitals. J Antimicrob Chemother 2003;51:323-31. [Crossref]

(2.) Barros M, Martinelli R, Rocha H. Enterococcal urinary tract infections in a university hospital: clinical studies. Braz J Infect Dis 2009;13:294-6. [Crossref]

(3.) Cortes-Penfield NW, Trautner BW, Jump RLP. Urinary tract infection and asymptomatic bacteriuria in older adults. Infect Dis Clin North Am 2017;31:673-88. [Crossref]

(4.) Landman D, Quale JM. Management of infections due to resistant enterococci: a review of therapeutic options. J Antimicrob Chemother 1997;40:161-70. [Crossref]

(5.) Vakulenko SB, Donabedian SM, Voskresenskiy AM, Zervos MJ, Lerner SA, Chow JW. Multiplex PCR for detection of aminoglycoside resistance genes in enterococci. Antimicrob Agents Chemother 2003;47:1423-6. [Crossref]

(6.) Zarrilli R Tripodi MF, Di Popolo A, et al. Molecular epidemiology of high-level aminoglycoside-resistant enterococci isolated from patients in a university hospital in southern Italy. J Antimicrob Chemother 2005;56:827-35. [Crossref]

(7.) Shete V, Grover N, Kumar M. Analysis of aminoglycoside modifying enzyme genes responsible for high-level aminoglycoside resistance among enterococcal isolates. J Pathog 2017;2017:3256952. [Crossref]

(8.) Kobayashi N, Alam M, Nishimoto Y, Urasawa S, Uehara N, Watanabe N. Distribution of aminoglycoside resistance genes in recent clinical isolates of Enterococcus faecalis, Enterococcus faecium and Enterococcus avium. Epidemiol Infect 2001;126:197-204. [Crossref]

(9.) Forbes BA, Sahm DF, Weissfeld AS, Trevino E. Bailey & Scott's diagnostic microbiology. St Louis: Mosby. Inc; 2002.

(10.) Dutka-Malen S, Evers S, Courvalin P. Detection of glycopeptide resistance genotypes and identification to the species level of clinically relevant enterococci by PCR. J Clin Microbiol 1995;33:24-7.

(11.) Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing. 26th ed. CLSI supplement M100s. CLSI; 2016.

(12.) Hollenbeck BL, Rice LB. Intrinsic and acquired resistance mechanisms in enterococcus. Virulence 2012;3:421-33. [Crossref]

(13.) Low DE, Keller N, Barth A, Jones RN. Clinical prevalence, antimicrobial susceptibility, and geographic resistance patterns of enterococci: results from the SENTRY Antimicrobial Surveillance Program, 1997-1999. Clin Infect Dis 2001;32 Suppl 2:S133-45. [Crossref]

(14.) Celik S, Cakirlar FK, Torun MM. Presence of vancomycin, aminoglycosides, and erythromycin resistance genes in enterococci isolated from clinical samples in Turkey. Clin Lab 2014;60:1801-6. [Crossref]

(15.) Dadfarma N, Imani Fooladi AA, Oskoui M, Mahmoodzadeh Hosseini H. High level of gentamicin resistance (HLGR) among enterococcus strains isolated from clinical specimens. J Infect Public Health 2013;6:202-8. [Crossref]

(16.) Bhatt P, Patel A, Sahni AK. et al. Emergence of multidrug resistant enterococci at a tertiary care centre. Med J Armed Forces India 2015;71:139-44.

(17.) Hashem YA, Yassin AS, Amin MA. Molecular characterization of Enterococcus spp. clinical isolates from Cairo, Egypt. Indian J Med Microbiol 2015;33 Suppl:806. [Crossref]

(18.) Olawale KO, Fadiora SO, Taiwo SS. Prevalence of hospital-acquired enterococci infections in two primary-care hospitals in osogbo, southwestern Nigeria. Afr J Infect Dis 2011;5:40-6. [Crossref]

(19.) Osuka H, Nakajima J, Oishi T et al. High-level aminoglycoside resistance in Enterococcus faecalis and Enterococcus faecium causing invasive infection: Twelve-year surveillance in the Minami Ibaraki Area. J Infect Chemother 2016;22:61-3. [Crossref]

(20.) Rudy M, Nowakowska M, Wiechula B, Zientara M, Radosz-Komoniewska H. [Antibiotic susceptibility analysis of Enterococcus spp. isolated from urine]. Przegl Lek 2004;61:473-6.

(21.) Qu TT, Chen YG, Yu YS, Wei ZQ, Zhou ZH, Li LJ. Genotypic diversity and epidemiology of high-level gentamicin resistant Enterococcus in a Chinese hospital. J Infect 2006;52:124-30. [Crossref]

(22.) Schouten MA, Voss A, Hoogkamp-Korstanje JA. Antimicrobial susceptibility patterns of enterococci causing infections in Europe. The European VRE Study Group. Antimicrob Agents Chemother 1999;43:2542-6. [Crossref]

(23.) Khani M, Fatollahzade M, Pajavand H, Bakhtiari S, Abiri R. Increasing prevalence of aminoglycoside-resistant Enterococcus faecalis isolates due to the aac(6')aph(2") gene: A therapeutic problem in Kermanshah, Iran. Jundishapur J Microbiol 2016;9:e28923. [Crossref]

(24.) Udo EE, Al-Sweih N, John P, Jacob LE, Mohanakrishnan S. Characterization of high-level aminoglycoside-resistant enterococci in Kuwait hospitals. Microb Drug Resist 2004;10:139-45. [Crossref]

(25.) del Campo R, Tenorio C, Rubio C, Castillo J, Torres C, Gomez-Lus R. Aminoglycoside-modifying enzymes in high-level streptomycin and gentamicin resistant Enterococcus spp. in Spain. Int J Antimicrob Agents 2000;15:221-6. [Crossref]

(26.) Sienko A, Wieczorek P, Wieczorek A, et al. Occurrence of high-level aminoglycoside resistance (HLAR) among Enterococcus species strains. Prog Health Sci 2014;4:179-87.

Rasha ElMahdy [1], *, Ahmed Mostafa [2], Ghada El-Kannishy [3]

Received: 30 September 2018; revised: 11 November 2018; accepted: 14 November 2018.

[1] MD, Department of Medical Microbiology and Immunology, Faculty of Medicine, Mansoura University, Mansoura 35516, Egypt; [2] MSc, Department of Medical Microbiology and Immunology, Faculty of Medicine, Mansoura University, Mansoura 35516, Egypt; [3] MD, Department of Internal Medicine, Faculty of Medicine, Mansoura University, Mansoura 35516, Egypt.

* Corresponding author: Rasha El-Mahdy, MD, Department of Medical Microbiology and Immunology, Faculty of Medicine, Mansoura University, Mansoura 35516, Egypt. rashaamr@mans.edu.eg.
Table 1. Specific primers used in this study

                                            Product
                                              size
Gene           Primer sequence (5'-3')        (bp)    Reference

aac(6')-Ie-    CAGAGCCTTGGGAAGATGAAG           348        5
aph(2")-Ia     CCTCGTGTAATTCATGTTCTGGC

aph(2')-Ib     CTTGGACGCTGAGATATATGAGCAC       867        5
               GTTTGTAGCAATTCAGAAACACCCTT

aph(2')-Ic     CCACAATGATAATGACTCAGTTCCC       444        5
               CCACAGCTTCCGATAGCAAGAG

aph(2')-Id     GTGGTTTTTACAGGAATGCCATC         641        5
               CCCTCTTCATACCAATCCATATAACC

aph(3')-IIIa   GGCTAAAATGAGAATATCACCGG         523        5
               CTTTAAAAAATCATACAGCTCGCG

ant(4')-Ia     CAAACTGCTAAATCGGTAGAAGCC        294        5
               GGAAAGTTGACCAGACATTACGAACT

aac(6')-Ii     TGGCCGGAAGAATATGGAGA            410        8
               GCATTTGGTAAGACACCTACG

ant(6)-Ia      CGGGAGAATGGGAGACTTTG            563        8
               CTGTGGCTCCACAATCTGAT

ddl E.         ATCAAGTACAGTTAGTCT              941        10
faecalis       ACGATTCAAAGCTAACTG

ddl E.         TAGAGACATTGAATATGCC             550        10
faecium        TCGAATGTGCTACAATC

Table 2. Antimicrobial resistance of E. faecalis and E. faecium

Antibiotic          E. faecalis  E. faecium
                       (n=73)       (n=7)     P-value    OR

Ampicillin           73 (100%)     7 (100%)     N/A     N/A
Nitrofurantoin       34 (46.6%)   5 (71.4%)    0.285   2.868
Tetracycline         67 (91.8%)   6 (85.7%)    0.487   0.537
Ciprofloxacin        62 (84.9%)    4 (5.7%)    0.098   0.237
Trimethoprim/        64 (87.7%)   5 (71.4%)    0.245   0.352
  sulfamethoxazole
Linezolid              0 (0%)       0 (0%)      N/A     N/A
Vancomycin             0 (0%)       0 (0%)      N/A     N/A
HLG gentamicin       52 (71.2%)   6 (85.7%)    0.667   2.423
HLS streptomycin     48 (65.8%)   5 (71.4%)      1     1.302
Penicillin           73 (100%)     7 (100%)     N/A     N/A

Antibiotic
                        (95%CI)

Ampicillin                N/A
Nitrofurantoin      (0.522-15.746)
Tetracycline         (0.055-5.231)
Ciprofloxacin        (0.046-1.206)
Trimethoprim/        (0.059-2.089)
  sulfamethoxazole
Linezolid                 N/A
Vancomycin                N/A
HLG gentamicin      (0.275-21.367)
HLS streptomycin     (0.236-7.196)
Penicillin                N/A

Data are no. (%). HLG--high level gentamicin; HLS--high
level streptomycin; N/A--not applicable.

Table 3. Distribution of aminoglycoside-modifying genes
in E. faecalis and E. faecium

  Presence of aminoglycoside-modifying genes

 aac(6')-Ie-   ant(6)-   aph(3')-   aph(2')-      E.           E.
 aph(2")-Ia      Ia       IIIa        Id       faecalis     faecium
   (n=53)      (n=53)     (n=54)     (n=4)       (n=73)       (n=7)

      +           +         +          -       39 (53.4%)   1 (14.3%)
      +           +         -          -        4 (5.5%)     0 (0%)
      +           +         +          +         0 (0%)     4 (57.1%)
      -           +         +          -        5 (6.8%)     0 (0%)
      +           -         +          -        4 (5.5%)    1 (14.3%)
      -           -         -          -       21 (28.8%)   1 (14.3%)
COPYRIGHT 2018 Asociatia pentru Cresterea Vizibilitatii Cercetarii Stiintifice (ACVCS)
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2018 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Original article
Author:Mahdy, Rasha El-; Mostafa, Ahmed; Kannishy, Ghada El-
Publication:GERMS
Article Type:Report
Geographic Code:7EGYP
Date:Dec 1, 2018
Words:2545
Previous Article:Rapid detection of salmonellosis due to Salmonella enterica serovar Typhimurium in Peruvian commercially bred cavies, using indigenous wild...
Next Article:Detection of antibiotic-producing Actinobacteria in the sediment and water of Ma'in thermal springs (Jordan).
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters