Printer Friendly

High level aminoglycoside resistance and distribution of aminoglycoside resistant genes among clinical isolates of Enterococcus species in Chennai, India.

1. Introduction

Enterococci have emerged as an important multiple-drug resistant nosocomial pathogen reported worldwide. Its resistance to wider range of antimicrobial agents particularly, aminoglycosides, glycopeptides and beta-lactams had increasingly been documented [1]. Although enterococci are intrinsically resistant to low levels of aminoglycosides, high level resistance to aminoglycosides (MIC [greater than or equal to] 2000 [micro]g/mL) is mediated by acquisition of genes encoding AMEs. High level gentamicin resistance (MIC [greater than or equal to] 500 [micro]g/mL) in enterococci is predominantly mediated by aac(6')-Ie-aph(2")-Ia, which encodes the bifunctional aminoglycoside modifying enzyme AAC(6')VAPH(2"). The action of this enzyme in enterococci eliminates the synergistic activity of gentamicin when combined with a cell wall active agent, such as ampicillin or vancomycin. Recently, newer AME genes such as aph(2")Ib, aph(2")-Ic, and aph(2")-Id have been detected as those conferring gentamicin resistance in enterococci. High level streptomycin and kanamycin resistance in enterococci are mediated by aph(3')-IIIa gene encoding aminoglycoside phosphotransferase enzyme, APH(3,)-IIIa [2]. In India, high level aminoglycoside resistance has been reported from different centers; however, studies on prevalence of these resistance genes are limited. The goal of this study is to determine rate of high level aminoglycoside resistance and aminoglycoside resistance encoding genes in enterococcal isolates collected from different specimen sources in Chennai.

2. Materials and Methods

2.1. Bacterial Strains. A total of 178 nonidentical clinical isolates of enterococci were obtained from clinical specimens from various tertiary care centers from Chennai, during a period of 2010-2012. Appropriate inpatient details were collected and recorded to avoid identical isolates from the same patient. An Institutional ethical clearance was obtained for conducting this study (reference number: 1168). The strains were initially grown on MacConkey agar (MV082) and Enterococcus confirmatory agar (M392) (HiMedia, Mumbai, India). Species characterization was carried out by carbohydrate fermentation test using 1% sugars such as sucrose, sorbose, sorbitol, mannitol, glucose, pyruvate, inulin, ribose, melibiose, raffinose, arabinose, and arginine. All the isolates were confirmed for genus and species by standard protocols [3]. Enterococcus faecium and Enterococcus faecalis were further confirmed by PCR analysis using specific [ddl.sub.E.faecjum] and [ddl.sub.E.faeces] genes, respectively [4].

2.2. Minimum Inhibitory Concentration for Aminoglycosides.

The isolates were confirmed as high level aminoglycoside resistant enterococci (HLARE) by considering growth [greater than or equal to] 512 [micro]g/mL for gentamicin and [greater than or equal to]2048 [micro]g/mL for streptomycin. The overnight bacterial cultures were adjusted to 0.5 McFarland's turbidity and the inoculum was spot inoculated on the surface of brain heart infusion agar with increasing concentrations of gentamicin and streptomycin antibiotics (HiMedia, Mumbai, India). The plates were incubated at 37[degrees]C for 24 hrs and inspected for more than one colony forming units in the spotted area. Enterococcus faecalis ATCC 29212 was used as a negative control strain.

2.3. Molecular Analysis of Aminoglycoside Modifying Genes by PCR. The primers for AME genes such as aac(6)-Ieaph(2")-Ia; aph(2")-Ib; aph(2n)-Ic; aph(2n)-Id and aph(3')IIIa included in this study were previously described [5].

PCR was carried out with reaction tube containing 1 [micro]L template DNA prepared from boiling lysis of bacterial suspension added to a 50 [micro]L reaction mixture containing 25 mM Tris/HCl, 50 mM KCl, 1.5 mM Mg[Cl.sub.2],0.2 Mm of each dNTP (Bangalore Genei, India), and 1.5 U Taq polymerase (Bangalore Genei, India). First reaction with a pair of 25 pmol each of primers for aac(6)-Ie-aph(2n)-Ia and aph(3')-IIIa (Sigma Aldrich, USA) and second reaction with aph(2")-Ib, aph(2")-Ic, aph(2")-Id primer sets separately.

Amplification was performed with PCR system (Eppendorf, Germany) and the cycling programs consisted of an initial denaturation (95[degrees]C, 5 min) followed by 32 cycles each of denaturation (95[degrees]C, 1min), annealing (58[degrees]C, 1min) and extension (72[degrees]C, 1 min), with a final extension of (72[degrees]C, 5 min). Each amplification product was resolved by electrophoresis with a 100-base pair molecular weight marker (Real Biotech Corporation, Taiwan) in a 1.2% agarose-Trisborate-EDTA gel stained with ethidium bromide (0.5 [micro]g/mL) and visualized under gel documentation system (BioRad, USA). Table 1 shows the product size of all the genes analyzed.

3. Results and Discussion

3.1. Identification of Enterococcus Species. Since early 1970s, Enterococcus species were considered as nosocomial pathogens. The incidences of high level GM/SM resistance have been disseminated in many enterococcal species. The predominant species observed in our study was E. faecalis 86/178 (48.3%) as observed in previous studies [6] in our region. Since then, the high level aminoglycoside resistance has become a serious problem in most of the health care settings; identification of clinical isolates of enterococci up to species level is essential for an appropriate management of the infection. Other than E. faecium which was 80/178 (44.9%), we have also obtained E. avium (2%), E. hirae (1.6%), E. durans (0.6%), E. gallinarum, and E. dispar (1%). The species distribution and specimen source of isolates were listed in Table 2.

3.2. High Level Aminoglycoside Resistance in Enterococcal Isolates. Aminoglycoside antibiotics are considered efficient in treating serious infections caused by both gram positive and gram negative organisms. Due to acquisition of extrinsic resistance to high level aminoglycoside antibiotics in enterococci, these strains gain importance in clinical settings. A total of 178 enterococcal isolates were screened by MIC method, 76/178 (42.7%) were HLGR (MIC [greater than or equal to] 512 [micro]g/mL) for gentamicin and 53/178 (29.8%) were HLSR (MIC [greater than or equal to] 2048 [micro]g/mL) for streptomycin (Table 3). Although the clinical use of streptomycin for enterococci has long been restricted due to intrinsic low level resistance (LLR), the present study revealed HLSR strains.

A total of 129/178 (72.47%) high level aminoglycoside resistant enterococci (HLGR and HLSR) were observed among our study isolates.

Recent studies also indicated HLGR to be more common in all species of enterococci than HLSR. Similarly, we had observed HLGR to be more predominant than HLSR in our study isolates. One E. avium, E. hirae, E. durans, and E. gallinarum isolates were exhibiting MIC of [greater than or equal to] 512 [micro]g/mL for gentamicin and [greater than or equal to] 2048 [micro]g/mL for streptomycin antibiotics. The reports on resistance carried by species other than E. faecalis and E. faecium were observed from late 1990s [8]. A surveillance study that analyzed 20 European countries had reported 32% and 22% HLGR and 41% and 49% HLSR among gentamicin resistant E. faecalis and E. faecium, respectively [9]. A very recent study conducted in Iran [10] had reported around 60.45% HLGR strains in their region. This is higher than our present report. They were suggesting cotransfer of these resistance genes along with VRE for the higher percentage of HLGR in their study. However, studies on AME gene profile were not done frequently in our region.

3.3. PCR Identification of HLAR Genes in Enterococci. All 178 enterococcal isolates were analyzed for the presence of aminoglycoside modifying enzyme coding genes (Figure 1).

High level gentamicin resistance is primarily due to the presence of bifunctional enzyme aac(6)-Ie-aph(2")-Ia which also confers high level resistance to amikacin, tobramycin, kanamycin, netilmicin, and dibekacin except streptomycin [11]. aph(2")-Ib was first detected from E. faecium and E. coli and confers high level resistance to gentamicin, tobramycin, amikacin, kanamycin, netilmicin, and dibekacin but not to amikacin. aph(2")-Ic confers HLR to gentamicin, tobramycin, and kanamycin while the strains carrying them can be treated with amikacin, netilmicin, and streptomycin in combination with cell wall inhibitors. Earlier this gene was shown to be present in E. gallinarum; but it had also been reported in isolates obtained from farm animals and in E. faecalis and E. faecium [12]. aph(2")-Id was reported in E. casseliflavus and has similar mechanism to that of aph(2")-Ib [13].

aac(6)-Ie-aph(2")-Ia gene was found in 38.2% of isolates in our study. But, out of 76 strains of HLGR identified by MIC method, only 52 strains (68.4%) carried aac(6')-Ie-aph(2")-Ia gene. However, 24/76 (31.57%) isolates that were high level gentamicin resistant and 12/53 (22.64%) isolates that were high level streptomycin resistant did not carry any of the genes tested. In a previous study [14], all the high level gentamicin resistant E. faecalis and E. faecium isolates were found to carry aac(6')-Ie-aph(2")-Ia gene.

Newer aminoglycoside resistance genes such as aph(2n)Ib, aph(2")-Ic, and aph(2")-Id also found to encode high level resistance to gentamicin (>500 [micro]g/mL) were not detected among our study isolates.

Another most important gene tested in our study aph(3)IIIa (GenBank Accession number: KF550184) was detected among 40.4% (72/178) isolates of enterococci. Out of 53 high level streptomycin resistant isolates, 41 (77.4%) carried aph(3)-IIIa gene.

20.2% (39/178) of strains carried both aac(6)-Ie-aph(2")-Ia and aph(3')-IIIa genes in our study. Out of 39 (21.9%) HLAR isolates which were resistant to both gentamicin (MIC > 512 [micro]g/mL) and streptomycin (MIC > 2048 [micro]g/mL) by MIC, 19 (48.7%) isolates carried both the genes, and the remaining (38.5%) isolates had one of the genes either aac(6')-Ieaph(2)-Ia or aph(3')-IIIa gene, while 12.8% isolates did not carry neither of the genes tested.

E.faecalis, the most predominant isolate of our study was found to carry aac(6)-Ie-aph(2n)-Ia gene in 34/86 (39.5%) isolates and aph(3')-IIIa gene in 34/86 (39.5%) isolates. 30/80 (37.5%) E. faecium isolates with an MIC range between 128 [micro]g/mL and 512 [micro]g/mL carried the bifunctional enzyme coding gene aac(6)-Ie-aph(2")-Ia.

Each of the HLAR E. avium, E. hirae, and E. durans had both the genes while another E. avium strain carried aph(3')-IIIa with streptomycin MIC of 1024 [micro]g/mL. One of the two E. gallinarum strains isolated was HLAR and it carried both aminoglycoside resistance genes aac(6)-Ie-aph(2")-Ia and aph(3')-IIIa, while the other strain carried aph(3')-IIIa gene alone but with an MIC of [greater than or equal to] 16 [micro]g/mL for gentamicin and >64 [micro]g/mL for streptomycin. One of the two E. dispar isolates in our study was found to be HLGR + HLSR and carried aph(3')-IIIa gene (see Table 4).

4. Conclusion

In our study, we had observed strains with phenotypic resistance towards high level gentamicin and streptomycin antibiotics without presence of respective AME gene. This may be due to the expression of genes other than genes analyzed in this study. The coexistence of aac(6')-Ie-aph(2")-Ia and aph(3')-IIIa was observed in 20.2% of the isolates.

Though an array of AMEs is responsible for HLAR status among enterococcal species, we have demonstrated aac(6)Ie-aph(2n)-Ia and aph(3)-IIIa genes more frequently occurring genes than other genes. This observation emphasizes the restricted gene distribution and transfer of resistant genes within a geographical region. Hence, surveillance studies should be conducted among Enterococcus isolates from different sources in any given geographical area to document the AME gene profile. Our study is the first to report resistance gene analysis among the Enterococcus species in India.

http://dx.doi.org/10.1155/2014/329157

Conflict of Interests

The authors declare that there is no conflict of interests regarding the publication of this paper.

References

[1] S. Shindae, G. V. Koppikar, and S. Oommen, "Characterization and antimicrobial susceptibility pattern of clinical isolates of enterococci at a tertiary care hospital in Mumbai, India," Annals of Tropical Medicine and Public Health, vol. 5, no. 2, pp. 85-88, 2012.

[2] N. Kobayashi, M. Mahbub Alam, Y. Nishimoto, S. Urasawa, N. Uehara, and N. Watanabe, "Distribution of aminoglycoside resistance genes in recent clinical isolates of Enterococcus faecalis, Enterococcus faecium and Enterococcus avium" Epidemiology and Infection, vol. 126, no. 2, pp. 197-204, 2001.

[3] W. Washington, S. Allen, W. Janda et al., Konemans Color Atlas and Textbook of Diagnostic Microbiology, 6th edition, 2006.

[4] S. Dutka-Malen, S. Evers, and P. Courvalin, "Detection of glycopeptide resistance genotypes and identification to the species level of clinically relevant enterococci by PCR," Journal of Clinical Microbiology, vol. 33, no. 1, pp. 24-27, 1995.

[5] S. B. Vakulenko, S. M. Donabedian, A. M. Voskresenskiy, M. J. Zervos, S. A. Lerner, and J. W. Chow, "Multiplex PCR for detection of aminoglycoside resistance genes in enterococci," Antimicrobial Agents and Chemotherapy, vol. 47, no. 4, pp. 1423-1426, 2003.

[6] S. Sreeja, P. R. Sreenivasa Babu, and A. G. Prathab, "The prevalence and the characterization of the Enterococcus species from various clinical samples in a tertiary care hospital," Journal of Clinical and Diagnostic Research, vol. 6, no. 9, pp. 1486-1488, 2012.

[7] Clinical Laboratory Standards Institute, "Performance standards for antimicrobial susceptibility testing, twenty-first informational supplement. M02-A10 and M07-A8," CLSI Document M100-S21, Clinical and Laboratory Standards Institute, Wayne, Pa, USA, 2011.

[8] D. F. Sahm, S. Boonlayangoor, and J. E. Schulz, "Detection of high-level aminoglycoside resistance in enterococci other than Enterococcus faecalis" Journal of Clinical Microbiology, vol. 29, no. 11, pp. 2595-2598, 1991.

[9] F.-J. Schmitz, J. Verhoef, and A. C. Fluit, "Prevalence of aminoglycoside resistance in 20 European university hospitals participating in the European SENTRY Antimicrobial Surveillance Programme" European Journal of Clinical Microbiology and Infectious Diseases, vol. 18, no. 6, pp. 414-421, 1999.

[10] A. Hasani, Y. Sharifi, R. Ghotaslon et al., "Molecular screening of virulence genes in high level gentamicin resistant Enterococcus faecalis and Enterococcus faecium isolated from clinical specimens in northwest Iran," Indian Journal of Medical Microbiology, vol. 30, no. 2, pp. 175-181, 2012.

[11] J. W. Chow, "Aminoglycoside resistance in enterococci," Clinical Infectious Diseases, vol. 31, no. 2, pp. 586-589, 2000.

[12] S. M. Donabedian, L. A. Thal, E. Hershberger et al., "Molecular characterization of gentamicin-resistant Enterococci in the United States: evidence of spread from animals to humans through food," Journal of Clinical Microbiology, vol. 41, no. 3, pp. 1109-1113, 2003.

[13] S. B. Vakulenko and S. Mobashery, "Versatility of aminoglycosides and prospects for their future," Clinical Microbiology Reviews, vol. 16, no. 3, pp. 430-450, 2003.

[14] R. Zarrilli, M.-F. Tripodi, A. Di Popolo et al., "Molecular epidemiology of high-level aminoglycoside-resistant enterococci isolated from patients in a university hospital in southern Italy," Journal of Antimicrobial Chemotherapy, vol. 56, no. 5, pp. 827835, 2005.

Elango Padmasini, (1) R. Padmaraj, (2) and S. Srivani Ramesh (1,3)

(1) Dr ALM Post Graduate Institute of Basic Medical Sciences, University of Madras, Chennai 600 008, India

(2) Department of Paediatric Nephrology, Institute of Child Health and Research Centre, Chennai 600 008, India

(3) Department of Microbiology, Dr ALM Post Graduate Institute of Basic Medical Sciences, University of Madras, Chennai 600113, India

Correspondence should be addressed to S. Srivani Ramesh; dr.srmicro@gmail.com

Received 27 August 2013; Accepted 26 November 2013; Published 4 February 2014

Academic Editors: J. P. Ackers and E. P. Sampaio

TABLE 1: Primers and their sequences for aminoglycoside resistance
encoding genes used in multiplex PCR.

Genes                      Primer sequences (5,-3;)

aac(6')-Ie-aph(2")-Ia      F: CAGGAATTTATCGAAAATGGTAGAAAAG
aph(2")-Ib                 F: CTTGGACGCTGAGATATATGAGCAC
aph(2")-Ic                 F: CCACAATGATAATGACTCAGTTCCC
aph(2")-Id                 F: GTGGTTTTTACAGGAATGCCATC
aph(3')-IIIa               F: GGCTAAAATGAGAATATCACCGG

Genes                      Primer sequences (5,-3;)

aac(6')-Ie-aph(2")-Ia      R: CACAATCGACTAAAGAGTACCAATC
aph(2")-Ib                 R: GTTTGTAGCAATTCAGAAACACCCTT
aph(2")-Ic                 R: CCACAGCTTCCGATAGCAAGAG
aph(2")-Id                 R: CCCTCTTCATACCAATCCATATAACC
aph(3')-IIIa               R: CTTTAAAAAATCATACAGCTCGCG

Genes                      Size of PCR product (bp)

aac(6')-Ie-aph(2")-Ia      369
aph(2")-Ib                 867
aph(2")-Ic                 444
aph(2")-Id                 641
aph(3')-IIIa               523

TABLE 2: Distribution of Enterococcus species from various clinical
specimens.

                     Distribution of Enterococcus spp. (n = 178)

Source of the        E. faecalis   E. faecium   E. durans   E. avium
isolates

Urine                    62            38          --          2
DFU ([dagger])            9            2            1          1
Blood                     7            35          --          --
Pus                       5            3           --          1
CSF                      --            1           --          --
Vaginal/semen swab        3            1           --          --
Total                    86            80           1          4

                     Distribution of Enterococcus spp. (n = 178)

Source of the        E. hirae   E. dispar   E. gallinarum   Total
isolates

Urine                   3           2            --          107
DFU ([dagger])          --         --            --          13
Blood                   --         --             2          44
Pus                     --         --            --           9
CSF                     --         --            --           1
Vaginal/semen swab      --         --            --           4
Total                   3           2             2          178

([dagger]) DFU: diabetic foot ulcer isolates.

TABLE 3: Results of minimum inhibitory concentration of entero-coccal
isolates to gentamicin and streptomycin (n = 178).

MIC ([micro]g/mL)   Gentamicin (n = 178)   Streptomycin (n = 178)

0.50                         0                       0
1                            0                       0
2                            1                       1
4                            6                       0
8                            8                       0
16                           44                      0
32                           15                      0
64                           5                       12
128                          19                      85
256                          4                       11
>512                         76                      2
1024                        NDf                      14
>2048                       NDf                      53

([dagger]) ND: not done; HLGR > 500 [micro]g/mL; HLSR > 2000 [micro]g/
mL [7].

TABLE 4: Results of high level aminoglycoside resistance and
distribution of aminoglycoside modifying enzyme encoding genes among
Enterococcus spp.

                      Distribution of high level aminoglycoside
HLARE                 resistance in Enterococcus spp. (n = 178)
(MIC and detection
of genes by PCR)      E. faecalis   E. faecium   E. durans   E. avium
                         (86)          (80)         (1)        (4)

HLGR *                    32            39           1          1
HLSR *                    21            27           1          1
aac(6)-Ie-aph             34            30           1          1
  (2")-Ia
aph(2")-Ib                --            --          --          --
aph(2")-Ic                --            --          --          --
aph(2")-Id                --            --          --          --
aph(3')-IIIa              34            30           1          2

                      Distribution of high level aminoglycoside
HLARE                 resistance in Enterococcus spp. (n = 178)
(MIC and detection
of genes by PCR)      E. hirae   E. dispar   E. gallinarum   Total
                        (3)         (2)           (2)

HLGR *                   1           1             1          76
HLSR *                   1           1             1          53
aac(6)-Ie-aph            1          --             1          68
  (2")-Ia
aph(2")-Ib               --         --            --          --
aph(2")-Ic               --         --            --          --
aph(2")-Id               --         --            --          --
aph(3')-IIIa             1           2             2          72

* HLGR; HLSR; MIC screening.
COPYRIGHT 2014 Hindawi Limited
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2014 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research Article
Author:Padmasini, Elango; Padmaraj, R.; Ramesh, S. Srivani
Publication:The Scientific World Journal
Article Type:Report
Geographic Code:9INDI
Date:Jan 1, 2014
Words:3020
Previous Article:Effect of peat on physicomechanical properties of cemented brick.
Next Article:A community detection algorithm based on topology potential and spectral clustering.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters