Printer Friendly

Heterozygous M3Mmalton [[alpha].sub.1]-antitrypsin deficiency associated with end-stage liver disease: case report and review.

[[alpha.sub.1]-Antitrypsin ([alpha]1AT) [6] deficiency, one of the most common hereditary disorders in Europe, is an autosomal recessive disorder characterized by reduced serum [alpha]1AT. Various homo- and heterozygous combinations of [alpha]1AT gene mutations are associated with a high risk for development of pulmonary emphysema or liver disease (1).

[alpha]1AT, also called al-proteinase inhibitor, is the major proteinase inhibitor in human plasma. It counteracts the effects of neutrophil elastase and other proteolytic enzymes and diffuses in most organs, where it protects extracellular structures from attacks by neutrophil elastase released by activated or disintegrating neutrophils (1). The lower respiratory tract is particularly vulnerable to [alpha]1AT deficiency.

The liver is the major site of [alpha]1AT gene expression, releasing 2 g of [alpha]1AT into the circulation daily. The [alpha]1AT protein is extremely pleomorphic, and >90 variants have now been identified (2). The most common allele is PiM, which is associated with serum [alpha]1AT concentrations within the reference interval. Other variants are associated with a reduction in serum [alpha]1AT concentrations and are so-called deficiency variants. The most common are PiS and PiZ, which are characterized by serum [alpha]1AT concentrations between 50-60% and 10-15% of normal, respectively, and for PiZ by early development of pulmonary emphysema. The S variant is considered not associated with clinical disease (3). Homozygous PiZZ is also associated with liver involvement and confers a risk for liver disease, but only a minority of people with this genotype develop cholestasis and/or cirrhosis (2, 4, 5). The PiZ allele is characterized by a single base substitution, which causes replacement of Glu-342 by Lys (6-8). Pathophysiology of liver injury could lead to impaired liver secretion and storage: accumulation of [alpha]1AT protein in the rough endoplasmic reticulum (RER) with formation of aggregates could hamper secretion and directly cause liver damage (9,10). However, other mutated alleles can also be responsible for proteinase inhibitor deficiencies, such as Mmalton, Mduarte, Mheerlen, and Mprocida, which are characterized by a low serum [alpha]1AT concentration (3-15% of normal) (11).

There is no specific treatment of [alpha]1AT deficiency-induced liver disease. Patients with [alpha]1AT deficiency who develop cirrhosis and liver failure, therefore, are candidates for liver transplantation, which treats the liver disease and corrects [alpha]1AT deficiency (12-14).

We investigated a patient with an end-stage liver disease treated by liver transplantation and who had a heterozygous M3Mmalton [alpha]1AT genotype related to a deficiency phenotype. Association of liver disease in subjects heterozygous for deficiency alleles has not been clearly established. The present study is the first to report a heterozygous Mmalton genotype associated with an [alpha]1AT deficiency leading to severe liver disease requiring liver transplantation.

Case Report

A 59-year-old housewife was admitted to hospital in March 1995 for evaluation of jaundice. In 1980, she had undergone a cholecystectomy for cholelithiasis and additional surgery. In 1981 and 1982, she had undergone treatments for eventration. At theses times, liver function was normal. She had no history of hepatitis or childhood liver disease. She had never received a blood transfusion, nor had she abused drugs or alcohol. In 1990, a checkup revealed abnormal liver functions tests [serum aspartate aminotransferase (ASAT), 45 U/L (reference interval, 0-30 U/L); [gamma]-glutamyltransferase, 60 U/L (reference interval, 5-25 U/L)], but her alkaline phosphatase activities were within the appropriate reference intervals and the physical examination was not remarkable.

At admission, physical examination revealed that she was jaundiced with labored breathing, a distended abdomen, cutaneous collateral circulation, a painless hepatosplenomegaly, and many spider angiomas. There was no digital clubbing or cyanosis, but dyspnea secondary to ascitis was present. Laboratory data revealed anemia (hemoglobin, 111 g/L), thrombocytopenia (50 000/[mm.sup.3]), leukopenia (3500/[mm.sup.3]), reduced prothrombin activity (35% of normal; reference interval, 60-120%), and reduced factor V (32%; reference interval, 60-120%). The results of the patient's liver function tests were as follows: ASAT, 75 U/L (reference interval, 0-30 U/L); [gamma]-glutamyltransferase, 60 U/L (reference interval, 5-25 U/L); total bilirubin, 84 [micro]mol/L (reference interval, 2-21 [micro]mol/L); serum albumin, 25 g/L (reference interval, 32-52 g/L); and serum cholesterol, 0.64 g/L (reference interval, 1.8-2.6 g/L) were abnormal, whereas her alkaline phosphatases were within the appropriate reference intervals. Serologic markers were negative for anti-nuclear antibodies (ABs), anti-smooth muscle ABs, anti-mitochondrial ABs, and anti-endoplasmic endothelial ABs. Hepatitis B and C virus serologies were also negative for hepatitis B surface antigen, hepatitis B core antigen ABs, and hepatitis C AB. Plasma ferritin and ceruloplasmin were within the appropriate reference intervals. Serum protein electrophoresis revealed a slight decrease of al-globulin (1.4 g/L; reference interval, 1.8-4.8 g/L). The chest x-ray and spirometry were unremarkable. According to Child-Pugh classification, the cirrhosis was C13. A diuretic treatment rapidly decreased ascites.

Six months later, the jaundice recurred with aggravation of liver failure (prothrombin activity; 23%;factor V, 19%). Transjugular liver biopsy revealed micronodular cirrhosis with periodic acid-Schiff (PAS)-positive acidophilic bodies in the cytoplasm of the hepatocytes. An investigation of the [alpha]1AT phenotype and genotype was then performed to search for a rare deficiency allele associated with the liver disease. Because of persistent liver cell failure and ascitis, the patient underwent orthotopic liver transplantation (OLT) in January 1996. Five years after transplantation, the patient was still alive and results of her liver function tests were within the appropriate reference intervals: ASAT, 13 U/L; alkaine aminotransferase, 16 U/L; total bilirubin, 12 [micro]mol/L; serum albumin, 42 g/L; and prothrombin activity, 96%.

An investigation of the patient's family was concomitantly undertaken; plasma samples were obtained from her husband and daughter (who were healthy) for [alpha]1AT phenotyping. Two of the patient's sisters had cryptogenetic cirrhosis; one of the two had decompensated liver cirrhosis but could not undergo liver transplantation because of her age (68 years). Samples could not be obtained from the patient's two other sisters and her three brothers.

Materials and Methods

ANALYTICAL METHODS

Serum [alpha]1AT was determined by an automated immunoturbidimetric method on a Cobas Fara II centrifugal analyzer (Roche), using specific commercially available antibodies (Dako). Sera were also analyzed for their elastase inhibitory activity against porcine pancreatic elastase as described previously (15). [alpha]1AT phenotypes were determined by isoelectric focusing (16) using Pharmalytes 4.2-4.9 (Pharmacia).

HISTOCHEMICAL AND IMMUNOHISTOCHEMICAL METHODS

Specimens obtained from transjugular liver biopsy (1-mm length) and from native liver were cut into 3- to 5-[micro]m-thick sections and stained with Hematoxylin-eosin, Masson trichrome, Oil red O, Prussian blue, and PAS after diastase digestion. An immunoperoxidase technique with specific anti-[alpha]1AT antibodies was also performed.

DNA ANALYSIS

Informed written consent was obtained from the patient. Genomic DNA was prepared from peripheral blood samples collected on EDTA according to standard protocols. Sequencing analysis was performed on PCR-amplified exons 1-5. The sequences of primers were obtained from previously published sequences (17,18) and deduced using the PCR PLAN program from PC GENE Software. The sequences and PCR conditions are given in Table 1. PCR products were purified on Wizard[TM] PCR prep columns (Promega) before sequencing. Both strands were sequenced using the dRhodamine cycle sequencing ready reaction (Perkin-Elmer) on an ABI Prism 377 XL automated DNA sequencer.

To confirm the nature of the deletion, the PCR products of exon 2.1 were cloned into pCR2.1 vector (Invitrogen). Wild-type and deleted clones were sequenced four times on both strands. The double-stranded plasmid inserts were sequenced manually using the dideoxynucleotide chain termination method (19) with [[sup.35]S]ATP[alpha]S (Amersham) and Sequenase 2.0 (US Biochemical Corp.), according to the protocol indicated by the manufacturer.

Results

FOLLOW-UP AND CURRENT STATUS

The patient did not experience any medical or surgical complications. During the follow-up after OLT, she never experienced acute rejection episodes. Five years after transplantation, she was still alive and the results of her liver functions tests were within the appropriate reference intervals: ASAT, 13 U/L; alanine aminotransferase, 16 U/L; total bilirubin, 12 [micro]mol/L; serum albumin, 42 g/L; and prothrombin activity, 96%. Itiitnunosuppressive therapy is maintained with cyclosporine (100 mg twice a day) and prednisone (7.5 mg once a day).

HISTOCHEMICAL AND IMMUNOHISTOCHEMICAL METHODS

Transjugular liver biopsy revealed micronodular cirrhosis without steatosis. Stained acidophilic bodies (size, 3-10 [micro]m) were observed in the cytoplasm of hepatocytes. These stained acidophilic bodies are highly predictive of [alpha]1AT deficiency (Figs. 1 and 2). They were intensively PAS positive and resistant to diastase digestion. The immunoperoxidase technique with specific anti-[alpha]1AT antibodies confirmed the presence of [alpha]1AT.

Histologic examination of native liver showed micro-and macronodular cirrhosis associated with steatosis and stained acidophilic bodies.

[FIGURE 1 OMITTED]

BIOCHEMICAL INVESTIGATIONS

Investigation of the [alpha]1AT system in the proband, performed three times before transplantation, revealed a substantial decrease in serum [alpha]1AT concentration associated with a low elastase inhibitory capacity (Table 2). The Pi phenotype, determined in our experimental conditions, revealed a PiM-like profile. In our system, Pi Mmalton cannot be clearly detected because it comigrates with the M2 allele (Table 2).

After transplantation, serum [alpha]1AT and elastase inhibitory capacity were within reference values (2.76 g/L and 24 690 units/L, respectively), and the phenotype was PiMM (Table 2). Serum [alpha]1AT, elastase inhibitory capacity, and phenotype were also evaluated in the husband and daughter (Table 3). For these subjects, the [alpha]1AT concentration and inhibitory capacity were both below the lower limit of the reference interval. The husband had an homozygous 55 phenotype, and the daughter had the heterozygous MS phenotype. No clinical disease was associated with these phenotypes.

[FIGURE 2 OMITTED]

IDENTIFICATION OF THE Mmalton MUTATION

Sequencing of exons 1a, 1b, 1c, and 2-5 and of all exon-intron junctions demonstrated two differences from the common [alpha]1AT gene. The first difference was a single point mutation (GAA[right arrow]GAC, [Glu.sup.376][right arrow]Asp) in exon 5 on the two alleles, indicating the presence of the M3 allele. The second was a triple nucleotide deletion in exon 2 of one allele.

The PCR fragments obtained from exon 2 were cloned, and five clones were sequenced. Three of the clones had the common sequence and two had the deletion. The triple nucleotide deletion could correspond to a complete codon for [Phe.sup.51] but also to the two last bases of the codon for PheSZ (TC) and to the first base of the codon for [Ser.sup.53] (T; Fig. 3). However, this causes an "in-phase" frameshift that codes for a protein deficient in a single Phe residue.

Discussion

[alpha]1AT deficiency is a common inborn metabolism error and occurs mainly in Caucasians of Northern Europe. Its incidence is 1:1600 to 1:2000 in Western countries (20, 21). Because various events can increase (inflammation) or decrease (liver failure) [alpha]1AT, quantification of serum [alpha]1AT may be deceptive and diagnosis of [alpha]1AT deficiency is based mostly on [alpha]1AT phenotype analysis.

The [alpha]1AT locus is pleomorphic, with ~90 alleles identified (2). These [alpha]1AT alleles are categorized as "normal" or "at risk". There are four common wild-type alleles: M1 ([Ala.sup.213]), M1 ([Val.sup.213]), M2, and M3. Among Caucasians of Northern Europe, M1 (Val.sup.213]) is the most common allele (1). The at-risk group includes "deficient" alleles, which when inherited in homozygous form are associated with serum [alpha]1AT <20 [micro]mol/L, and "null" alleles (no [alpha]1AT in serum attributable to that allele) (22). According to the literature, two at-risk alleles must be inherited to confer a real risk for clinically significant disease. These mutations are probably directly relevant to the pathogenesis of the liver disease. In addition to inflammation and liver cirrhosis, all cases of liver disease associated with [alpha]1AT deficiency are also characterized by an accumulation of [alpha]1AT in the hepatocytes.

[FIGURE 3 OMITTED]

Liver disease associated with [alpha]1AT deficiency, first described by Sharp et al. in 1969 (4), is discovered mainly in childhood, with jaundice as the first symptom a few weeks after birth (14). Ten percent of neonates with [alpha]1AT deficiency will develop cholestasis and hepatitis. This prolonged neonatal cholestasis often is associated to further spontaneous regression and is not considered an indicator of poor prognosis because subsequent evolution is variable, except for patients with paucity of intralobular bile ducts, which rapidly leads to liver cell failure (23). Whereas most of these children remain free of any symptoms, others progress toward cirrhosis (14). The second pattern of evolution includes portal hypertension with esophageal varices and gastrointestinal bleeding, which constitute criteria for an unfavorable prognosis requiring liver transplantation. In adults >40 years, hepatitis and cirrhosis can also rarely develop (5), with a minority of patients requiring OLT. These patients have a survival rate of 80-94% at 3 years, and transplantation is the best therapy (14, 24).

The pathogenesis of liver disease related to [alpha]1AT deficiency is poorly understood but is related to the fact that hepatocytes are the major site of [alpha]1AT synthesis and that certain mutations of the [alpha]1AT gene cause derangements in the intracellular processing of [alpha]1AT, culminating in hepatocyte injury (5). The pathophysiology of liver injury does not seem to be related to an uninhibited proteolytic attack because it is well established in lung injury. Most evidence favors the concept that the accumulation of [alpha]1AT in the endoplasmic reticulum is directly related to liver cell damage (11). This "accumulation theory' is directly supported by studies by Carlson et al. (25) and Dycaico et al. (26). The mechanisms responsible for intracellular accumulation of [alpha]1AT in association with Z and Mmalton alleles are not fully understood. It has been suggested that in the Pi Z phenotype, the [Glu.sup.342][right arrow]Lys mutation slows the rate of folding of the [alpha]1AT polypeptide and/or changes the tertiary structure of the [alpha]1AT molecule within the RER (27). Abnormal folding might expose a site molecule that is recognized by a protein in the RER. According to Birrer et al. (27), three mechanisms have been proposed: (a) this interaction may cause specific intracellular retention of the molecule; (b) improperly folded [alpha]1AT may alter the affinity of [alpha]1AT for a receptor that is involved in the translocation of [alpha]1AT from the RER to the Golgi apparatus, with consequent trapping and accumulation of [alpha]1AT in the RER; and (c) specific intracellular systems have been identified in the RER that degrade improperly folded proteins. One such system is the ubiquitin pathway, in which selectivity for degradation depends on the conjugation of the protein to ubiquitin. Ubiquitin is increased in monocytes and hepatocytes of PiZ homozygotes, suggesting that the accumulation of the Z form of [alpha]1AT in the hepatocytes may be the result of a relative increase in binding to heat-shock proteins combined with a malfunctioning degrading system (27).

Pi Mmalton was initially described in a family exhibiting Pi MmaltonZ and Pi MmaltonM phenotypes, but without liver or lung involvement (28). The Pi Mmalton allele has been also reported as Pi MmaltonZ in a few patients with severe emphysema and as Pi MmaltonM in patients with intrahepatocytic globules positive for PAS staining after diastase digestion (29). These diastase-resistant globules are always found in the livers of Pi Z, Mduarte, and Mmalton subjects. The distribution, number, and size vary greatly. Usually they are situated in the periportal hepatocytes, but in cirrhotic nodules, they are spread throughout (30). Globules may be difficult to find, especially in infancy. In liver biopsy specimens taken with Menghini or trocut, the globules can be almost undetectable, especially in children <12 weeks of age. In cirrhotic adults, globules can be irregularly distributed, and some parenchymal areas can have no globules at all (30). The effect of the Mmalton mutation on the plasma concentration is apparently attributable to a decrease in glycoprotein secretion and not to synthesis (11). Like Z [alpha]1AT, Mmalton [alpha]1AT has the wild-type promoter region and signal sequence, and is stable in vivo. The decreased serum concentration of Mmalton [alpha]1AT is therefore likely attributable to the self-aggregation phenomenon, which is observed in vitro (11). The Mmalton allele shows, like the Z allele, the association of liver disease with the same type of abnormalities of [alpha]1AT biosynthesis. Sequence analysis demonstrated that the Mmalton allele differs from the wild-type [alpha]1AT M2 allele by deletion of a triplet TCT that straddles two consecutive codons. The Mmalton and the M2 proteins are similar in charge; the isoelectric point of the Mmalton protein is slightly more cathodal that the M2 protein in isoelectric focusing gels (11). The mutation causes a deleted residue (Phe) in a hydrophobic region within the center of the molecule. The concentrations of [alpha]1AT mRNA transcripts in the liver biopsies were normal, but there was abnormal intracellular accumulation of newly synthesized [alpha]1AT in the RER with consequent reduced [alpha]1AT secretion. This abnormal accumulation of the newly synthesized Mmalton [alpha]1AT derives from perturbations of the molecular conformation, which impairs maturation from the RER to the Golgi (22).

In conclusion, this case provided information on the following: (a) the possibility of heterozygous [alpha]1AT deficiency associated with Mmalton phenotype; (b) end-stage liver disease without any pulmonary disease; and (c) late symptomatic liver disease, although [alpha]1AT deficiency is discovered mainly in childhood.

We thank Dr. M. Crepin ("Plateau Technique de Sequencage du CH et U de Lille") for excellent technical assistance and Prof. A. Cortot for reviewing the manuscript.

Received February 26, 2001; accepted April 26, 2001.

References

(1.) Crystal RG. [alpha]1AT deficiency, emphysema and liver disease. Genetic basis and strategies for therapy. J Clin Invest 1990;85: 1343-52.

(2.) Normann MR, Mowat AP, Hutchinson DC. Molecular basis, clinical consequences and diagnosis of [alpha]-1 antitrypsin deficiency. Ann Clin Biochem 1997;34:230-46.

(3.) Teckman JH, Qu D, Perlmutter DH. Molecular pathogenesis of liver disease in a1 antitrypsin deficiency. Hepatology 1996;24:1504-16.

(4.) Sharp HL, Bridges RA, Krivit W, Freier EF. Cirrhosis associated with a1-AT deficiency: a previously unrecognized inherited disorder. J Lab Clin Med 1969;73:934-9.

(5.) Eriksson S, Carlson J, Velez R. Risk of cirrhosis and primary liver cancer in a1-AT deficiency. N Engl J Med 1986;341:736-9.

(6.) Jeppsson J0. Amino acid substitution Glu-Lys in a1 antitrypsin PiZ. FEBS Lett 1976;65:247-9.

(7.) Yoshida A, Lieberman J, Gaidulis L, Ewing C. Molecular abnormality of human a1 antitrypsin variant (PiZ) associated with plasma activity efficiency. Proc Natl Acad Sci U S A 1976;73:1324-8.

(8.) Kidd VJ, Wallace RB, Itakura K, Woo SLC. [alpha]-1 Antitrypsin deficiency detection by analysis of mutation of the gene. Nature 1983;304:230-4.

(9.) Carrel RW. a1 Antitrypsin: molecular pathology, leukocyte and tissue damage. J Clin Invest 1986;77:1427-31.

(10.) Lomas DA, Evans DL, Finch JT, Carrel RW. The mechanism of Z a1 antitrypsin accumulation in the liver. Nature 1992;357:605-7.

(11.) Fraizer GC, Harrold TR, Hofker MH, Cox DW. In-frame single codon deletion in the Mmalton deficiency allele of a1-antitrypsin. Am J Hum Genet 1989;44:894-902.

(12.) Putnam CW, Porter KA, Peters RL, Aschcavai M, Redeker AG, Starzl TE. Liver replacement for a1-antitrypsin deficiency. Surgery 1977;81:258-61.

(13.) Hood JM, Koep U, Peters RL, Schroter GP, Weil R, Redeker AG, Starzl TE. Liver transplantation for advanced liver disease with a1-antitrypsin deficiency. N Engl J Med 1980;302:272-5.

(14.) Filipponi F, Soubrane 0, Labrousse F, Devictor D, Bernard 0, Valayer J, Houssin D. Liver transplantation for end-stage liver disease associated with a-l-antitrypsin deficiency in children: pretransplant natural history, timing and results of transplantation. J Hepatol 1994;20:72-8.

(15.) Huet G, Balduyck M, Watrigant Y, Sesboue R, Thiebaut C, Lafitte JJ, Degand P. Relationship between a mild a1 proteinase inhibitor deficiency and respiratory symptoms in a family. Ann Clin Biochem 1995;32:545-9.

(16.) Sesboue R, Vercaigne D, Charlionet C, Lefebvre F, Martin JP. Human a-1 antitrypsin genetic polymorphism: PI M subtypes. Hum Hered 1984;34:105-13.

(17.) Long GL, Chandra T, Woo SLC, Davie EW, Kurachi K. Complete sequence of the cDNA for human a1-antitrypsin and the gene for this S variant. Biochemistry 1984;23:4828-37.

(18.) Perlino E, Cortese R, Ciliberto G. The human [right arrow]1-antitrypsin gene is transcribed from two different promoters in macrophages and hepatocytes. EMBO J 1987;6:2767-71.

(19.) Sanger F, Nicklen S, Coulson AR. DNA sequencing with chainterminating inhibitors. Proc Natl Acad Sci U S A 1977;74:5463-7.

(20.) Sveger T. Liver disease in a1-antitrypsin deficiency detected by screening of 200,000 infants. N Engl J Med 1976;294:1316-21.

(21.) Perlmutter DH, Pierce JA. The a1-antitrypsin gene and emphysema. Am J Physiol 1989;258:L147-62.

(22.) Curiel DT, Holmes MD, Okayama H, Brantly ML, Vogelmeier C, Travis WD, et al. Molecular basis of the liver and lung disease associated with the a1-antitrypsin deficiency allele Mmalton. J Biol Chem 1989;264:13938-45.

(23.) Alagille D. a1-Antitrypsin deficiency. Hepatology 1984;4:11S-4S.

(24.) Houssin D, Soubrane 0, Boillot 0, Dousset B, Ozier Y, Devictor D, et al. Orthotopic liver transplantation with a reduced-size graft: an ideal compromise in pediatrics? Surgery 1992;111:532-42.

(25.) Carlson JA, Rogers BB, Sifers RN, Finegold MJ, Clift SM, De Mayo FM, et al. Accumulation of PiZ a1-antitrypsin causes liver damage in transgenic mice. J Clin Invest 1989;83:1183-90.

(26.) Dycaico JM, Grant SGN, Felts K, Nichols WS, Geller SA, Hager JH, et al. Neonatal hepatitis induced by a1-antitrypsin: a transgenic mouse model. Science 1988;242:1404-12.

(27.) Birrer P, McElvaney NG, Chang-Stroman LM, Crystal RG. a1Antitrypsin deficiency and liver disease. J Inherit Metab Dis 1991;14:512-25.

(28.) Cox DW. A new deficiency allele of AAT: Pi Mmalton. In: Peeters H, ed. Protides of the biological fluids, Vol. 23. Oxford: Pergamon, 1975:375-8.

(29.) Reid CL, Wiener GJ, Cox DW, Richter JE, Geisinger KR. Diffuse hepatocellular dysplasia and carcinoma associated with the Mmalton variant of a1-antitrypsin. Gastroenterology 1987;93: 181-7.

(30.) Massi G. Pathogenesis and pathology of liver disease associated with a1-antitrypsin deficiency. Chest 1996;110:251S-5S.

[6] Nonstandard abbreviafions: [alpha]1AT, al-antitrypsin; RER, rough endoplasmic reticulum; ASAT, aspartate aminotransferase; AB, anfibody; PAS, periodic acid-Schiff; and OLT, orthotopic liver transplantafion.

VALERIE CANVA, [1] * SANDRINE PIOTTE, [1] JEAN-PIERRE AUBERT, [2,3] NICOLE PORCHET, [2,3] MARTINE LECOMTE-HOUCKE, [4] GUILLEMETTE HUET, [2,3] TAHAR ZENJARI, [1] DIDIER ROUMILHAC, [5] FRANCOIS-RENE PRUVOT, [5] PIERRE DEGAND, [2,3] JEAN-CLAUDE PARIS, [1] and MALIKA BALDUYCK [2]

Departments of [1] Hepatology and Gastroenterology,

[2] Biochemistry, and

[4] Pathology, Hopital C. Huriez, CHRU-Lille, 59037 Lille Cedex, France.

[3] Unite INSERM 377, Place de Verdun, 59037 Lille Cedex, France.

[5] Department of Liver Transplantation, Hopital A. Calmette, CHRU-Lille, 59037 Lille Cedex, France.

* Address correspondence to this author at: Department of Hepatology and Gastroenterology, Hopital Huriez, CHRU, rue Michel Polonovski, 59037 Lille Cedex, France. E-mail vcanva@chru-lille.lr.
Table 1. Experimental PCR conditions used for amplification of
[[alpha].sub.1]AT exons 1-5.

Exon Primer sequence, 5' to 3' Length, bp Mg[Cl.sub.2],
 mmol/L

1as GGGCAGGAACTGGGCACTGT 258 0.8

1aas GAGCAGCAGCAGCAATGTTCC
1bs TCTAACCCACTCTGATCTCCC 255 0.8

1bas GTGTACAGCTTCCACTGCACTT
1cs GACCTTGGTTAATATTCACCAGC 150 0.8

1cas CCTCGCAGTGAAAGGCATACTT
2as CCCCCCATCTCTGTCTTGC 396 2

2aas GAGGAGTTCCTGGAAGCCTT
2bs ATGAAATCCTGGAGGGCCTG 376 1.5

2bas CAGGCTGGTTGAGCAACCTT
3s CCCACCTTCCCCTCTCTCC 314 1.5

3as CACCCTCAGGTTGGGGAATC
4s CTTGAATTTCTTTTCTGCACGAC 195 2

4as AAGGTCGTCAGGGTGATCTC
5s GTCTCTGCTTCTCTCCCCTC 296 1.2

5as AGGGACCAGCTCAACCCTTC

Exon Cycles (a)

1as 94[degrees]C for 2 min; 94[degrees]C for 1 min;
 66[degrees]C for 1.5 min; 72[degrees]C for 1
 min (35); 72[degrees]C for 7 min

1aas
1bs 94[degrees]C for 2 min; 94[degrees]C for 1 min;
 66[degrees]C for 1.5 min; 72[degrees]C for 1
 min (35); 72[degrees]C for 7 min

1bas
1cs 94[degrees]C for 2 min; 94[degrees]C for 1 min;
 66[degrees]C for 1.5 min; 72[degrees]C for 1
 min (35); 72[degrees]C for 7 min

1cas
2as 94[degrees]C for 2 min; 94[degrees]C for 1 min;
 62[degrees]C for 1.5 min; 72[degrees]C for 1
 min (35); 72[degrees]C for 7 min

2aas
2bs 94[degrees]C for 2 min; 94[degrees]C for 1 min;
 62[degrees]C for 1.5 min; 72[degrees]C for 1
 min (35); 72[degrees]C for 7 min

2bas
3s 94[degrees]C for 12 min; 94[degrees]C for 1 min;
 63[degrees]C for 1.5 min; 72[degrees]C for 1
 min (35); 72[degrees]C for 7 min

3as
4s 94[degrees]C for 2 min; 94[degrees]C for 1 min;
 63[degrees]C for 1.5 min; 72[degrees]C for 1
 min (35); 72[degrees]C for 7 min
4as
5s 94[degrees]C for 12 min; 94[degrees]C for 1 min;
 62[degrees]C for 1.5 min; 72[degrees]C for 1
 min (35); 72[degrees]C for 7 min

5as

(a) Number of cycles in parentheses.

Table 2. Serum [alpha]1AT concentration, elastase inhibitory capacity,
and [alpha]1AT phenotype before and after OLT.

 Elastase
 inhibitory
 [alpha]1AT capacity (17
 (1.90-3.50 g/L) 500-31 500 Phenotype
 (a) units/L) (a)

Before OLT
 Sept. 12, 1995 1.22 12 300 M-like profile
 Sept. 22, 1995 1.14 9718 M-like profile
 Oct. 10, 1995 1.40 11 976 M-like profile
After OLT
 April 30, 1996 2.76 24 691 MM

(a) Reference inte

Table 3. Serum [alpha]1AT concentrations, elastase inhibitory
capacity, and phenotypes of the proband's daughter and husband.

 Elastase inhibitory
 [alpha]1AT capacity (17 500-31
 (1.90-3.50 g/L) (a) 500 units/L) (a) Phenotype

Daughter 1.85 15 350 MS
Husband 1.56 15 107 SS

(a) Reference interval
COPYRIGHT 2001 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2001 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Case Report
Author:Canva, Valerie; Piotte, Sandrine; Aubert, Jean-Pierre; Porchet, Nicole; Lecomte-Houcke, Martine; Hue
Publication:Clinical Chemistry
Date:Aug 1, 2001
Words:4328
Previous Article:Extracellular tyrosinase mRNA within apoptotic bodies is protected from degradation in human serum.
Next Article:Standardization of bone marker nomenclature.
Topics:


Related Articles
Type IV glycogen storage disease. (Images in Pathology).
Environmental, occupational, and genetic risk factors for [alpha]-1 Antitrypsin deficiency.
Alpha-1 antitrypsin deficiency is not a rare disease but a disease that is rarely diagnosed.
Inherited chronic obstructive pulmonary disease: new selective-sequencing workup for [[alpha].sub.1]-antitrypsin deficiency identifies 2 previously...
Cirrhosis originally diagnosed as nonalcoholic steatohepatitis.
Liver dysfunction and steatosis in familial hypobetalipoproteinemia.
ELISA for specific detection of PiZ-related [[alpha].sub.1]-antitrypsin deficiency.
Diagnosis and monitoring of hepatic injury. II. Recommendations for use of laboratory tests in screening, diagnosis, and monitoring.
Molecular biological methods in diagnosis and treatment of liver diseases.

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters