Printer Friendly

Helicobacter pylori Pathogenicity Factors Related to Gastric Cancer.

1. Introduction

Gastric cancer remains a prevalent disease worldwide with a poor prognosis. Helicobacter pylori plays a major role in gastric carcinogenesis. H. pylori colonization leads to chronic gastritis, which predisposes to atrophic gastritis, intestinal metaplasia, dysplasia, and eventually gastric cancer. Screening, treatment, and prevention of H. pylori colonization can reduce the incidence of gastric cancer [1]. Other interventions that may yield a similar effect, although of smaller magnitude, include promotion of a healthy lifestyle including dietary measures, nonsmoking, low alcohol intake, and sufficient physical activity [2]. Furthermore, increasing evidence suggests that host factors, including genetic makeup, are also important determinants for carcinogenesis in H. pylori infection [3]. Colonization of H. pylori has been associated with chronic gastritis because it can trigger fulminant inflammatory response which can lead to pathological conditions such as gastric carcinoma and peptic ulcer disease [4]. Consequently a clinical need exists to stratify H. pylori-infected patients with respect to their propensity to develop H. pylori-related pathology; especially for GC this is felt as a pressing concern. The importance of H. pylori virulence factors is evident from the serious clinical outcome associated with bacteria positive for the vacillating cytotoxic (vacA) and the cytotoxin-associated gene A (cagA) antigen [5]. However, these two virulence factors are insufficient to explain the variety in clinical presentation of pathology associates with H. pylori infection [6,7]. A potential H. pylori virulence factor possibly important to explain this variance in clinical outcome is the cag pathogenicity island(cag-PAI). The cagA gene is a marker for the presence of the cag-PAI of approximately 40 kb, whose presence is associated with the more severe clinical outcomes [8, 9]. A type IV secretion system translocates cagA protein into gastric epithelial cells, where it is phosphorylated. When this modification occurs, cagA affects various cellular processes and signal transduction pathways, such as disruption of tight and adherent junctions that lead to proinflammatory and mitogenic responses: effects [8,10]. One of the six cag-PAI genes is cagE, located in the right half of the cag-PAI, that has been shown to induce secretion of interleukin- (IL-) 8, from infected host epithelial cells [11,12].

Another putative virulence factor is ice A, whose gene has two main allelic variants, iceAl and iceA2. The expression of iceA1 is upregulated on contact of H. pylori with human epithelial cells and may be linked with peptic ulcer disease [16,17]. The blood group antigen binding adhesin (babA), a 78 KDa outer membrane protein encoded by the babA2 gene, binds to Lewis b antigens and ABO antigen [18,19]. Although three bab alleles have been identified (babAl, babA2, and babB), only the babA2 gene product is functionally active [20]. Studies in Western populations have associated the presence of the bab A2 gene with gastric cancer [19,21]. The aim of this study is to assess the genotype of H. pylori strains infecting patients with chronic gastritis through the evaluation of the prevalence of several genes coding for virulence factors.

2. Materials and Methods

This research was approved by the regional Medical Research Ethics Committee of Azad University of Medical Science on 19 Jul 2016 (number 1311/28772) and all patients provided written informed consent for this research.

This study protocol conforms to the ethical guidelines of the 1975 Declaration of Helsinki as reflected in a prior approval by the institution's human research committee.

2.1. Patients, Bacterial Strains, and Cultivation. Our cohort consisted of 109 clinical isolates of H. pylori; 49 (45%) were from females and 60 from males (55%).

From male patients (sex ratio F/M: 0.82), the average age of the patients from which the isolates were obtained was 39[+ or -] 17 years. H. pylori was isolated employing gastric biopsies of patients presenting with gastritis, peptic ulcer, or gastric cancer. Patients were not exposed to antimicrobial agents at least one week before endoscopy was performed. Following collection, gastric biopsy samples were homogenized and cultured onto Brucella agar supplanted with 5% sheep blood and antibiotics (vancomycin, amphotericin B, and trimethoprim). Culture plates were incubated at microaerophilic condition, 37[degrees]C and high humidity for 5-7 days. Organisms were identified as H. pylori based on colony morphology, gram staining, and positive oxidase, catalase, and urease tests.

2.2. DNA Extraction from Culture. Genomic DNA of total H. pylori isolates was extracted using the QiAamp DNA mini kit (QIAGEN, Hilden, Germany) according to manufacturer's protocol and stored at -20[degrees]C until use.

2.3. Detection of Genes. In this study, PCR was used to detect the H. pylori specific ureC gene for confirming that the cultures represented a bona-fide H. pylori isolate, and the same technique was employed to establish presence or absence of cagE, cagA, iceAl, iceA2 babA2, and babB genes.

All primer sets were selected from published literature (listed in Table 1). PCR reactions were performed in a volume of 50 [micro]L containing 10 mmol/L Tris-HCl, 1.5 mmol/L MgCl2,0.2 mmol/L of each deoxynucleotide, 25 pmol of each primer, and 2.5 units of Taq polymerase (Geneone, Germany) [22, 23]. The thermal cycler program used consisted of the following steps: initial denaturation at 94[degrees]C for 3 min followed by 35 cycles of 30 seconds at 94[degrees]C (denaturation); 30 seconds at 58[degrees]C for cagA and glmM [24]; 30 seconds at 53[degrees]C for cagE; 48[degrees]C for babA2; 49[degrees]C for babB; 57[degrees]C for iceAl; and 48[degrees]C and for iceA2 all annealing steps, followed by 30 seconds at 72[degrees]C (extension step); and a final extension step was 3 min at 72[degrees]C [25].

2.4. Statistics Analysis. Data were analyzed by SPSS version 16. Fisher's exact test or the Chi-square test was used for analysis of categorical data. A P value of <0.05 was considered statistically significant.

3. Results

3.1. Description of the Patient Cohort and Isolation of Study Samples. A total of 109 H. pylori samples were isolated from an initial number of 359 biopsies included in this study (yielding an apparent infection rate of 30.4%), of which 60 (55%) were derived from male patients and 49 (45%) isolates came from female patients (sex ratio F/M: 0.82). The average patients' age at the time of endoscopy was 39 [+ or -] 17 years. From the 109 patients with established H. pylori infection, 81 patients had presented with a nonulcer dyspepsia, nineteen patients with a peptic ulcer dyspepsia, and nine patients with GC (Signet Ring Cell Carcinoma (SRCC)). There was no significant difference between the mean age and sex of patients with and without ulcers and cancer. We concluded that our cohort would enable analysis of the link between H. pylori virulence factors and clinical presentation.

3.2. The Presence of Virulence Factors Is Common in the Clinical Cohort. The PCR-based amplification showed that the cagE, babA2, and babB positive strains had a prevalence of, respectively, 55.9%, 71.7%, and 61.3% in our cohort, whereas cagA, iceAl, and iceA2 were detected in, respectively, 70.6%, 42.2%, and 13.2% of the patients included in this study (Table 2). Thus, the virulence factors selected for this study are commonly detected in our patient cohort and allow statistical analysis as to their relation to disease manifestation.

3.3. Specific H. pylori Virulence Factors Show Trends of Being Positively or Negatively Associated with Patient's Clinical Presentation. In our study the frequency of cagE-positive isolates obtained from patients with nonulcer dyspepsia, peptic ulcer dyspepsia, or GC patients was 49.4%, 68.4%, and 88.9%, respectively, but this apparent positive association with more severe disease did not reach statistical significance (P = 0.198). The babA2 genotype was detected in 74%, 84.2%, and 0% of isolates from NUD, PUD, and GC patients. The percentage of babA[2.sup.-] genotype within GC patients was significantly higher than that of cag[A.sup.+] genotype (P < 0.001). Also the percentage of bab[B.sup.+] was 65.4% and 63.1% for NUD and PUD cases, respectively, but for isolates from patients with GC (0%), this apparent negative association was statistically significant (P = 0.005). Conversely the prevalence of the iceA2 allele was observed in NUD patients (13.6%) and in PUD (15.8%) and in GC patients (0%), but no significant association was observed between iceA2 genotype and GC (P = 0.779). Similarly, in this study the distribution of iceAl and clinical outcome was analyzed statistically and it was observed that the frequency of iceAl-positive isolates in NUD, PUD, and GC patients was 35.8%, 42.1%, and 100%, respectively. The relation of the presence of iceAl and the development of cases to gastric cancer was statistically significant (P = 0.008).

Although the cagA allele was observed in NUD (65.4%) cases and in PUD patients (78.9%) and in GC patients (100%), there was not statistically significant association between cagA and the gastric outcomes (P = 0.134). A full overview of all virulence factors studied and their linkage to specific clinical manifestations is provided through Table 2.

It is apparent from our data that cagE, cagA, and iceAl are more common in patients with gastric cancer than in the other patient groups, whereas babA2 and babB alleles were absent in patients with GC.

3.4. Combining Different Virulence Factors Allows Stratification of the Patient Cohort with respect to Patient Stratification. We examined eight different combinations based on analysis of babA2, babB, and iceAl genotypes (positive and negative) in patients as a single genotype (Table 3). We were able to identify an association between these genotypes and clinical outcome. The frequency distributions of the combination genotypes of H. pylori showed the relation of babA2 and babB negative and iceAl positive genotype and the development of cases to gastric cancer was statistically significant (P < 0.001) among the patient groups. But there was not statistically significant association between other genotype combinations and the gastric cancer (P [greater than or equal to] 0.113).

The apparent absence of babA2 and babB alleles in GC patients raises, however, hopes that larger studies may establish the usefulness of these alleles in guiding patient management.

4. Discussion

Various studies have observed substantial differences in incidence and/or severity of gastroduodenal pathologies related to H. pylori which may vary according to geographical regions [26]. Although many factors may contribute to these differences, an obvious contributing factor is the different distribution of pathogenic markers in circulating strains [27]. The clinical relevance of the putative virulence-associated genes of H. pylori and geographical region remains controversial. Other factors that influence the risks for atrophy and cancer in the presence of infection may be related to the time when infection occurred, to other environmental factors, and to the host genetic variation [28]. In particular single nucleotide polymorphisms in genes that influence bacterial handling via pattern recognition receptors appear to be involved, further strengthening the link between host risk factors, H. pylori incidence, and cancer [29]. In the present study we exploited this situation to study the relationship between selected virulence genes of H. pylori and the clinical status. Our results clearly support the notion that further studies aimed at establishing the negative predictive value of the presence of babA2 and babB alleles for GC development are warranted.

The cagE is a pathogenicity biomarker of H. pylori. A survey of previous studies suggested that the cagE prevalence is different around the world [30]. The general importance of cagE is best illustrated by its high frequency in GC patients as demonstrated by studies performed in patient populations derived from India (100%), Turkey (81.8%), and Thailand (93.8%) [31]. However, the prevalence of cagE gene in this study was only 55.9%, markedly different from the results obtained in the aforementioned countries [32]. In the present study cagE-positive isolates were slightly more detected in isolates from peptic ulcer dyspepsia (PUD) patients (68.4%), but the potential significance of this finding, if any, remains to be established. The prevalence of cagA gene in our cohort is 70.6%, which resembles the situation in Western countries (Yamaoka et al., 2002), but is markedly lower than that observed in East Asian countries where cagA is present in more than 90% of cases [32]. Like cagE, cagA-positive isolates were enriched in samples obtained from peptic ulcer dyspepsia patients, albeit not in a statistically significant manner. Nevertheless, our findings support previous studies [32] (Wu et al., 2003) and should prove interesting in including our data in a meta-analysis of virulence genes in this respect. Our results show that the prevalence of iceAl and iceA2 genes in isolates was 42.2% and 13.2%, respectively. These results are in agreement with previous studies showing that the iceAl gene is prevalent in Japanese, Korean, and Dutch patients [13] (Ito et al., 2000; Shiota et al., 2013); conversely the iceA2 allele was predominant in the United States and Colombia. In our cohort, the relation of the presence of iceAl and the development of cases to gastric cancer was statistically significant (P = 0.008). But our data showed that there was no significant association between iceA2 and GC compared with PUD or NUD. However, several studies have reported different results, as the iceA2 gene was detected to be predominant genotype in these studies (Aghdam et al., 2014; Biernat et al., 2014).

The babA is one of the mediators for the attachment to gastric cells by H. pylori [33]. More recent analysis of babA2 as a virulence marker has produced conflicting data on the usefulness of babA2 expression in predicting clinical outcome, which is most likely dependent on the geographic origin of the H. pylori strains. Survey of previous studies on Portuguese, Thai, and India populations showed that babA2 is not a marker for peptic ulcer disease or gastric cancer [12, 26, 34]. However, several studies have reported different results for strains isolated from Turkey or Germany [26, 35]. Our study suggests that babA2, "although quite prevalent," is associated with reduced propensity to develop GC and is thus associated with less oncogenic H. pylori. Similar results were obtained concerning babB.

Our results showed the relation of babA2 and babB negative and iceAl positive genotype and the development of cases to gastric cancer was statistically significant. Further studies are required to determine the functions of babA2 and babB and their relationship with disease outcome and whether the presence of these alleles indicates the presence of bacteria unlikely to confer progression towards GC.

Disclosure

This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.

https://doi.org/10.1155/2017/7942489

Conflicts of Interest

The authors certify that they report no conflicts of interest.

Acknowledgments

The authors would like to acknowledge Marand Branch, Islamic Azad University, and Erasmus MC Cancer Institute, Erasmus University Rotterdam, Netherlands, for their support of this research.

References

[1] J. Ferlay, H. R. Shin, F. Bray, D. Forman, C. Mathers, and D. M. Parkin, "Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008," International Journal of Cancer, vol. 127, no. 12, pp. 2893-2917, 2010.

[2] C. M. den Hoed and E. J. Kuipers, "Gastric Cancer: How Can We Reduce the Incidence of this Disease?" Current Fungal Infection Reports, vol. 18, no. 7, p. 34, 2016.

[3] H. M. Malaty, L. Engstrand, N. L. Pedersen, and D. Y. Graham, "Helicobacter pylori infection: genetic and environmental influences. A study of twins," Annals of Internal Medicine, vol. 120, no. 12, pp. 982-986,1994.

[4] M. A. Chiurillo, Y. Moran, M. Canas et al., "Genotyping of Helicobacter pylori virulence-associated genes shows high diversity of strains infecting patients in western venezuela," International Journal of Infectious Diseases, vol. 17, no. 9, pp. e750-e756, 2013.

[5] S. Sahara, M. Sugimoto, R.-K. Vilaichone et al., "Role of Helicobacter pylori cagA EPIYA motif and vacA genotypes for the development of gastrointestinal diseases in Southeast Asian countries: A meta-analysis," BMC Infectious Diseases, vol. 12, article no. 223, 2012.

[6] J. L. Proenca-Modena, G. O. Acrani, and M. Brocchi, "Helicobacter pylori: Phenotypes, genotypes and virulence genes," Future Microbiology, vol 4, no. 2, pp. 223-240, 2009.

[7] V. P. Lima, M. A. P. D. Lima, M. V. P. Ferreira, M. A. P. Barros, and S. H. B. Rabenhorst, "The relationship between Helicobacter pylori genes cagE and virB11 and gastric cancer," International Journal of Infectious Diseases, vol. 14, no. 7, pp. e613-e617, 2010.

[8] M. J. Blaser, G. I. Perez-Perez, H. Kleanthous et al., "Infection with Helicobacter pylori strains possessing cagA is associated with an increased risk of developing adenocarcinoma of the stomach," Cancer Research, vol. 55, no. 10, pp. 2111-2115,1995.

[9] J. C. Atherton, "CagA: A role at last," Gut, vol. 47, no. 3, pp. 330-331, 2000.

[10] S. Wen and S. F. Moss, "Helicobacter pylori virulence factors in gastric carcinogenesis," Cancer Letters, vol. 282, no. 1, pp. 1-8, 2009.

[11] M. Sozzi, M. L. Tomasini, C. Vindigni et al., "Heterogeneity of cag genotypes and clinical outcome of Helicobacter pylori infection," Journal of Laboratory and Clinical Medicine, vol. 146, no. 5, pp. 262-270, 2005.

[12] C. Chomvarin, W. Namwat, K. Chaicumpar et al., "Prevalence of Helicobacter pylori vacA, cagA, cagE, iceA and babA2 genotypes in Thai dyspeptic patients," International Journal of Infectious Diseases, vol. 12, no. 1, pp. 30-36, 2008.

[13] J. S. Ko, K. M. Kim, Y. L. Oh, and J. K. Seo, "cagA, vacA, and iceA genotypes of Helicobacter pylori in Korean children," Pediatrics International, vol. 50, no. 5, pp. 628-631, 2008.

[14] A. Bockstrom, C. Lundberg, D. Kersulyte, D. E. Berg, T. Boren, and A. Arnqvist, "Metastability of Helicobacter pylori bab adhesin genes and dynamics in Lewis b antigen binding," Proceedings of the National Acadamy of Sciences of the United States of America, vol. 101, no. 48, pp. 16923-16928, 2004.

[15] L.-J. Van Doorn, C. Figueiredo, R. Sanna et al., "Clinical relevance of the cagA, vacA, and iceA status of Helicobacter pylori" Gastroenterology, vol. 115, no. 1, pp. 58-66,1998.

[16] R. M. Peek Jr., S. A. Thompson, J. P. Donahue, K. T. Tham, J. C. Atherton, M. J. Blaser et al., "Adherence to gastric epithelial cells induces expression of a Helicobacter pylori gene, iceA that is associated with clinical outcome," Proc Assoc Am Physicians, vol. 110, no. 6, pp. 531-544, 1998.

[17] S. Shiota, M. Watada, O. Matsunari, S. Iwatani, R. Suzuki, and Y. Yamaoka, "Helicobacter pylori iceA, clinical outcomes, and correlation with cagA: A meta-analysis," PLoS ONE, vol. 7, no. 1, Article ID e30354, 2012.

[18] T. Boren, P. Falk, K. A. Roth, G. Larson, and S. Normark, "Attachment of Helicobacter pylori to human gastric epithelium mediated by blood group antigens," Science, vol. 262, no. 5141, pp. 1892-1895,1993.

[19] M. Gerhard, N. Lehn, N. Neumayer et al., "Clinical relevance of the Helicobacter pylori gene for blood-group antigen-binding adhesin," Proceedings of the National Acadamy of Sciences of the United States of America, vol. 96, no. 22, pp. 12778-12783,1999.

[20] D. T. Pride, R. J. Meinersmann, and M. J. Blaser, "Allelic variation within Helicobacter pylori babA and babB " Infection & Immunity, vol. 69, no. 2, pp. 1160-1171, 2001.

[21] L. E. Torres, K. Melien, A. Moreno et al., "Prevalence of vacA, cagA and babA2 genes in Cuban Helicobacter pylori isolates," World Journal of Gastroenterology, vol. 15, no. 2, pp. 204-210, 2009.

[22] K. Dadashzadeh, M. Milani, and M. H. Somi, "The prevalence of Helicobacter pylori cagA and iceA genotypes and possible clinical outcomes," Acta Medica Mediterranea, vol. 31, p. 1345, 2015.

[23] K. Dadashzadeh, "Relevance of Helicobacter pylori dupA and OipA genotypes and development of gastric disease," Journal of Biomedical Research, pp. 28-19, 2017.

[24] K. Dadashzadeh, M. Milani, M. Rahmati, and A. Akbarzadeh, "Real-time PCR detection of 16S rRNA novel mutations associated with Helicobacter pylori Tetracycline resistance in Iran," Asian Pacific Journal of Cancer Prevention, vol. 15, no. 20, pp. 8883-8886, 2014.

[25] Y. Yamaoka, T. Kodama, O. Gutierrez, J. G. Kim, K. Kashima, and D. Y. Graham, "Relationship between Helicobacter pylori iceA, cagA, and vacA status and clinical outcome: studies in four different countries," Journal of Clinical Microbiology, vol. 37, no. 7, pp. 2274-2279, 1999.

[26] P. Ghosh, A. Sarkar, M. Ganguly et al., "Helicobacter pylori strains harboring babA2 from Indian sub population are associated with increased virulence in ex vivo study," Gut Pathogens, vol. 8, no. 1, article no. 1, 2016.

[27] L. E. Torres, K. Melian, A. Moreno et al., "Prevalence of vacA, cagA and babA2 genes in Cuban Helicobacter pylori isolates," World Journal of Gastroenterology, vol. 15, no. 2, pp. 204-210, 2009.

[28] E. J. Kuipers, "Review article: Exploring the link between Helicobacter pylori and gastric cancer," Alimentary Pharmacology and Therapeutics, Supplement, vol. 13, no. s1, pp. 3-11,1999.

[29] J. Mayerle, C. M. den Hoed, C. Schurmann et al., "Identification of genetic loci associated with Helicobacter pylori serologic status," Journal of the American Medical Association, vol. 309, no. 18, pp. 1912-1920, 2013.

[30] A. S. Day, N. L. Jones, J. T. Lynett et al., "cagE is a virulence factor associated with Helicobacter pylori-induced duodenal ulceration in children," The Journal of Infectious Diseases, vol. 181, no. 4, pp. 1370-1375, 2000.

[31] V. P. Lima, I. J. D. L. Silva-Fernandes, M. K. S. Alves, and S. H. B. Rabenhorst, "Prevalence of Helicobacter pylori genotypes (vacA, cagA, cagE and virB11) in gastric cancer in Brazilian's patients: An association with histopathological parameters," Cancer Epidemiology, vol. 35, no. 5, pp. e32-e37, 2011.

[32] T. Uchida, L. T. Nguyen, A. Takayama et al., "Analysis of virulence factors of Helicobacter pylori isolated from a Vietnamese population," BMC Microbiology, vol. 9, article no. 175, 2009.

[33] J. Yu, W. K. Leung, M. Y. Y. Go et al., "Relationship between Helicobacter pylori babA2 status with gastric epithelial cell turnover and premalignant gastric lesions," Gut, vol. 51, no. 4, pp. 480-484, 2002.

[34] L. L. Gatti, J. L. P. Modena, S. L. M. Payao et al., "Prevalence of Helicobacter pylori cagA, iceA and babA2 alleles in Brazilian patients with upper gastrointestinal diseases," Acta Tropica, vol. 100, no. 3, pp. 232-240, 2006.

[35] Y. Erzin, V. Koksal, S. Altun et al., "Role of host interleukin 1[beta] gene (IL-1B) and interleukin 1 receptor antagonist gene (IL-1RN) polymorphisms in clinical outcomes in Helicobacter pylori-positive Turkish patients with dyspepsia," Journal of Gastroenterology, vol. 43, no. 9, pp. 705-710, 2008.

Kianoosh Dadashzadeh, (1) Maikel P. Peppelenbosch, (2) and Akyala Ishaku Adamu (2)

(1) Department of Medical Laboratory Sciences, Marand Branch, Islamic Azad University, Marand, Iran

(2) Erasmus MC Cancer Institute, Erasmus University Rotterdam, Rotterdam, Netherlands

Correspondence should be addressed to Kianoosh Dadashzadeh; drkianoosh@gmail.com

Received 24 July 2017; Revised 23 November 2017; Accepted 29 November 2017; Published 17 December 2017

Academic Editor: Yousuke Nakai
TABLE 1: Primer sequences for polymerase chain reaction.

Gene            Primer         Nucleotide sequence

ureC (glmM)      Hp-F      GGATAAGCTTTTAGGGGTGTTAGGGG
                 HP-R       GCTTACTTTCTAACACTAACGCGC

cag E           cag E-F    TTGAAAACTTCAAGGATAGGATAGAGC
                cagE-R      GCCTAGCGTAATATCACCATTACCC

bab A2         bab A2-F       CCAAACGAAACAAAAAGCGT
               bab A2-R       GCTTGTGTAAAAGCCGTCGT

babB            babB -F        ATGAAAAAAACCCTTTTAC
                babB-R         CGAATTGCAAGTGATGGT

cagA            cagA-F       AGGGATAACAGGCAAGCTTTTGA
                cagA-R       CTGCAAAAGATTGTTTGGCAGA

iceAl           iceAl-F       GTGTTTTTAACCAAAGTATC
                iceAl-R       CTATAGCCASTYTCTTTGCA

iceA2           iceA2-F       GTTGGGTATATCACAATTTAT
                iceA2-R       TTRCCCTATTTTCTAGTAGGT

Gene           Size (bp)   Reference

ureC (glmM)       294        [13]

cag E             508        [12]

bab A2            971         [6]

babB              496        [14]

cagA              352        [15]

iceAl             247        [13]

iceA2             229        [13]

TABLE 2: Relationship between clinical outcome and status of cagE,
babA2, babB, iceAl, iceA2, and CagA.

                    Number (%) of isolates

Genotypes   NUD (n = 81)   PUD (n = 19)   GC (n = 9)

cagE         40 (49.4%)     13 (68.4%)    8 (88.9%)
babA2         60 (74%)      16 (84.2%)        0
babB         53 (65.4%)     12 (63.1%)        0
iceAl        29 (35.8%)     8 (42.1%)      9 (100%)
iceA2        11 (13.6%)     3 (15.8%)         0
cagA         53 (65.4%)     15 (78.9%)     9 (100%)

Genotypes   Total (n = 109)   P value

cagE          61 (55.9%)       0.198
babA2         76 (71.7%)       0.001
babB          65 (61.3%)       0.005
iceAl         46 (42.2%)       0.008
iceA2         14 (13.2%)       0.779
cagA          77 (70.6%)       0.134

TABLE 3: Combination of babA2, babB, and iceAl genotypes and
clinical outcome.

babA2        babB      iceAl     GC (n = 9)   NUD (n = 81)

Positive   Positive   Positive       0             19
Positive   Positive   Negative       0             15
Positive   Negative   Positive       0             12
Positive   Negative   Negative       0             9
Negative   Positive   Positive       3             7
Negative   Positive   Negative       0             11
Negative   Negative   Positive       6             3
Negative   Negative   Negative       0             5

babA2      PUD (n = 19)   Total (n = 109)   P value

Positive        6               25           0.113
Positive        3               18           0.121
Positive        2               14           0.136
Positive        4               13           0.196
Negative        1               11           0.216
Negative        2               13           0.157
Negative        1               10           0.001
Negative        0                5           0.253
COPYRIGHT 2018 Hindawi Limited
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2018 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research Article
Author:Dadashzadeh, Kianoosh; Peppelenbosch, Maikel P.; Adamu, Akyala Ishaku
Publication:Canadian Journal of Gastroenterology and Hepatology
Date:Jan 1, 2018
Words:4103
Previous Article:The Effect of Anesthesia on the Immune System in Colorectal Cancer Patients.
Next Article:Urinary Elimination of Bile Acid Glucuronides under Severe Cholestatic Situations: Contribution of Hepatic and Renal Glucuronidation Reactions.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters