Printer Friendly

HOST RESPONSE WHEN PERKINSUS MARINUS INFECTION INTENSITIES INCREASE IN THE OYSTER CRASSOSTREA CORTEZIENSIS.

INTRODUCTION

Cultivation of the normative Pacific oyster Crassostrea gigas (Thunberg, 1793) along the northwestern coast of Mexico has resulted in unexplained mortalities in areas where summer temperatures reach 35[degrees]C, unlike the case of the native oyster Crassostrea corteziensis (Hertlein, 1951), which is cultivated near mangrove areas where it grows at temperatures 25[degrees]C-35[degrees]C. Rapid growth of C. corteziensis during summer (Chavez-Villalba et al. 2005) suggests that high temperatures are favorable for its cultivation, making it an alternative species for culture in the region.

Oyster mortalities have been explained by the interaction between anomalous temperatures, pathogens, and the differential susceptibility of various oyster species (Bushek & Allen 1996a; Samain & McCombie 2008). When temperature rises along the east coast of the United States, perkinsosis disease causes massive mortalities of the adult Eastern oyster Crassostrea virginica infected by the protozoan Perkinsus marinus (Andrews & Hewatt 1957). The increase in temperature is critical for P. marinus, given its ability to proliferate in vitro between 10 and 40[degrees]C, and its optimal growth at 35[degrees]C (Dungan & Hamilton 1995), leading to increased infection intensity in C. virginica when field temperatures reach 26[degrees]C (Crosby & Roberts 1990, Ragone-Calvo et al. 2003). Furthermore, the proliferation of P. marinus isolates from high-temperature sites is faster than that of isolates from low-temperature sites (Ford & Chintala 2006).

The protozoan Perkinsus marinus detected in Crassostrea corteziensis oyster farms in Nayarit, Mexico, was phylogenetically grouped with different P. marinus genotypes of low and moderate virulence and separated from the clade with the most virulent P. marinus genotype (Bushek & Allen 1996b) from Virginia (Escobedo-Fregoso et al. 2015). So far, disease-related mortalities have not been observed in C. corteziensis farms in Mexico; however, the oyster species' response to this pathogen remains unknown. The differential survival of some genetic families of Crassostrea gigas and Crassostrea virginica oysters (Bushek & Allen 1996a; Samain et al. 2007) has led to conducting transcriptome analysis to identify genes that promote survival in response to pathogens (McDowell et al. 2014, Nikapitiya et al. 2014). Expression analyses indicated that resistant C. virginica increase the expression of the gene cvSI-1, a serine protease inhibitor (SP1), by inactivating the extracellular P. marinus subtilisin and perkinsin proteases that inhibit the proliferation of P. marinus (Xue et al. 2009). It was proposed that because of the high expression levels of genes involved in cellular death, transcriptomic signatures might help to identify vulnerable C. gigas stocks (Chaney & Gracey 2011).

In susceptible oyster species such as Crassostrea virginica, in which proliferation of the protozoan Perkinsus marinus is higher than that in the resistant Crassostrea gigas (Goedken et al. 2005), P. marinus has the advantage of being able to enter host cells and lead to their destruction. Phagocytosis in C. virginica is insufficient to destroy P. marinus (Goedken et al. 2005), because it evades the host cell respiratory burst via the production of superoxide dismutase (SOD) (Ahmed et al. 2003). When phagocytosis occurs during early infection, mechanisms such as chemotaxis and increase in the activity of nicotinamide adenine dinucleotide phosphate (NADPH)-oxidase generating the free radical super oxide are involved. Pathogen destruction by phagocytosis via reactive oxygen species is counteracted by antioxidants such as SOD and glutathione S-transferase (GST), and their activity is positively correlated with the activity of the NADH-oxidase enzyme.

The strategy of several pathogens to survive and proliferate in their host is to modulate the immune response, as in the case of Perkinsus marinus, which is able to inhibit apoptosis in Crassostrea virginica (Hughes et al. 2010). Apoptosis inhibition is greater in highly virulent strains compared with those that have low and intermediate virulence (Hughes et al. 2010). Unlike what is known in mammals, apoptosis inhibition of C. virginica is not associated with a decrease of caspase-3 (CAS3) activity, and the apoptosis inhibition mechanism is still unknown in molluscs (Hughes et al. 2010). Apoptosis in model species is activated by the tumor necrosis factor (TNF) and a cascade of caspases, such as caspase-8 (CAS8) followed by CAS3, that regulate the DNA fragmentation factor gene (DNA-FRAG) leading to cell death (Yan et al. 2006); however, CAS3 might be controlled by apoptosis inhibitor genes (IAP) to prevent cell death. An early response to infections is the activation of Toll receptors that signal the evolutionarily conserved signaling intermediate (ECSIT), and cactus that conduct the translocation to the nucleus of the nuclear factor-kappa B (NF-[KAPPA]B) which regulates the gene's immune response.

The aim of this study was to evaluate the responses of the oyster Crassostrea corteziensis when the proliferation of Perkinsus marinus increases under laboratory conditions. Responses analyzed included infection intensity of P. marinus, oyster survival, and expression of specific genes involved in the host's immune response. This study contributes to the understanding of C. corteziensis responses when P. marinus infection increases in the field under conditions in which the water temperature is optimal for P. marinus proliferation.

MATERIALS AND METHODS

Origin of Oysters

Thirty-two adult Crassostrea corteziensis oysters (mean [+ or -] SD. SD = 10.2 [+ or -] 4 g wet weight, WW) were collected from Baja California Sur (BCS), Mexico, at an ambient temperature of ~20[degrees]C, and diagnosed for the degree of Perkinsus marinus infection. In addition, oysters produced in a hatchery and field-grown in BCS were collected for a challenge experiment. We were unable to find C. corteziensis farms without P. marinus; however, oysters from BCS compared with Sinaloa and Nayarit oysters (data not show) had the lowest P. marinus infection levels (0.5-2 according to the Mackin scale; Ray 1954).

Quantification of Perkinsus marinus Using Partial Body Burden Ray Fluid Thioglyeollate Medium

The intensity of Perkinsus marinus infection was quantified in a subsample of oysters, from which gills were dissected, weighed, and incubated in Ray fluid thioglyeollate medium (29.4 g [L.sup.-1], pH 7) containing 100 U m[L.sup.-1] penicillin G-streptomycin and 50 U m[L.sup.-1] nystatin (P4333; N3503; Sigma-Aldrich, St. Louis, MO) for 7 days. Tissue digestion was carried out in 10 mL of 2 N NaOH at 50[degrees]C; pellets were recovered by centrifugation at 2,500 g for 15 min and were resuspended in 5 mL of phosphate buffered saline (Almeida et al. 1999). Each sample was diluted, iodine stained, and infection intensity quantified in a Neubauer chamber observed under a compound microscope. The concentration of P. marinus (number of cells m[L.sup.-1]; CN) was calculated as CN = (C1 + C2 + C3 + C4)/(4 x 10.000 x Fd), where C is the number of protozoa per each square of the Neubauer chamber, and Fd is the dilution factor. Body burden of P. marinus, in cells per gram of analyzed host tissue, was normalized by dividing the total number of protozoa by the WW of the respective tissue subsample (Almeida et al. 1999). Infection intensity was categorized according to the Mackin scale (0-5), where 0 indicates no detection of protozoans and 5 is the highest level of infection (Ray 1954). The Mackin scale was obtained according to Choi et al. (1989), and the burden of hypnospores (H, number of spores g W[W.sup.-1]) was calculated as H = 1,409.9 ([10.sup.0.64296X])/WW, where X is a numerical value of the Mackin scale.

Detection of Perkinsus marinus by Polymerase Chain Reaction (PCR)

A section of the gill from each oyster was fixed in 90% ethanol, and DNA was extracted from 10 mg of tissue homogenized with 400 [micro]L buffer (100 mM NaCl, 50 mM Tris, 100 mM ethylenediaminetetraacetic acid, 1% sodium dodecyl sulfate) and 20 [micro]g proteinase K, incubated at 60[degrees]C. The DNA was precipitated with 200 [micro]L NaCl (6 M), washed with ethanol 100% and 70%, and centrifuged at 12,000 g. Pellets were dried in a centrifugal vacuum evaporator (Speed Vac, Thermo Scientific, Waltham, MA) for 20 min and resuspended in 50 [micro]L distilled water. Quality and concentration of DNA were evaluated using a spectrophotometer (NanoDrop 2000, Thermo Scientific). Detection of Perkinsus marinus was performed by PCR targeting, 703 bp of the internal transcribed spacers (ITS) of the Perkinsus spp. The PCR analyses were carried out in 12.5 [micro]L reaction media containing 2.5 [micro]L Go Taq Flexi buffer green, 2.5 mM Mg[Cl.sub.2], 0.25 mM dNTP, 0.2 [micro]M of primers PerkITS85 (5'-CCG CTT TGT TTG GAT CCC C-3') and PerkITS750 (5 -ACA TCA GGC CTT CTA ATG ATG-3') (Casas et al. 2002b), 0.5 U Go Taq Flexi DNA polymerase (M8295, Promega, Madison, WI), and 100 ng DNA. Amplification was performed in a thermocycler (Applied Biosystems, Carlsbad, CA) with an initial denaturation step at 95[degrees]C for 4 min, followed by 40 cycles (95, 65, and 72[degrees]C for 1 min each), and a final extension at 72[degrees]C for 5 min (modified from Casas et al. 2002b). Products of the PCR were subjected to electrophoresis in 1.2% agarose gels, stained with ethidium bromide and visualized with ultraviolet light. The PCR product of oysters from BCS was sequenced (submitted to GenBank, Accession no. KJ458987) to verify the sequence of P. marinus. Sequences of P. marinus from Nayarit (GenBank Accession no. JQ266231-JQ266264) were reported by Escobedo-Fregoso et al. (2015).

Perkinsus marinus Culture

The species Crassostrea corteziensis (n = 12) from Boca de Camichin, Nayarit, Mexico (oysters with high Perkinsus marinus infection levels), were dissected to obtain 1 [cm.sup.2] gill sections. Tissues were washed twice with 2 mL of sterile seawater on 24-well tissue culture plates (353,847, Corning, Tewksbury, MA) and washed twice with 2 mL of antibiotic solution (100 U m[L.sup.-1] penicillin G-streptomycin, 50 U m[L.sup.-1] nystatin) for 30 min each, followed by two washes with sterile seawater. Tissues infected with P. marinus were homogenized with a pestle in 1 mL of antibiotic solution and centrifuged at 12,000 g for 5 min. The pellets with the protozoans were resuspended in 1 mL filtered seawater; 50 [micro]L was placed in four wells with 1 mL DME-Ham's F12 (12500-062, GIBCO, Carlsbad, CA), 50 mM Hepes, 3.5 mM sodium bicarbonate, 0.5% fetal bovine serum (F6178, Sigma-Aldrich) previously exposed at 56[degrees]C for 30 min, and the antibiotic solution dissolved in sterile seawater, pH 6.6-6.8 (Gauthier & Vasta 1995). The P. marinus culture was incubated in a humidity chamber at 28[degrees]C, and half of the medium was replaced every 6 days. Once proliferation was observed under a compound microscope, cultures were centrifuged at 2,000 g for 15 min; then the pellets were transferred to culture flasks with 25 mL DME-Ham's F12 (1:2 v/v) and incubated until a concentration of [10.sup.5] cells m[L.sup.-1] was obtained as an inoculum to inject the experimental oysters. Protozoans were recovered by centrifugation and washed twice with sterile seawater (Gauthier & Vasta 1995, Casas et al. 2002a). Protozoan viability in the suspension was determined by mixing (1:1) with 15 [micro]L of neutral red (N2889; Sigma-Aldrich) for 30 min and counting in a Neubauer chamber.

Perkinsus marinus Experimental Challenge

To evaluate immune response expression by Crassostrea corteziensis, we searched Nayarit (Escobedo-Fregoso et al. 2015) and BCS oyster farms for individuals that did not have Perkinsus marinus; however, both sites had infected oysters. The P. marinus experimental challenge was carried out with C. corteziensis (n = 65; 6-7.5 cm long) from BCS because oysters had the lowest P. marinus infection (0.5-2) at this location. Oysters were acclimated to 26[degrees]C in the laboratory by increasing 1[degrees]C per day. Shells were notched close to the adductor muscle, and the latter was injected in 26 control oysters with 220 [micro]L artificial seawater. The adductor muscle of the remaining 39 oysters was injected with 5.4 x [10.sup.6] P. marinus in 220 [micro]L sterile seawater. The notch and valves were held closed for 30 min with rubber bands to prevent water exchange, and inoculated oysters were maintained in six 25-L tanks at 26[degrees]C for 15 days. On the second day, oysters were fed Isochrisys galhana; 10% of the tank water was exchanged every day starting on the seventh day. Mortality was determined daily, and dead oysters were removed. Detection of P. marinus by PCR and P. marinus intensity, were analyzed in 32 oysters before injection (day 0), 22 control oysters injected with saline solution sampled on day 15, and 15 surviving oysters injected with P. marinus sampled after 15 days.

Selection of Reference and Immune Response Genes

Reference genes to normalize gene expression were selected from those involved in ribosomal elongation and cytoskeleton processes, and genes involved in the immune response were selected from the preliminary transcriptome of Crassostrea corteziensis. The genomic information for C. corteziensis was obtained from two paired-end libraries sequenced on an Illumina Hiseq 2000 platform, and reads of 100 bp were assembled using Trinity and submitted to the National Center for Biotechnology Information Sequence Read Archive (SRR1170558, SRR1170559). The primers were obtained with the software Primer3 v.0.4.0 (http://frodo.wi.mit.edu/). Their characteristics were corroborated with the DNAcalculator (http://sigmagenosys.com/calc/DNACalc.asp) and OligoAnalyzer 3.1 (http://idtdna.com).

Gene Expression Analysis

Challenged oysters that were not injected with Perkinsus marinus were classified into two groups: (1) control oysters with level 3 of the Mackin scale (C3, n = 2), and (2) control oysters with infection level 4 (C4, n = 6). Surviving experimental oysters injected with P. marinus were classified as exhibiting level 4 (14, n = 3) and infected oysters with level-5 infections (15, n = 4), respectively. A piece of gill was homogenized individually with pestles in TRIzol reagent following the manufacturer's protocol (15596-018; Invitrogen, Carlsbad, CA). The RNA was assessed spectrophotometrically (NanoDrop 2000: Thermo Scientific. Waltham, MA) and using electrophoresis. The DNA was removed from 5 [micro]g of RNA by incorporating 1 U DNAse (AM2238; Invitrogen), 2.5 [micro]L TURBO DNAse buffer 10x in a final volume of 25 [micro]L incubated at 37[degrees]C for 30 min, and the reaction was stopped for 10 min with 15 mM ethylenediaminetetraacetic acid at 75[degrees]C. Nonamplification of actin-[beta] (ACT-[beta]) was verified by PCR.

For the relative expression (RE) analyses. RNA (1 [micro]g) from 15 gills of the experimental oysters were mixed with 0.5 [micro]g oligodT, incubated at 70[degrees]C for 5 min, and then chilled on ice for 5 min. Retrotranscriptions were performed by adding 1 [micro]L of reverse transcriptase ImProm-II (A3802, Promega), 4 [micro]L buffer 5x ImProm-II. 30 mM Mg[Cl.sup.2], 0.5 mM dNTP, and 40 U RNAsin (N2515, Promega) in 20 [micro]L incubated at 25[degrees]C for 5 min. with an extension at 42[degrees]C for 60 min and enzyme inactivation at 70[degrees]C for 15 min.

Reverse transcription quantitative PCR (RT-qPCR) was performed on a real-time system CFX96 (Bio-Rad Laboratories, Hercules, CA); each reaction was carried out with 3 [micro]L Go Taq Flexi buffer 5x, 2.5 mM Mg[Cl.sub.2], 0.15 mM dNTPs, 0.45 U Go Taq Flexi DNA polymerase (M8295, Promega). and 1x EvaGreen DNA-binding dye (3100; Biotum, Hayward, CA) in 15 [micro]L final volume (Llera-Herrera et al. 2012). The primer concentration was modified according to the amplification of each gene from 0.2 to 0.5 [micro]M. Reverse transcription quantitative PCR analysis was performed at 94[degrees]C for 3 min, 40 cycles at 94[degrees]C for 10 sec, and 60[degrees]C for 30 sec. Acquisition reads occurred at 78[degrees]C for 2 sec, and dissociation was read from 60 to 94[degrees]C at 0.5[degrees]C [cycle.sup.-1]. All samples were analyzed in triplicate, and primers with single amplicons were used.

Efficiency and Stability of Reference Genes

The RT-qPCR efficiency of each primer pair (Table 1) was determined by performing standard curves using 10-fold or 5-fold dilution of PCR products. The efficiency of the PCR reaction (E) was calculated from the slope of the standard curve as E = [10.sup.(-1/slope)] -1, where the PCR is 100% efficient when the slope is -3.32. A PCR efficiency between 90% and 110% is considered acceptable (slope between 3.1 and 3.6).

To normalize the expression of immune-related genes, the relative stability of the four candidate reference genes [ribosomal protein L10 (RPL10), glyceraldehyde-3-phosphate dehydrogenase 1 (GAPDH), ribosomal protein L8 (RPL8), and ACT-[beta]] was calculated with the quantification cycle (Cq) of the 15 samples for each gene using four methods: Delta CT, BestKeeper, Normfinder, andz geNorm (http://leonxie.com/referencegene.php). Determination of the optimal number of reference genes was calculated with geNorm using pairwise variations. The normalization factor (NF) was calculated using the geometric mean of the relative quantities (RQ) of the three most stable genes, where NF = geomeanRQ (RPL10. GAPDH. RPL8) and RQij = E (Cq minimum) - Cqij), E is the gene-specific efficiency, and (Cq minimum - Cqij) is the lowest Cq value of all samples minus the mean of the Cq value for each sample (Llera-Herrera et al. 2012). The RQ for each immunerelated gene were normalized to obtain RE = RQ N[F.sup.-1]. The number of oysters analyzed by RT-qPCR was different because only surviving oysters were evaluated.

Square root transformations of RE values were used to compare the gene expression levels among the four infection levels. Statistical analyses among groups used one-way analysis of variance (STATIST1CA 6.0, StatSoft, Tulsa, OK) followed by the post hoc Fisher's test (P < 0.05).

Phylogenetic Analysis

Sequences of the 16S ribosomal DNA and SPI were obtained from NCBI and were aligned with CLUSTAL W. Phylogenetic analyses were calculated with MEGA6, according to the models Tamura-3-Parameter (T92) for 16S, and Kimura-2-Parameter (K2) for the SPI. The robustness of maximum likelihood was tested with 10,000 bootstraps.

RESULTS

Identification of Perkinsus marinus in BCS

The consensus sequence from the rDNA-ITS region of the Perkinsus marinus isolated in the present study from Crassostrea corteziensis originating from BCS, Mexico, was 638 bp (GenBank Accession no. KJ458987); however, low-quality bases were removed before analyses were done with 561 bp. The sequence KJ458987 showed 100% similarity to the P. marinus ITS of C. corteziensis from Nayarit, Mexico (GenBank Accession no. JQ266240), which was grouped in the same phylogenetic clade of P. marinus isolated from Crassostrea gigas from Bahia Kino, Sonora, Mexico, and P. marinus of Crassostrea virginica from North Carolina, MD, Louisiana, and New Jersey (Escobedo-Fregoso et al. 2015).

Intensity of Perkinsus marinus and Oysters Survival

The BCS oysters collected at an ambient temperature of 20[degrees]C had Perkinsus marinus intensities from 0.5 to 2 (Mackin scale), and when the temperature was experimentally increased to 26[degrees]C for 15 days, the intensity increased (2-5), and 68% of the oysters were infected with intensity levels of 4 (Fig. 1). The surviving oysters injected with P. marinus exhibited intensities from 3 to 5, and 60% of them showed level 5 infection (Fig. 1). The highest mortality in oysters injected with P. marinus (43.6%) occurred the second day after injection and mortality decreased thereafter. Cumulative mortality was 64.1% in injected oysters and 15.4% in the control group on day 15 (Fig. 2). The fact that the highest mortality occurred 2 days postinjection is attributed to P. marinus infection because no mortalities were detected at this time in the control group. The early mortality in the control (two oysters) is attributed to the effects of notching the shell and injection. The mortality of two oysters after the 14th day are attributed to increased infection resulting from the temperature increase.

Selection of Candidate Reference Genes

To select the reference genes used to normalize gene expression, we evaluated ribosomal, cytoskeleton, and elongation genes. From the eight reference genes, only four primer pairs had efficiencies between 92% and 100% (Table 1). Tubulins and elongation factor genes were discarded because the primer efficiency was low. The amplification efficiency of qPCR primers was between 90% and 110%, indicating that the PCR product doubled with each cycle.

Stability of Reference Genes

Based on the stability analysis of the reference genes, the most stable genes were RPL10 and GAPDH, followed by RPL8 and ACT-[beta] (Fig. 3). The pairwise variation (V) analyzed by geNorm was 0.109 for V = 2/3 and 0.331 for K=3/4. Given that a cutoff value below 0.15 is recommended to determine the optimal number of reference genes for normalization, we used three genes as reference genes. Furthermore, geNorm suggests using the three best reference genes. Differential expression of ACT-[beta] was found between the experimental groups, where group C3 oysters had a higher expression than the C4, I4, and 15 oyster groups. Therefore, the relative gene expression was normalized using the geometric mean expression of genes RPL10, GAPDH, and RPL8, which were selected as the reference genes.

Relative Expression of Immune Response Genes

Efficiencies of 90%--100% of standard curves for primers of immune response genes were obtained before transcript quantification by RT-qPCR. The expression level of a SPI was measured in Crassostrea corteziensis because SPI CvS2 and CvS1 are involved in the resistance to Perkinsus marinus in Crassostrea virginica (La Peyre et al. 2010); cvSI-1 is different, however, from the SPI of C. corteziensis evaluated in the present study. Significantly lower SPI expression levels (Fig. 4A) were found in the most highly infected oysters (15) compared with C3 oysters.

The relative gene expression of dual oxidase 2 (DUOX) or NADPH-oxidase, peroxidasin, GST, SOD Cu-Zn, and ACT-[beta] genes, which participate in phagocytosis (Fig. 4A, B), was analyzed in oyster groups classified according to their infection level. The DUOX gene, which is involved in oxidative stress (Bugge et al. 2007), had a lower expression in the oyster group with the highest infection level (I5) compared with the C3 group. The GST gene had significantly lower expression levels in oysters with high infection (I5) compared with C3 oysters, although there was high intraspecific variability, as reflected in up to 3-fold differences in expression among individuals. Oysters with infection levels 4 and 5 (C4, I4, and I5) had low SOD expression compared with C3 oysters. The ACT-[beta] gene, considered as a reference gene because it participates in cytoskeleton formation, had lower expression in oysters C4, I4, and I5 compared with C3 oysters.

Genes involved in the activation of the NF-[KAPPA]B (Fig. 4C), such as the receptor lipopolysaccharide-induced TNF alpha factor (LPTNF) and the ECSIT in the toll pathway, showed low expression in oysters with infection levels 4 and 5 (C4, I4, and I5) compared with C3 oysters. There were no significant differences among groups when assessing the gene nuclear factor NF-[kappa]B inhibitor (NF-[kappa]-INH).

From the analysis of genes involved in apoptosis, i.e., CAS8, CAS3, deterin apoptosis (B-IAP), baculoviral inhibitor apoptosis 2 (B-IAP2), and DNA-FRAG, the kinase CAS8 regulatory gene of apoptosis had low expression in oysters C4, I4, and I5. The CAS3 gene, which is regulated by apoptosis inhibitors, had the same expression levels in oysters with all infection levels. Both apoptosis inhibitors (B-IAP) were lower in C4, I4, and I5 groups compared with C3 oysters. The DNA-FRAG gene, expressed at the end of apoptosis to fragment DNA, was also lower in groups C4, I4, and I5 than in group C3 (Fig. 4D).

Phytogeny of the SPI

The SPI of Crassostrea corteziensis is homologous to that of Crassostrea gigas (GenBank, EU583801). There is thus greater similarity between C. corteziensis and C. gigas than there is between the former and Crassostrea ariakensis. The phylogenetic analyses of 16S ribosomal RNA and SPI grouped the sequences of oysters in a separate clade from that of pectinids and gastropods (Fig. 5). No similarity was found with the Crassostrea virginica SPI cv-SI (DQ092546) (Xue et al. 2006), which showed higher expression in oysters selected for increased resistance to Perkinsus marinus (La Peyre et al. 2010); cv-SI was classified as a single member in a different family of protease inhibitors in the MEROPS database.

DISCUSSION

Identification and Intensity of Perkinsus marinus Infection in Crassostrea corteziensis

The protozoan Perkinsus marinus is widely distributed along the east coast of the United States where it attains prevalence rates of up to 100% in Crassostrea virginica (Oliver et al. 1998); however, the combination of different P. marinus virulence genotypes (Reece et al. 2001) and oysters of varying resistance to the disease has led to the survival of certain genetic oyster families (Bushek & Allen 1996a). Pathogen spread in molluscs has been mainly attributed to their movement among sites; yet with improved surveillance programs and more sensitive diagnostic tools, pathogens such as P. marinus have been detected in new hosts such as Crassostrea corteziensis from Mexico (Caceres-Martinez et al. 2008).

In the present study, Perkinsus marinus (KJ458987) was recorded for the first time in Crassostrea corteziensis cultivated in BCS, which shows 100% similarity to the ITS of P. marinus from Nayarit (JQ266240). Although P. marinus from BCS was phylogenetically grouped (Escobedo-Fregoso et al. 2015) in the clade of P. marinus genotypes classified as moderately virulent (Bushek & Allen 1996b), it is not possible to determine the response of the new host C. corteziensis because pathogens adapt to the conditions of their hosts, and environmental conditions differ among sites.

The present study has confirmed that in Crassostrea corteziensis, as occurs in Crassostrea virginica (Crosby & Roberts 1990), the increase in temperature contributed to the proliferation of Perkinsus marinus. Oysters, however, showed different P. marinus infection levels in the group injected with the protozoan, indicating that the response to P. marinus differs among individuals.

Infected Crassostrea corteziensis could survive under naturally occurring Perkinsus marinus intensities when the temperature remained at 26[degrees]C for 15 days. However, the high mortality (43.6%) in oysters injected with P. marinus demonstrates that C. corteziensis is susceptible to high P. marinus doses (5.4 x [10.sup.6] cells) at which Crassostrea gigas ([10.sup.6]) showed resistance (Tanguy et al. 2004). In the present study, the early mortalities occurred at 48 h postinfection. In previous studies, they occurred in Crassostrea virginica exposed to the wild-type parasite isolated in the summer, contrasting with the late mortality caused by fall isolates (Ford et al. 2002). Early mortalities also occurred in oysters infected with cultured P. marinus supplemented with pallial mucus (Pales Espinosa et al. 2014), demonstrating differences in P. marinus virulence depending on environmental and culture conditions.

The mortalities here recorded in Crassostrea corteziensis challenged with Perkinsus marinus were not observed in the C. corteziensis challenge of Gutierrez-Rivera et al. (2015), although the initial infection levels of the oysters were low in both studies; BCS oysters showed infection levels between 0.5 and 2 versus Mackin values <1 in Sinaloan oysters. This study demonstrated that latent infections increased when the temperature was raised to 26[degrees]C, in contrast to the results using unchallenged oysters reported by Gutierrez-Rivera et al. (2015) because Sinaloan oysters were cultured in the field at 28.7[degrees]C (Gutierrez-Rivera et al. 2015), whereas those from BCS were cultured at 20[degrees]C. In conclusion, the temperature at which oysters are cultured influenced the increase in infection levels because in the present study, oysters reached infection categories 3-5, in contrast to the oysters in the Gutierrez-Rivera et al. (2015) study, which reached infection level 2.

The decline in the population of Crassostrea virginica in Chesapeake Bay has not occurred in the Gulf of Mexico, even though populations in both regions coexist with Perkinsus marinus. This has been attributed in part to higher temperatures in the Gulf of Mexico that induce faster oyster growth (Bushek & Allen 1996a). Although different pathogens have been identified in Crassostrea corteziensis (Caceres-Martinez et al. 2010), to date they have not led to mortalities, unlike findings in the introduced species Crassostrea gigas that is cultivated in the northern Gulf of California, where mortalities are associated with an increase in temperature. Native species such as C. corteziensis in the Gulf of California reach commercial size in a year, and this fast growth prevents mortality caused by P. marinus proliferation in the host, thus providing a viable alternative candidate for cultivation in the Gulf of California.

Reference Genes

The mechanism of immune response in Crassostrea corteziensis is unknown; therefore, this study was performed to understand the immunological processes involved in Perkinsus marinus infection. For proper transcript quantification by RT-qPCR and to prevent improper biological interpretation (Tricarico et al. 2002), it was important to measure the stability of reference genes (De Santis et al. 2011, Llera-Herrera et al. 2012) among oysters with varying infection levels. The relative stability analysis showed that RPL10, GAPDH, and RPL8 were the most stable genes in C. corteziensis gills among oysters with different levels of infection. Although GAPDH is unstable in human tissues (Barber et al. 2005) and in Crassostrea gigas adductor muscle (Dheilly et al. 2011), GAPDH stability in C. corteziensis gills was high.

Although the ACT-[beta] gene has been widely used as a normalizer gene, it was found to be unstable in the present study. The unstable expression of actin under infection occurs because it is involved in phagosome formation during early pathogen internalization where actin cytoskeleton remodeling occurs (May & Machesky 2001). Actin overexpression was observed in Crassostrea gigas infected by herpesvirus OsHV-1, suggesting that the virus uses actin for mobility (Jouaux et al. 2013). Low actin stability was also found in Ostrea edulis infected by Bonamia ostreae (Morga et al. 2010), suggesting that actin should not be used as a reference gene in infected molluscs.

Expression of the Inhibitor of Serine Proteases

The low expression levels of SPI in highly infected oysters assayed is attributed to the SPI decrease in Crassostrea corteziensis that prevents the proliferation of Perkinsus marinus in Crassostrea virginica resistant to this pathogen. Neutralization by SPI of the P. marinus proteases perkinsin and subtilisin prevents the uptake of nutrients by the host and thus the proliferation of P. marinus (Joseph et al. 2010, La Peyre et al. 2010). Although in the present study SPI expression was quantified in gills, where the synthesis is lower than in the digestive gland, the C. corteziensis SPI transcripts were found in all oysters analyzed, unlike the results of La Peyre et al. (2010) where some oysters exhibited no cv-SI expression. In the present study, C. corteziensis with low infection levels showed the highest SPI expression levels, a pattern similar to that reported in Crassostrea gigas which secretes SPI to increase resistance against pathogens such as P. marinus (Romestand et al. 2002).

Genes Involved in Phagocytosis

Results of this study suggest that Crassostrea corteziensis phagocytosis occurs in early infections because oysters with low infection levels (C3) presented high expression of DUOX or NADPH-oxidase, involved in early phagocyte chemotaxis. The increase in NADPH in zebrafish infected by the fungus Candida albicans was related to the early phagocyte migration to infected sites, as NADPH-oxidase is considered a strong indicator of survival (Brothers et al. 2013). In addition, high NADPH-oxidase transcription was associated with high GST and SOD antioxidant expression in the less-infected C. corteziensis assayed. A high antioxidant content has been found in resistant genetic families of Crassostrea gigas (Fleury et al. 2010) that leads to an increase in reactive oxygen species under anomalous conditions such as infection, which is counteracted by high transcript levels of antioxidant enzymes.

Levels of peroxidasin expression did not differ among the levels of infection observed in this study. Peroxidasin stabilizes the cellular matrix and is composed of four Ig-like domains in arthropods and vertebrates (Soudi et al. 2012). It also participates in cell destruction in programmed death (i.e., apoptosis) and protects the organism from foreign materials (Nelson et al. 1994).

Genes Involved in Cellular Proliferation

High expression of the TNF in less-infected C3 oysters was related to high expression of CAS8 involved in apoptosis. The similar CAS3 expression and high ECSIT expression in all infected oysters, however, suggest that control of apoptosis by way of NF-[kappa]B occurs to prevent cell death.

High TNF expression in the mussel Hyriopsis cummingii infected by Vibrio anguillarium (Ren et al. 2013) triggers proinflammatory cytokines as an early response to infection. Findings of the present study suggest that this protection occurs in Crassostrea corteziensis with low levels of Perkinsus marinus infection to prevent proliferation. Although receptor LPTNF expression was higher in less-infected oysters, the cactus inhibitor or NF-[kappa]-INH transcript levels did not differ among the four conditions of infection, suggesting that C. corteziensis recognizes P. marinus via other receptors such as toll or 18-wheeler leading to the activation of the NF-[kappa]B (Aderem & Ulevitch 2000).

Genes Involved in Apoptosis

The least infected oysters showed overexpression of apoptosis genes LPTNF, DNA fragmentation, and the CAS8 inductor of protease CAS3, which is critical in DNA fragmentation by extrinsic pathways caused by pathogens (Zhang et al. 2011). In contrast, CAS3 expression was similar under all infection conditions, suggesting that cell death by an extrinsic pathway was inhibited by the IAP because low levels of CAS3 in less-infected oysters were related to high levels of IAP1 and IAP2 (Fig. 5). Despite CAS3 inhibition in less-infected oysters, the expression of the DNA fragmentation was high, indicating that the latter could be taking place during apoptosis by an intrinsic pathway induced by high oxidative stress transcript levels, given that this apoptosis pathway is independent of CAS3. Previous results indicate that effective apoptosis in less-infected oysters prevents protozoan proliferation by destroying infected cells, a response that occurs in the early stages of infection and is followed by a decrease of apoptotic cells (Hughes et al. 2010), i.e., apoptotic hemocytes decrease from 50% to 10% (Sunila & LaBanca 2003).

Phytogeny of the SPI Gene

Although no similarity was observed between the SPI of Crassostrea corteziensis and the SPI (CvS1, CvS2) of Crassostrea virginica, the closest species to C. corteziensis according to 16S ribosomal RNA, the phylogenetic analysis shows that the C. corteziensis SPI is grouped in the same clade with the SPI-bearing, multi-Kazal conserved domain in the proteinase inhibitor. It is thus concluded that C. corteziensis has one SPI homologous to the Perkinsus marinus resistant Crassostrea gigas. The Kazal domain inhibits the catalytic site of serine proteinases, and the function of the Kazal-type proteinase is to protect the host against microbial proteinases (Laskowski & Kato 1980). Multi-Kazal domain inhibitors in invertebrates are one of the key response mechanisms against pathogens because they compete for the active site of microbial proteinases using a lock-and-key mechanism. Multi-Kazal domain inhibitors increase the defense response because various domains usually have different specificities toward a particular protease.

In conclusion, the temperature increase contributed to Perkinsus marinus proliferation in Crassostrea corteziensis cultured in BCS, and high concentrations of P. marinus caused mortalities of C. corteziensis. This study determined that C. corteziensis is affected by P. marinus and that the low level of infection in this species is associated with high expression of genes involved in phagocytosis, apoptosis, and SPI, responses known to be used by invertebrates to avoid the proliferation of pathogens.

ACKNOWLEDGMENTS

The authors thank Carmen Rodriguez Jaramillo, Eulalia Meza Chavez, Pablo Monsalvo Spencer, and Gabriel Robles Villegas for their technical assistance. They also thank Raul Llera Herrera for his comments and support in data analysis. Ira Fogel and Diana Dorantes of CIBNOR provided extensive editorial services. This research was supported by the Consejo Nacional de Ciencia y Tecnologia of Mexico (SEP-CONACYT grant 106887); C.E.F. was a recipient of a CONACYT doctoral fellowship.

LITERATURE CITED

Aderem, A. & R. J. Ulevitch 2000. Toll-like receptors in the induction of the innate immune response. Nature 406:782-787.

Ahmed, H., E. J. Schott, J. D. Gauthier & G. R. Vasta. 2003. Superoxide dismutases from the oyster parasite Perkinsus marinus: purification, biochemical characterization, and development of a plate microassay for activity. Anal. Biochem. 318:132-141.

Almeida, M., F. Berthe. A. Thebault & M. T. Dinis. 1999. Whole clam culture as a quantitative diagnostic procedure of Perkinsus atlanticus (Apicomplexa, Perkinsea) in clams Ruditapes decussatus. Aquaculture 177:325-332.

Andrews. J. D. & W. G. Hewatt. 1957. Oyster mortality studies in Virginia. II. The fungus disease caused by Dermocystidium marinum in oysters of Chesapeake Bay. Ecol. Monogr. 27:1-25.

Barber, R. D., D. W. Harmer, R. A. Coleman, B. J. Clark & D. Robert. 2005. GAPDH as a housekeeping gene: analysis of GAPDH mRNA expression in a panel of 72 human tissues. Physiol. Genomics 21:389-395.

Brothers, K. M., R. L. Gratacap, S. E. Barker, Z. R. Newman, A. Norum & R. T. Wheeler. 2013. NADPH oxidase-driven phagocyte recruitment controls Candida albicans filamentous growth and prevents mortality. PLoS Pathog. 9:el003634.

Bugge, D. M., H. Hegaret, G. H. Wikfors & B. Allam. 2007. Oxidative burst in hard clam (Mercenaria mercenaria) haemocytes. Fish Shellfish Immunol. 23:188-196.

Bushek, D. & S. K. Allen. 1996a. Races of Perkinsus marinus. J. Shellfish Res. 15:103-107.

Bushek, D. & S. K. Allen. 1996b. Host-parasite interactions among broadly distributed populations of the eastern oyster Crassostrea virginica and the protozoan Perkinsus marinus. Mar. Ecol. Prog. Ser. 139:127-141.

Caceres-Martinez, J., R. Vasquez-Yeomans & G. Padilla-Lardizabal. 2010. Parasites of the pleasure oyster Crassostrea corteziensis cultured in Nayarit, Mexico. J. Aquat. Anim. Health 22:141-151.

Caceres-Martinez, J., R. Vasquez-Yeomans, G. Padilla-Lardizabal & M. A. Del Rio Portilla. 2008. Perkinsus marinus in pleasure oyster Crassostrea corteziensis from Nayarit. Pacific coast of Mexico. J. Invertebr. Pathol. 99:66-73.

Casas, S. M., J. F. La Peyre, K. S. Reece, C. Azevedo & A. Villalba. 2002a. Continuous in vitro culture of the carpet shell clam Tapes decussatus protozoan parasite Perkinsus atlanticus. Dis. Aquat. Organ. 52:217-231.

Casas, S. M., A. Villalba & K. S. Reece. 2002b. Study of perkinsosis in the carpet shell clam Tapes decussatus in Galicia (NW Spain). I. Identification of the aetiological agent and in vitro modulation of zoosporulation by temperature and salinity. Dis. Aquat. Organ. 50:51-65.

Chaney, M. L. & A. Y. Gracey. 2011. Mass mortality in Pacific oysters is associated with a specific gene expression signature. Mol. Ecol. 20:2942-2954.

Chavez-Villalba, J., M. Lopez-Tapia, J. Mazon-Suastegui & M. Robles-Mungaray. 2005. Growth of the oyster Crassostrea corteziensis (Hertlein, 1951) in Sonora, Mexico. Aquacult. Res. 36:1337-1344.

Choi, K. S., E. A. Wilson, D. H. Lewis, E. N. Powell & S. M. Ray. 1989. The energetic cost of Perkinsus marinus parasitism in oysters: quantification of the thioglycollate method. J. Shellfish Res. 8:125-131.

Crosby, M. P. & C. F. Roberts. 1990. Seasonal infection intensity cycle of the parasite Perkinsus marinus (and an absence of Haplosporidium spp.) in oysters from a South Carolina salt marsh. Dis. Aquat. Organ. 9:149-155.

De Santis, C., C Smith-Keune & D. R. Jerry. 2011. Normalizing RT-qPCR data: are we getting the right answers? An appraisal of normalization approaches and internal reference genes from a case study in the finfish Lates calcarifer. Mar. Biotechnol. (NY) 13:170-180.

Dheilly, N. M., C. Lelong, A. Huvet & P. Favrel. 2011. Development of a Pacific oyster (Crassostrea gigas) 31, 918-feature microarray: identification of reference genes and tissue-enriched expression patterns. BMC Genomics 12:468.

Dungan, C. F. & R. M. Hamilton. 1995. Use of tetrazolium-based cell proliferation assay to measure effects of in vitro conditions on Perkinsus marinus (Apicomplexa) proliferation. J. Eukaryot. Microbiol. 42:379-388.

Escobedo-Fregoso, C., I. Arzul, N. Carrasco, J. N. Gutierrez-Rivera, R. Llera-Herrera & R. Vazquez-Juarez. 2015. Polymorphism at the ITS and NTS Loci of Perkinsus marinus isolated from cultivated oyster Crassostrea corteziensis in Nayarit, Mexico and phylogenetic relationship to P. marinus along the Atlantic Coast. Transbound. Emerg. Dis. 62:137-147.

Fleury, E., J. Moal, V. Boulo, J. Y. Daniel, D. Mazurais, A. Henaut, C. Corporeau, P. Boudry, P. Favrel & A. Huvet. 2010. Microarraybased identification of gonad transcripts differentially expressed between lines of Pacific oyster selected to be resistant or susceptible to summer mortality. Mar. Biotechnol. (NY) 12:326-339.

Ford, S. E. & M. M. Chintala. 2006. Northward expansion of a marine parasite: testing the role of temperature adaptation. J. Exp. Mar. Biol. Ecol. 339:226-235.

Ford, S. E., M. M. Chintala & D. Bushek. 2002. Comparison on in vitro-cultures and wild-type Perkinsus marinus. II. Dosing methods and host response. Dis. Aquat. Organ. 51:203-216.

Gauthier, J. D. & G. R. Vasta. 1995. In vitro culture of the eastern oyster parasite Perkinsus marinus: optimization of the methodology. J. Invertebr. Pathol. 66:156-168.

Goedken, M., B. Morsey, I. Sunila & S. De Guise. 2005. Immunomodulation of Crassostrea gigas and Crassostrea virginica cellular defense mechanisms by Perkinsus marinus. J. Shellfish Res. 24:487-196.

Gutierrez-Rivera, J., G. F. Arcos-Ortega, A. Luna-Gonzalez, M. C. Rodriguez-Jaramillo, E. T. Arechiga-Carvajal & R. Vazquez-Juarez. 2015. Differential expression of serine protease inhibitors 1 and 2 in Crassostrea corteziensis and C. virginica infected with Perkinsus marinus. Dis. Aquat. Organ. 112:185-197.

Hughes, F. M., B. Foster, S. Grewal & I. M. Sokolova. 2010. Apoptosis as a host defense mechanism in Crassostrea virginica and its modulation by Perkinsus marinus. Fish Shellfish Immunol. 29:247-257.

Joseph, S. J., J. A. Fernandez-Robledo, M. J. Gardner, N. M. El-Sayed, C. H. Kuo, E. J. Schott, H. Wang, J. C. Kissinger & G. R. Vasta. 2010. The alveolate Perkinsus marinus: biological insights from EST gene discovery. BMC Genomics 11:1-21.

Jouaux, A., M. Lafont, J. L. Blin, M. Houssin, M. Mathieu & C. Lelong. 2013. Physiological change under OsHV-1 contamination in Pacific oyster Crassostrea gigas through massive mortality events on fields. BMC Genomics 14:590.

La Peyre, J. F., Q. G. Xue. N. Itoh, Y. Li & R. K. Cooper. 2010. Serine protease inhibitor cvSI-1 potential role in the eastern oyster host defense against the protozoan parasite Perkinsus marinus. Dev. Camp. Immunol. 34:84-92.

Laskowski, M. & I. Kato. 1980. Protein inhibitors of proteinases. Annu. Rev. Biochem. 49:593-626.

Llera-Herrera, R., A. Garcia-Gasca, A. Huvet & A. M. Ibarra. 2012. Identification of a tubulin-[alpha] gene specifically expressed in testis and adductor muscle during stable reference gene selection in the hermaphrodite gonad of the lion's paw scallop Nodipecten subnodosus. Mar. Genomics 6:33-44.

May, R. C. & L. M. Machesky. 2001. Phagocytosis and the actin cytoskeleton. J. Cell Sci. 114:1061-1077.

McDowell, I. C., C. Nikapitiya, D. Aguiar, C. E. Lane, S. Istrail & M. Gomez-Chiarri. 2014. Transcriptome of American oysters, Crassostrea virginica, in response to bacterial challenge: insights into potential mechanisms of disease resistance. PLoS One 9:e105097.

Morga. B., I. Arzul, N. Faury & T. Renault. 2010. Identification of genes from flat oyster Ostrea edulis as suitable housekeeping genes for quantitative real time PCR. Fish Shellfish Immunol. 29:937-945.

Nelson, R. E., L. I. Fessler, Y. Takagi, B. Blumberg, D. R. Keene, P. F. Olson, C. G. Parker & J. H. Fessler. 1994. Peroxidasin: a novel enzyme-matrix protein of Drosophila development. EMBO J. 13:3438-3447.

Nikapitiya, C., I. C. McDowell, L. Villamil, P. Munoz, S. Sohn & M. Gomez-Chiarri. 2014. Identification of potential general markers of disease resistance in American oysters, Crassostrea virginica through gene expression studies. Fish Shellfish Immunol. 41:27-36.

Oliver, L. M., W. S. Fisher, S. E. Ford, L. M. Calvo, E. M. Burreson, E. B. Sutton & J. Gandy. 1998. Perkinsus marinus tissue distribution and seasonal variation in oysters Crassostrea virginica from Florida, Virginia and New York. Dis. Aquat. Organ. 34:51-61.

Pales Espinosa, E., E. Corre & B. Allam. 2014. Pallial mucus of the oyster Crassostrea virginica regulates the expression of putative virulence genes of its pathogen Perkinsus marinus. Int. J. Parasitol. 44:305-317.

Ragone Calvo, L. M., C. F. Dungan, B. S. Roberson & E. M. Burreson. 2003. Systematic evaluation of factors controlling Perkinsus marinus transmission dynamics in lower Chesapeake Bay. Dis. Aquat. Organ. 56:75-86.

Ray, S. M. 1954. Biological studies of Dermocystidium marinum. The Rice Institute Pamphlet, special issue, monograph in biology. Houston, TX. 114 pp.

Reece, K. S., D. Bushek, K. L. Hudson & J. E. Graves. 2001. Geographic distribution of Perkinsus marinus genetic strains along the Atlantic and Gulf coasts of the USA. Mar. Biol. 139:1047-1055.

Ren, Q., X. Zhong, S. W. Yin, F. Y. Hao, K. M. Hui, Z. Zhang, C. Y. Zhang, X. Q. Yu &W. Wang. 2013. The first Toll receptor from the triangle-shell pearl mussel Hyriopsis cumingii. Fish Shellfish Immunol. 34:1287-1293.

Romestand, B., F. Corbier & P. Roch. 2002. Protease inhibitors and haemagglutinins associated with resistance to the protozoan parasite, Perkinsus marinus, in the Pacific oyster, Crassostrea gigas. Parasitology 125:323-329.

Samain, J. F., L. Degremont, P. Soletchnik, J. Haure, E. Bedier, M. Ropert & J. Moal. 2007. Genetically based resistance to summer mortality in the Pacific oyster (Crassostrea gigas) and its relationship with physiological, immunological characteristics and infection processes. Aquaculture 268:227-243.

Samain, J. M. & H. Mc Combie. 2008. Summer mortality of Pacific oyster Crassostrea gigas: the morest project, Quae edition. Versailles.

Soudi, M., M. Zamocky, C. Jakopitsch, P. G. Furtmuller & C. Obinger. 2012. Molecular evolution, structure, and function of peroxidasins. Chem. Biodivers. 9:1776-17793.

Sunila, I. & J. LaBanca. 2003. Apoptosis in the pathogenesis of infectious diseases of the eastern oyster Crassostrea virginica. Dis. Aquat. Organ. 56:163-170.

Tanguy, A., X. Guo & S. E. Ford. 2004. Discovery of genes expressed in response to Perkinsus marinus challenge in eastern (Crassostrea virginica) and Pacific (C. gigas) oysters. Gene 338:121-131.

Tricarico, C., P. Pinzani, S. Bianchi, M. Paglierani, V. Distante, M. Pazzagli, S. A. Bustin & C. Orlando. 2002. Quantitative real-time reverse transcription polymerase chain reaction: normalization to rRNA or single housekeeping genes is inappropriate for human tissue biopsies. Anal. Biochem. 309:293-300.

Xue, Q. L., N. Itoh, K. L. Schey, R. K. Cooper & J. F. La Peyre. 2009. Evidence indicating the existence of a novel family of serine protease inhibitors that may be involved in marine invertebrate immunity. Fish Shellfish Immunol. 27:250-259.

Xue, Q., G. L. Waldrop, K. L. Schey, N. Ithon, M. Ogawa, R. K. Cooper, J. N. Losso & J. La Peyre. 2006. A novel slow-tight binding serine protease inhibitor from eastern oyster (Crassostrea virginica) plasma inhibits perkinsin. the major extracellular protease of the oyster protozoan parasite Perkinsus marinus. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 145:16-26.

Yan, B., H. Wang, Y. Peng, Y. Hu, H. Wang, X. Zhang, Q. Chen, J. S. Bedford, M. W. Dewhirst & C. Y. Li. 2006. A unique role of the DNA fragmentation factor in maintaining genomic stability. Proc. Natl. Acad. Sci. USA 103:1504-1509.

Zhang, L., L. Li & G. Zhang. 2011. Gene discovery, comparative analysis and expression profile reveal the complexity of the Crassostrea gigas apoptosis system. Dev. Comp. Immunol. 35:603-610.

CRISTINA ESCOBEDO-FREGOSO, (1) JORGE RAMIREZ-SALCEDO (2) AND RICARDO VAZQUEZ-JUAREZ (3*)

(1) Consejo National de Ciencia y Tecnologia-Centro de Investigaciones Biologicas del Noroeste S.C. Institute Politecnico National 195, Col Playa Palo de Santa Rita Sur, C.P. 23096 La Paz, Baja California Sur, Mexico; (2) Unidadde Microarreglos, Institute de Fisiologia Celular, Universidad National Autonoma de Mexico, Circuito Exterior s/n, Ciudad Universitaria, Delegation Coyoacan, 04510 Mexico City, Mexico; (3) Centre de Investigaciones Biologicas del Noroeste, S.C. Institute Politecnico National 195, Col. Playa Palo de Santa Rita, C.P. 23096 La Paz, Baja California Sur, Mexico

(*) Corresponding author. E-mail: rvazquez04@cibnor.mx

DOI: 10.2983/035.036.0321
TABLE 1.
Blast hits of Crassostrea corteziensis genes and RT-qPCR efficiencies.

                     Accession number     Function in             Length
Biological process   to C. corteziensis   C. corteziensis         (bp)

Candidate            Contig_1162          RPL10                     726
  reference genes
                     Contig_4             GAPDH                   1,602
                     Contig_1120          RPL8                      940
                     Contig_856           ACT-[beta]                383
Immune response      Contig_4959          Inhibitor of serine     1,566
                                          proteases
Oxidation-           Contig_399           DUOX                    5,920
  reduction
                     Contig_15279         Peroxidasin               706
                     Contig_4190          GST                     1,944
                     Contig_1230          SOD Cu-Zn                 761
NF-Kappa             Contig_160           LPTNF                     885
                     Contig_57858         ECSIT                     901
                     Contig_2430          NF-kappa-B inhibitor    1,698
                                          epsilon (NF-K-INH)
Apoptosis            Contig_9921          CAS8                    3,681
                     Contig_35121         CAS3                      809
                     Contig_26966         Deterin apoptosis         414
                                          (B-IAP)
                     Contig_1125          Baculoviral inhibitor     743
                                          apoptosis 2 (B-IAP2)
                     Contig_6480          DNA-FRAG subunit alpha  1,318

                                                                Identity
Biological process  Species                  Score  e-value      (%)

Candidate           Drosophila sechellia      404    4.00E-095    100
  reference genes     (NP_648514)
                    Drosophila melanogaster   621    0            100
                    (NP_525108)
                    Oslrea edulis             488    5.00E-169     97
                    (AFA34382)
                    Crassostrea ariakensis    269    1.00E-088    100
                    (ABE99841)
Immune response     Crassostrea gigas         598    1.00E-134     70
                    (EKC37817)
Oxidation-          C.gigas (EKC39815)       2475    0             89
  reduction
                    Tursiops truncatus        197    1.00E-007     37
                    (XP_004311896)
                    C. gigas (EKC36795)       346    1.00E-111     76
                    C. gigas (EKC39001)       296    6.00E-098     85
NF-Kappa            C. gigas (EKC36232)       143    6.00E-039     87
                    C. gigas (EKC26622)       329    7.00E-107     77
                    C. gigas (EKC37831)       516    2.00E-177     76
Apoptosis           C. gigas (EKC27835)       665    0             70
                    C. gigas (EKC30354)       540    0             96
                    C. gigas (EKC24792)       140    3.00E-040     86
                    C. gigas (EKC27835)       191    7.00E-055     59
                    C. gigas (EKC41810)       342    6.00E-113     65

                                               Amplicon      qPCR
Biological process   qPCR primers 5'-3'       length (bp)   E (%)

Candidate            CCTCTCCACTTCCTCTTTCGT      117           92
  reference genes    ACTTCCTTGGTTTGTCTTGAGC
                     ACATCATCCCCTCCTCCACT        S4          100
                     ACGCCATTCCTGTGAGTTTT
                     CAAGAAGCTGATCCCCTCTG       160           93.64
                     AACAGGATTCATGGCCACTC
                     GTCAAGAGGACGGGGTGTT        145           92.6
                     CCCAGAGCAAGAGAGGTATCC
Immune response      CGCCGCTATCACTACAACC         95           93.1
                     TTACACTCCACCCCAACTCC
Oxidation-           CCATCACCCACACCTACCTT       104           96.7
  reduction          CTCTGCCTTGACCACCCTAC
                     TGGCAATGATGAGATACCG         81           94.2
                     TCCACCAAACAGAGAGAGCA
                     AGGGAAAAACCAGGCATCAG       148           90
                     AAAGGAAGAGGACCGCAAAG
                     ATTCCTGCTCGGGTTGACT        146           91.8
                     ATAGTTGGGGTCCTCGTCGT
NF-Kappa             CAACATCACCACTTCCACGA       102           91.1
                     GGGATAAGGCAACAACCAAG
                     GAGGGCGGGGTTAGATGT         101           99.2
                     AGGAGGATGGGACGGTGTA
                     AATGACGCAGACAGAAACGA       229           97.7
                     CCAGTGAAGAATCGGAGGAA
Apoptosis            GACTTTGTTCTGGGGTGTGC       164           90.1
                     GCTCGTCCAACTTCCTCATT
                     TGAATGGGACGATAAGGACA       101           92.2
                     TTCGGACTGTTTTGGTTGTG
                     CGAGACGGAGAGGGATTTTT       150           98.6
                     CTGCCAACTTATCGGGGGTA
                     TCGTCACTCTCCTCCCAATC       180           91.5
                     TAAACCCAAGACCCCAACCT
                     ATCATCTGCTCCGACTGG         177           97.5
                     CTGCTGAGAAAAGGGAAGG
COPYRIGHT 2017 National Shellfisheries Association, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Escobedo-Fregoso, Cristina; Ramirez-Salcedo, Jorge; Vazquez-Juarez, Ricardo
Publication:Journal of Shellfish Research
Article Type:Report
Geographic Code:1MEX
Date:Dec 1, 2017
Words:8199
Previous Article:IMPACTS OF ALTERED HYDROLOGY ON THE SOURCES OF PARTICULATE ORGANIC CARBON ON THE DIET OF CRASSOSTREA VIRGINICA IN THE NORTHERN EVERGLADES, FLORIDA,...
Next Article:SPAT PRODUCTION OF THE ROCK OYSTER STRIOSTREA PRISMATICA (GRAY, 1825).
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters