Printer Friendly

HLA Class II Allele, Haplotype, and Genotype Associations with Type 1 Diabetes in Benin: A Pilot Study.

1. Introduction

Type 1 diabetes (T1D) is a chronic and autoimmune disease characterized by the destruction of insulin-producing cells [1, 2]. The incidence of T1D has been increasing worldwide by approximately 3% per year [3], with the highest increase in young children [4]. Although the burden of T1D in the youth has been emphasized in the literature during the last decade, no T1D data exist in Benin. The prevalence of all diabetes was occurring in Benin up from 1.1% in 2001 [5] to 4.6% in 2012 [6]. The implication of HLA-DR/DQ loci in the susceptibility to T1D in Caucasoid and non-Caucasoid populations has been reported [7-9]. The HLA class II region with its multiple polymorphisms is then by far the greatest contributor to the genetic predisposition to T1D [9]. HLA allele and haplotype frequencies vary considerably across ethnic groups [10] as does T1D risk [11]. However, data from many reports show that HLADR3, HLA-DR4, HLA-DQA1 * 05:01, HLA-DQA1 * 03:01, HLA-DQB1 * 02:01, and HLA-DQB1 * 03:02 account for HLA class II allele susceptibility to T1D whereas HLA-DR2, HLA-DQA1 * 01:02, and HLA-DQB1 * 06:02 are in protection to T1D [12-14].

To the best of our knowledge, few studies have investigated the implication of the HLA class II in Black African patients with T1D [15-17]. This pilot study was the first to date to assess associations of specific HLA class II alleles, haplotypes, and genotypes with T1D in Benin.

2. Material and Methods

2.1. Design and Study Sample. The present study was designed as a 1-1-matched case-control study. The participants were 51 patients with T1D attending the Bank of Insulin of Cotonou (a reference center for the diagnosis and the management of diabetics in Benin) from November 2012 to January 2016 and 51 age-, sex-, ethnic-, and residence area-matched unrelated healthy individuals without diabetes or a family history of diabetes recruited in the general population.

The study was approved by the Research Ethics Review Boards of University of Abomey-Calavi. All participants provided written informed consent.

2.2. Case Ascertainment. Patients with T1D were diagnosed by a physician on the basis of the following criteria: a fasting glycemia > 1.26 g/dL, an unexplained weight loss, signs of hyperglycemia (polyuria, polydipsia, polyphagia, and asthenia), and an absolute insulin dependence. These criteria were defined according to the recommendations of the American Diabetes Association [18].

2.3. Participant Eligibility. All participants have to be originated from Benin. Patients with T1D should be diagnosed before the age of 30 years. Any participant was excluded in the acute phase of a serious illness requiring care or having a set of medicine interfering with the insulin sensibility (corticoids, growth hormone, and so forth).

2.4. Participant Characteristics. During the period from November 2012 to January 2016, a total of 102 participants were recruited (23 males and 28 females; sex ratio = 1.21). Of these, 51 were diagnosed with T1D and 51 without T1D (Table 1).

2.5. HLA Class II Genotyping. Each participant was invited to provide a 10 mL EDTA tube of peripheral blood, which was frozen at -20[degrees] Celsius at the Laboratory of Human Biology of the Faculty of Health Sciences of the University of Abomey-Calavi. The DNA extraction was realized according to the single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction [19,20]. The DNA quality and its concentrations were determined by a Thermo Scientific Evolution 60S UV-Visible spectrophotometer.

HLA class II genotyping was performed with PCR-based sequence-specific primers (PCR-SSP) [21] in a 20 f L mixture of 6.5 f L of DNA (100 ng/[micro]L), 0.8 [micro]L of Mg[Cl.sub.2] (2 mM), 2 [micro]L of PCR buffer 1x, 2 [micro]L of each deoxynucleotide triphosphate (200 [micro]M), 4 [micro]L of forward primers (20 [micro]M), 4 [micro]L of reverse primers (20 [micro]M), and 0.7 [micro]L of polymerase Taq 0.175 U (Invitrogen). The process of DNA amplification is described as follows: the program of amplification contains an initial denaturation of 2 min in 94[degrees]C, 32 cycles of amplification (every cycle consists of a denaturation of 30 s in 94[degrees]C, a hybridization of primers during 30 s in 63[degrees]C, and an extension of 30 s in 72[degrees]C), and a final extension of 10 min in 72[degrees]C. The products of amplification were separated on a 2% agarose gel. The sequences of primers used for the amplification of the genes are presented in Table 2.

2.6. Statistical Analysis. Data were collected in the MS Excel 2007. The association between T1D and each identified HLA-DR/DQ alleles, haplotypes, and genotypes was assessed using an odds ratio (OR) with its 95% confidence interval (95% CI). The SAS software (version 9.1 SAS Institute Inc., Cary, NC, USA) was used to perform all statistical analyses.

3. Results and Discussion

3.1. Results. The association between T1D and specific HLA class II alleles, haplotypes, and genotypes was assessed using an odds ratio (Table 3). Significant associations were found between T1D and DR3 haplotype (OR= 13.3; 95% CI: 4.37-40.6), DQA1 * 05:01 (OR = 03; 95% CI: 1.37-6.55) and DQB1 * 02:01 (OR = 2.4; 95% CI: 1.06-5.31) alleles, and DR3-DR4 genotype (OR=12; 95% CI: 2.00-71.9). In contrast, no significant associations were found between T1D and DR4 haplotype (OR = 02; 95% CI: 0.64-6.24) and DQB1 * 03:02 (OR = 0.80; 95% CI: 0.27-2.07) and DQB1 * 06:02 (OR = 0.65; 95% CI: 0.22-1.82) alleles.

3.2. Discussion. The present study is a pilot one in Benin focusing on the association between T1D and HLA genotyping with the sequence-specific primers of DR3, DR4, DQA1 * 05:01, dQb1 * 02:01, dQb1 * 03:02, and DQB1 * 06:02. These preliminary data showed a light predominance of female sex. A similar result was found by Timoteo et al. [22]. In contrast, EURODIAB data showed 1.06 as the sex ratio in favor of male sex [23]. The analyses of HLA disease associations in different ethnic populations, due to differences in allele frequency distributions and patterns of linkage disequilibrium, can allow important general inferences of disease risk associated with specific alleles and with specific combinations of alleles. Then, T1D has been strongly associated with HLA class II alleles in a variety of populations. Beside the marginal protective effects of DQB1 * 03:02 and DQB1 * 06:02 alleles observed in this study, DR3 haplotype, DQA1 * 05:01, and DQB1 * 02:01 alleles, and DR3-DR4 genotype showed positive significant associations with T1D. These latter alleles, haplotypes, and genotypes might be seen as T1D risk markers. Our results also indicated that DR3 haplotype, DQA1 * 05:01 and DQB1 * 02:01 alleles, and DR3-DR4 genotype increased T1D risk by >2 to <14 times in Beninese.

These results, together, showed that there is a relationship between the presence of these HLA class II alleles, haplotypes, and genotypes and the risk of developing T1D in Beninese as in Caucasoid population [8]. Indeed, Fajardy et al. showed positive associations between DQA1 * 05:01 allele and the T1D onset among French children [24]. Similar results with DR3 haplotype and DQA1 * 05:01 allele were also reported in the Lithuanian [25], in the Brazilian [26], and in the Spanish [27] populations.

The T1D risk was not significantly associated with DR4 haplotype and DQB1 * 03:02 and DQB1 * 06:02 alleles in the present study. In contrast, it was reported in the literature that there were positive associations between T1D and DR4 haplotype [8] and DQB1 * 03:02 allele [8, 28]. A protective effect of DQB1 * 06:02 allele in T1D was also observed [29].

4. Conclusion

This study is one of the first to assess the associations of HLA class II alleles, haplotypes, and genotypes with the risk of developing T1D in Benin. Certain HLA class II alleles, haplotypes, and genotypes were related to T1D and may be used as genetic susceptibility markers to T1D. Further studies of HLA and T1D in Benin are needed to confirm the present results and to provide data for the development of screening assays and for better management of patients with T1D at the onset disease.

https://doi.org/10.1155/2017/6053764

Conflicts of Interest

The authors declare that there is no conflict of interests regarding the publication of this paper.

Acknowledgments

This study was financially supported by the UFR de Biologie Humaine of the Faculty of Health Sciences at the University of Abomey-Calavi. The authors thank all participants in this study, especially Drs. David Courtin and Nicaise N'DAM, researchers at IRD, for the gift of PCR primers.

References

[1] N. S. Wilcox, J. Rui, M. Hebrok, and K. C. Herold, "Life and death of beta cells in type 1 diabetes: a comprehensive review," Journal of Autoimmunity, vol. 71, pp. 51-58, 2016.

[2] M. A. Atkinson, G. S. Eisenbarth, and A. W. Michels, "Type 1 diabetes," Lancet, vol. 383, no. 9911, pp. 69-82, 2014.

[3] P. Onkamo, S. Vaananen, M. Karvonen, and J. Tuomilehto, "Worldwide increase in incidence of type I diabetes--the analysis of the data on published incidence trends," Diabetologia, vol. 42, no. 12, pp. 1395-1403, 1999.

[4] E. H. Hathout, N. Hartwick, O. R. Fagoaga et al., "Clinical, autoimmune, and HLA characteristics of children diagnosed with type 1 diabetes before 5 years of age," Pediatrics, vol. 111, no. 4, pp. 860-863, 2003.

[5] F. Djrolo, K. D. Amoussou-guenou, D. M. Zannou, D. Houinato, F. Ahouandogbo, and F. Houngbe, "Prevalence du diabete sucre au Benin," Louvain Medical, vol. 122, no. 6, pp. S256-S260, 2003.

[6] F. Djrolo, D. Houinato, A. Gbary, R. Akoha, O. Djigbenoude, and J. Segnon, "Prevalence of diabetes mellitus in the adult population at Cotonou, Benin," Medecine des maladies Metaboliques, vol. 6, no. 2, pp. 167-169, 2012.

[7] H. Erlich, A. M. Valdes, J. Noble et al., "HLA DR-DQ haplotypes and genotypes and type 1 diabetes risk: analysis of the type 1 diabetes genetics consortium families," Diabetes, vol. 57, no. 4, pp. 1084-1092, 2008.

[8] J. C. Ongagna, R. Sapin, M. Pinget, and A. Belcourt, "Markers for risk of type 1 diabetes in relatives of Alsacian patients with type 1 diabetes," International Journal of Experimental Diabetes Research, vol. 3, no. 1, pp. 1-9, 2002.

[9] A. K. Steck and M. J. Rewers, "Genetics of type 1 diabetes," Clinical Chemistry, vol. 57, no. 2, pp. 176-185, 2011.

[10] J. Fletcher, C. Mijovic, O. Odugbesan, D. Jenkins, A. R. Bradwell, and A. H. Barnett, "Trans-racial studies implicate HLA-DQ as a component of genetic susceptibility to type 1 (insulin-dependent) diabetes," Diabetologia, vol. 31, no. 12, pp. 864-870, 1988.

[11] S. Caillat-Zucman, H. J. Garchon, J. Timsit et al., "Age-dependent HLA genetic heterogeneity of type 1 insulin-dependent diabetes mellitus," The Journal of Clinical Investigation, vol. 90, no. 6, pp. 2242-2250, 1992.

[12] C. B. Sanjeevi, "HLA-DQ6-mediated protection in IDDM," Human Immunology, vol. 61, no. 2, pp. 148-153, 2000.

[13] A. Svejgaard, P. Platz, and L. P. Ryder, "HLA and disease 1982--a survey," Immunological Reviews, vol. 70, pp. 193-218, 1983.

[14] G. Thomson, "HLA DR antigens and susceptibility to insulin-dependent diabetes mellitus," American Journal of Human Genetics, vol. 36, no. 6, pp. 1309-1317, 1984.

[15] J. C. Mbanya, E. Sobngwi, and D. N. Mbanya, "HLA-DRB1, -DQA1, -DQB1 and DPB1 susceptibility alleles in Cameroonian type 1 diabetes patients and controls," European Journal of Immunogenetics, vol. 28, no. 4, pp. 459-462, 2001.

[16] T. H. Ottenhoff, M. Mengistu, G. Tadesse, R. R. De Vries, and P. J. Converse, "HLA-DR and DQ antigens in insulin-dependent diabetics in Ethiopia," Tissue Antigens, vol. 30, no. 5, pp. 193-197, 1987.

[17] M. J. MacDonald, O. O. Famuyiwa, I. A. Nwabuebo et al., "HLA-DR associations in black type I diabetics in Nigeria. Further support for models of inheritance," Diabetes, vol. 35, no. 5, pp. 583-589, 1986.

[18] A. American Diabetes, "Diagnosis and classification of diabetes mellitus," Diabetes Care, vol. 37, Supplement 1, pp. S81-S90, 2014.

[19] P. Chomczynski and N. Sacchi, "Single-step method of RNA isolation by acid guanidinium thiocyanate-phenolchloroform extraction," Analytical Biochemistry, vol. 162, no. 1, pp. 156-159, 1987.

[20] P. Chomczynski and N. Sacchi, "The single-step method of RNA isolation by acid guanidinium thiocyanate-phenolchloroform extraction: twenty-something years on," Nature Protocols, vol. 1, no. 2, pp. 581-585, 2006.

[21] P. A. Zalloua, H. Shbaklo, G. Halaby, H. Terwedow, X. Xu, and S. T. Azar, "Type-2 diabetes family history delays the onset of type-1 diabetes," The Journal of Clinical Endocrinology and Metabolism, vol. 87, no. 7, pp. 3192-3196, 2002.

[22] C. Timoteo, S. Castanhinha, C. Constant, B. Robalo, C. Pereira, and L. Sampaio, "Growth and puberty in type 1 diabetes mellitus - experience from a pediatric endocrinology unit," Acta Medica Portuguesa, vol. 25, no. 4, pp. 213-218, 2012.

[23] EURODIAB ACE Study Group, "Variation and trends in incidence of childhood diabetes in Europe," Lancet, vol. 355, no. 9207, pp. 873-876, 2000.

[24] I. Fajardy, C. Levy-Marchal, X. F. Gu, R. Krishnamoorthy, J. Elion, and P. Czernichow, "Respective weight of genotypes DQA1 and DQB1 associated with insulin-dependent diabetes in French children," Diabete & Metabolisme, vol. 18, no. 4, pp. 298-305, 1992.

[25] E. Skrodeniene, D. Marciulionyte, Z. Padaiga et al., "HLA class II alleles and haplotypes in Lithuanian children with type 1 diabetes and healthy children (HLA and type 1 diabetes)," Medicina (Kaunas, Lithuania), vol. 46, no. 8, pp. 505-510, 2010.

[26] C. Alves, I. Meyer, N. Vieira, M. B. Toralles, and D. LeMaire, "Distribution and frequency of HLA alleles and haplotypes in Brazilians with type 1 diabetes mellitus," Arquivos Brasileiros de Endocrinologia e Metabologia, vol. 50, no. 3, pp. 436-444, 2006.

[27] E. Urcelay, J. L. Santiago, H. d. l. Calle et al., "Type 1 diabetes in the Spanish population: additional factors to class II HLA-DR3 and -DR4," BMC Genomics, vol. 6, p. 56, 2005.

[28] O. Cinek, S. Kolouskova, M. Snajderova et al., "HLA class II genetic association of type 1 diabetes mellitus in Czech children," Pediatric Diabetes, vol. 2, no. 3, pp. 98-102, 2001.

[29] A. Pugliese, R. Gianani, R. Moromisato et al., "HLA-DQB1 * 0602 is associated with dominant protection from diabetes even among islet cell antibody-positive first-degree relatives of patients with IDDM," Diabetes, vol. 44, no. 6, pp. 608613, 1995.

Kaossarath A. Fagbemi, (1) Thierry C. Marc Medehouenou, (2) Simon Azonbakin, (1) Marius Adjagba, (1) Razack Osseni, (1) Jocelyne Ahoueya, (1) Arnaud Agbanlinsou, (1) Raphael Darboux, (1) Lamine Baba-Moussa, (3) Anatole Laleye (1)

(1) UFR de Biologie Humaine, Faculte des Sciences de la Sante, Universite d'Abomey-Calavi, Cotonou, Benin

(2) Laboratoire de Recherche en Biologie Appliquee, Ecole Polytechnique d'Abomey-Calavi, Universite d'Abomey-Calavi, Abomey-Calavi, Benin

(3) Laboratoire de Biologie et de Typage Moleculaire en Microbiologie, Universite d'Abomey-Calavi, Abomey-Calavi, Benin

Correspondence should be addressed to Kaossarath A. Fagbemi; komsarath@yahoo.fr

Received 28 February 2017; Revised 30 May 2017; Accepted 5 July 2017; Published 20 July 2017

Academic Editor: Daniela Foti
Table 1: Ages of study participants.

Age range   Patients with T1D   Controls
            n (%)               n (%)

<5          04 (7.8)            04 (7.8)
5-15        39 (76.5)           39 (76.5)
>15         08 (15.7)           08 (15.7)

Table 2: Sequences of the couples of primers used for the
amplification of the genes.

Primers              Sequences

HLA-DR3              Fw: 5'CACGTTTCTTGGAGTAC3'
                     Rv: 5'CGTAGTTGTGTCTGCAGTAGT3'
                     Fw: 5'CAGGTTAAACATGAGTGT
HLA-DR4              CATTTCTTAAAC3'
                     Rv: 5'GCTGTCGAAGCGCACGTACTCC
                     TCTTGGTG3'
HLA-DQA1 * 05:01     Fw: 5'ACGGTCCCTCTGGCCAGTA3'
                     Rv: 5'AGTTGGAGCGTTTAATCAGAC3'
HLA-DQB1 * 02:01     Fw: 5'GTGCGTCTTGTGAGCAGAAG3'
                     Rv: 5'GCAAGGTCGTGCGGAGCT3'
HLA-DQB1 * 06:02     Fw: 5'CGTGCGTCTTGTGACCAGAT3'
                     Rv: 5'GCTGTTCCAGTACTCGGCAT3'
HLA-DQB1 * 03:02/3   Fw: 5'GACGGAGCGCGTGCGTTA3'
                     Rv: 5'AGTACTCGGCGTCAGGCG3'
HLA-DQB1 * 03:03     Fw: 5'GACGGAGCGCGTGCGTTA3'
                     Rv: 5'CTGTTCCAGTACTCGGCGT3'

Fw: forward; Rv: reverse.

Table 3: Associations between T1D and HLA class II alleles,
haplotypes, and genotypes.

HLA alleles,                Participants          ORs (CI 95%)
haplotypes, and genotypes   Cases      Controls
                            (n = 51)   (n = 51)

DR3                         42         05         13.3 (4.37-40.6)
DR4                         15         11         02 (0.64-6.24)
DQB1 * 02:01                26         15         2.4 (1.06-5.31)
DQB1 * 03:02                16         18         0.75 (0.27-2.07)
DQB1 * 06:02                10         13         0.65 (0.22-1.82)
DQA1 * 05:01                35         19         03 (1.37-6.55)
DR3-DR4                     13         02         12 (2.00-71.9)
COPYRIGHT 2017 Hindawi Limited
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research Article
Author:Fagbemi, Kaossarath A.; Medehouenou, Thierry C. Marc; Azonbakin, Simon; Adjagba, Marius; Osseni, Raz
Publication:Journal of Diabetes Research
Article Type:Report
Geographic Code:6BENI
Date:Jan 1, 2017
Words:2682
Previous Article:Comment on "Prevalence and Risk Factors for Diabetic Lower Limb Amputation: A Clinic-Based Case Control Study".
Next Article:The Preferential Impairment of Pupil Constriction Stimulated by Blue Light in Patients with Type 2 Diabetes without Autonomic Neuropathy.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters