Printer Friendly

Global gene expression analysis in the livers of rat offspring perinatally exposed to low doses of 2,2',4,4'-tetrabromodiphenyl ether.

BACKGROUND: Polybrominated diphenyl ethers are a group of flame-retardant chemicals appearing increasingly in the environment. Their health effects and mechanisms of toxicity are poorly understood.

OBJECTIVES: We screened for the sensitive effects and mechanisms of toxicity of 2,2',4,4'-tetra-bromodiphenyl ether (BDE-47) by analyzing the gene expression profile in rats exposed to doses comparable to human exposure.

METHODS: Wistar dams were exposed to vehicle or BDE-47 (0.002 and 0.2 mg/kg body weight) every fifth day from gestation day 15 to postnatal day 20 by injections to caudal vein. Total RNA was extracted from the livers of pups and hybridized to the whole-genome RNA expression micro-arrays. The list of genes 2-fold differentially expressed was exported to PANTHER and Ingenuity Systems for analysis of enriched ontology groups and molecular pathways.

RESULTS: Oxidoreductase and transferase protein families were enriched in exposed rats as were these biological process categories: carbohydrate metabolism; electron transport; and lipid, fatty acid, and steroid metabolism. Four signaling pathways (cascades of activation of drug-metabolizing enzymes) and 10 metabolic pathways were significantly enriched. Drug-metabolizing enzymes appear to be regulated by BDE-47 through an aryl hydrocarbon receptor--independent mechanism. Direct interaction with retinoid X receptor or its upstream cascade may be involved. The main metabolic effects consisted of activation of metabolic pathways: [alpha]- and [omega]-oxidation of fatty acids, glycolysis, and starch hydrolysis.

CONCLUSIONS: Altered expression of genes involved in metabolic and signaling pathways and functions of the organism occurs after perinatal exposure of rat offspring to BDE-47 at doses relevant for the general population.

KEY WORDS: genomics, low dose, metabolic pathways, microarray, PBDE, P450. Environ Health Perspect 118:97-102 (2010). doi:10.1289/ehp.0901031 available via [Online 17 August 2009]


Polybrominated diphenyl ethers (PBDEs) are a group of flame-retardant chemicals added to synthetic polymers. The main concern about PBDE health effects in the general population relates to prenatal and neonatal exposure. Indeed, because of the high lipo-philicity of PBDEs and their long half-life in human tissues (Geyer et al. 2004), even small daily exposure throughout life leads to substantial PBDE accumulation in tissues with high lipid content (Johnson-Restrepo et al. 2005). Animal experiments and human evidence indicate that PBDE probably mobilizes during pregnancy, increasing the exposure of the developing organism via cord blood and then via milk (Antignac et al. 2008; Schecter et al. 2006). Moreover, children are exposed postnatally to higher PBDE doses because of higher rates of dust ingestion (Wilford et al. 2005) and higher food intake per kilogram of body weight (BW) (Schecter et al. 2006).

Experiments with animal models have shown that PBDE exposure interferes with developmental processes, causing endocrine (Darnerud 2008; Zhou et al. 2001), reproductive (Kuriyama et al. 2005; Lilienthal et al. 2006; Talsness et al. 2008), and neuro-developmental disruption (Kuriyama et al. 2005; Suvorov et al. 2008; Viberg et al. 2006). Few articles demonstrate a relationship between PBDE exposure and health outcomes in the general population (Lim et al. 2008; Main et al. 2007).

In spite of the significant number of experimental studies, the mechanisms of PBDE toxicity and the most susceptible end points remain largely unknown. The history of studies on another group of persistent and bio-accumulative organohalogens, polychlorinated biphenyls, shows that the mechanisms involved could be multiple and remain unclear despite the long period of intensive research with traditional methods (Suvorov and Takser 2008b). The rapidly developing "omics" technologies provide toxicology with high-throughput methods of screening for the molecular targets of toxicants (Henry et al. 2002) and could be used as the first step in studying emerging environmental contaminants. The development of the high-throughput screening approach corresponds to a major strategic shift in how government agencies assess chemical hazards and risks (Collins et al. 2008).

To our knowledge, full-genome gene expression microarrays have not been used to study PBDE toxicity in a developing mammal. In this study, we analyze the change in the global gene expression in liver tissue of rat offspring exposed prenatally to 2,2',4,4'-tetrabromodiphenyl ether (BDE-47), which is the most prevalent PBDE congener found in maternal milk (Schecter et al. 2003) and cord blood (Mazdai et al. 2003).

Material and Methods

Animals and treatment. We obtained nine timed pregnant Wistar rats (250-300 g; Charles River Laboratories, St. Constant, Quebec, Canada) on gestational day (GD) 14 and housed them in single plastic cages with a bedding of sawdust under regulated temperature (21 [+ or -] 2[degrees]C), relative humidity (50 [+ or -] 10%), and a 12-hr light/dark cycle. Food (Charles River Rodent chow 5075) and water were provided ad libitum. All animals received care in compliance with The Guide to the Care and Use of Experimental Animals (Canadian Council of Animal Care 1993), and the protocol was approved by our institutional animal research ethics review board.

We used the same protocol of exposure as in our previous study (Suvorov et al. 2008). In short, dams received intravenous caudal injections of BDE-47 (Chromatographic Specialties Inc., Brockville, Ontario, Canada) at doses of 0.002 (group 2; G2) and 0.2 mg/kg BW (group 3; G3) in 0.3 ml/kg BW of vehicle: ethanol 95%, Cremophor EL, and sterile water for injections (1:1:8, v/v) from GD15 to post-natal day (PND) 20 every 5 days (a total of six injections/dam). The vehicle was administered to control dams (group 1; Gl) according to the same protocol.

RNA preparation and microarray analysis. One male and one female pup were selected randomly per litter on PND 27 and sacrificed by decapitation. Whole livers were harvested from these pups, snap-frozen in liquid nitrogen, and stored at -80[degrees]C until RNA extraction. RNA was extracted with the RNeasy Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions.

RNA samples were processed for hybridization by the Functional Genomics Platform, a collaboration between McGill University and Genome Quebec Innovation Centre (McGill University, Montreal, Canada). RNA and cRNA quality control was performed with the Agilent (Agilent, Santa Clara, CA, USA) bioanalyzer. cRNA was prepared using the Illumina RNA amplification kit (Ambion, Austin, TX, USA). cRNA was biotynilated during the in vitro transcription reaction. cRNA was then hybridized to the whole-genome RNA expression BeadChips RatRef-12 (Illumina Inc., San Diego, CA, USA) containing 22,523 50-mer probes. The chips were scanned with the Illumina BeadArray Reader.

Data analysis. Data were analyzed using FlexArray 1.2 software (Blazejczyk et al. 2007). The row data were preprocessed and normalized with the lumi Bioconductor package (Du et al. 2007).

The expression values in log2 scale were analyzed with ANOVA, followed by a two-sample Bayesian t-test (Fox and Dimmic 2006) to identify differentially expressed genes. The false discovery rate (FDR) approach (Benjamini and Hochberg 1995) was used to correct for multiple testing. The list of genes 2-fold over- or underexpressed significantly (p [less than or equal to] 0.05; FDR corrected) was generated.

A two-sample Bayesian t-test with the FDR correction was run first to compare gene expression in male and female offspring. No differentially expressed genes (p [less than or equal to] 0.05) were observed; female and male data were pooled within exposure groups for subsequent analysis.

qRT-PCR. Quantitative real-time polymerization chain reaction (qRT-PCR) was performed to quantify gene expression to validate the gene expression data obtained from microarray analysis (Table 1). Total RNA were reverse transcribed using O1igo(dT)15 Primer (Promega, Madison, WI, USA) in the presence of Omniscript Reverse Transcriptase according to the Qiagen protocol (Omniscript RT kit; Qiagen). qRT-PCR was carried out with the Eppendorf RealPlex System (Eppendorf, Hamburg, Germany) according to the protocol for the TAKARA SYBR Green kit. All samples were run in triplicate reactions. Relative gene expression was analyzed according to the [2.sup.-[[DELTA][DELTA]Ct]] method (Livak and Schmittgen 2001). The housekeeping gene phosphofructokinase was used for normalization of the expression data. All the primers were designed using Primer-BLAST software (http://www.ncbi.nlm.nih. gov/tools/primer-blast/) and the Refseq RNA database [National Center for Biotechnology Information (NCBI) 2009a], and purchased from Integrated DNA Technologies, Inc. (Coralville, IA, USA).
Table 1. Gene expression changes verified by qRT-PCR.

          Expression fold-change (log2)

            Illumina          qRT-PCR

Gene ID  G2 (a)  G3 (b)  G2 (a)  G3 (b)  Sequence of primers
                                         used in qRT-PCR

AKR1B7   -1.48   -2.02   -1.36   -1.93   TAAGCCTGAGGACCCCGTAG


POR      -0.51   -1.39   -0.46   -1.20   ATCACCAACATGGGGGACTC


PER2     -1.05   -1.36   -1.21   -1.18   GCGGAAATGAAAACTGCTCC


CYP7A1   0.05    -1.29   0.13    -1.34   CGCGACAATATGTCCTGGAA


SLC3A2   1.03    0.63    1.00    0.49    GGACACCGAAGTGGACATGA


IGFBP2   0.48    1.02    0.62    1.17    TTACGCTGTTACCCCAACCC


CYP2C    0.49    1.05    0.35    1.30    AGGAAAAGCACAATCCGCAG


CLDN1    0.65    1.11    0.55    1.25    GGCTATGAGGGTCTTGGCTG


RHOA     0.57    1.22    0.71    1.41    CAAGGACCAGTTCCCAGAGG


CYP3A23  1.22    1.48    1.10    1.68    GAAAGGCAAACCTGTCCCTG


G6PC     1.52    1.50    1.65    1.63    CTACACCCTTTGCCAGCCTC


INSIG2   1.09    1.55    1.01    1.48    TGGCCCCTACATTTCCTCTG


Abbreviations: F, forward; R, reverse.

(a) Group exposed to 0.002 mg/kg BW BDE-47. (b) Group exposed to 0.2
mg/kg BW BDE-47.

Gene ontology and pathway analysis. The lists of genes expressed differently in response to BDE-47 exposure were imported into PANTHER (, and the number of genes in each functional classification category was compared against the number of genes from NCBI's Rattus norvegicus genome (NCBI 2009b) in that category. The binomial test was used to statistically determine overrepresentation of PANTHER classification categories. Bonferroni-corrected p-values < 0.05 were considered significant.

The same sets of genes were also imported into Ingenuity Pathway Analysis (IPA) (Ingenuity Systems Inc., Redwood City, CA, USA). Canonical pathway analysis identified canonical pathways from the IPA library that were most significant to the data set. The significance of the association between the data set and the canonical pathway was measured in two ways. First, a ratio of the number of genes from the data set that map to the pathway divided by the total number of genes that map to the canonical pathway was determined. Second, Fischer's exact test, followed by Benjamini--Hochberg (BH) multiple testing correction, was used to calculate a p-value determining the probability that the association between the genes in the data set and the canonical pathway can be accounted for by chance only.

Blood cholesterol and triglycerides analysis. Cholesterol and triglycerides were determined in trunk blood of pups sacrificed on PND 27. Analysis was performed at the Centre Hospitalier Universitaire de Sherbrooke (CHUS) Clinical Laboratory by Vitros 950 Chemistry System (Ortho-Clinical Diagnostics, Rochester, NY, USA).


We found no significant relationship between litter size and dose of exposure to BDE-47, with the number of pups varying from 10 to 17 per litter. No weight differences were observed between the control and exposed dams throughout the experiment. The BW of pups from both exposed groups increased; this finding is described in detail elsewhere (Suvorov et al. 2009).

Gene expression profile. Sixty genes were 2-fold differentially expressed (p [less than or equal to] 0.05; FDR corrected) in livers of the G3 rats [see Supplemental Material, Table 1, available online (doi:10.1289/ehp.0901031.Sl via http://dx.doi. org/)]: 22 were underexpressed and 38 were overexpressed. Twenty-one genes were 2-fold differentially expressed (p [less than or equal to] 0.05; FDR corrected) in G2: 3 were underexpressed and 18 were overexpressed. Monotonic dose-response relationships were observed for most of the genes 2-fold differentially expressed in both groups (Figure 1). The response of 6 genes appears to be nonlinear: 1 gene (LOC287167) was under-expressed, and 5 (SLC3A2, LOC497779, CYP2C7, LOC292539, PLDN_PREDICTED) were overexpressed in G2, whereas their expression in G3 was not significantly different from the control. Expression of 12 genes selected randomly was validated by qRT-PCR. A high correlation was observed between PCR and microarray data (Table 1).

PANTHER gene ontology analysis. Among molecular functions, the oxidoreductase protein family with oxygenase subfamily was enriched (p [less than or equal to] 0.05, Bonferroni corrected) in the livers of both groups of exposed rats (Table 2). The transferase family was significantly overrepresented in G3, and a similar trend was characteristic for G2.
Table 2. Gene ontology analysis using PANTHER.

                      0.002 mg/kg BW BDE-47   0.2 mg/kg BW BDE-47

Molecular function    No. of    p-Value (a)  No. of    p-Value (a)
                      genes                  genes

Transferase             3       9.07 x         9       5.86 x
                                [10.sup.-5]            [10.sup.-3]

Oxidoreductase          7       2.16 x        13       2.21 x
                                [10.sup.-5]            [10.sup.-7]

..Oxygenase             5       1.80 x         6       2.65 x
                                [10.sup.-5]            [10.sup.-4]

Biological process

..Carbohydrate          3       3.00 x         8       1.59 x
  metabolism                    [10.sup.-1]            [10.sup.-3]

..Electron transport    5       1.38 x         7       3.23 x
                                [10.sup.-4]            [10.sup.-4]

..Lipid, fatty acid,    9       1.28 x        12       9.37 x
  and steroid                   [10.sup.-7]            [10.sup.-6]

..Fatty acid            6       1.55 x         5       1.86 x
  metabolism                    [10.sup.-6]            [10.sup.-2]

..Steroid metabolism    4       4.39 x         7       1.76 x
                                [10.sup.-3]            [10.sup.-4]

..Steroid-hormone       2       1.79 x         4       1.96 x
  metabolism                    [10.sup.-1]            [10.sup.-3]

(a) Bonferroni corrected.

These PANTHER biological process categories were enriched in both exposed groups (Table 2): carbohydrate metabolism; electron transport; and lipid, fatty acid, and steroid metabolism. Within the limits of the last category, fatty acid and steroid metabolism were significantly overrepresented. Steroid-hormone metabolism was overrepresented within the limits of steroid metabolism category. The enrichment of carbohydrate metabolism and steroid-hormone metabolism in G2 was not significant but followed the same trend.

Ingenuity Pathway Analysis. We then used IPA to perform pathway analysis of the differentially expressed gene sets. Of the data set of 66 differentially expressed genes, 59 were mapped in Ingenuity Knowledge Base; 27 genes populated the functions/pathways category.

Fourteen canonical pathways were significantly enriched in the liver samples obtained from G2 and G3 (Table 3): 4 signaling pathways dealing mainly with activation of drug metabolizing enzyme cascade; 10 metabolic pathways including 4 pathways of lipid metabolism, 2 pathways of amino acid metabolism, 2 pathways of carbohydrate metabolism, 1 pathway of cofactor and vitamin metabolism, and 1 pathway of complex carbohydrate metabolism. Number of pathways were enriched because the same differentially expressed genes populated multiple pathways. The optimized set of pathways obtained after exclusion of most of overlapping pathways is shown in Figure 2 [see also Supplemental Material, Figure 1 (doi:10.1289/ehp.0901031.S1)].

Blood cholesterol and triglycerides. No significant difference was observed in triglycerides blood level in control and exposed pups on PND 27 (data not shown). Blood level of total cholesterol in G3 (adjusted for litter size, individual weight, and sex) was significantly higher than in Gl. No significant differences were observed between Gl and G2. Blood cholesterol coincided with underexpression of CYP7A1 in the same rats (Figure 3).


To our knowledge, this is the first study of PBDE effects on a mammal using high-throughput genomic methods. We obtained evidence of prolonged effects of perinatal exposure to low doses of BDE-47 on gene expression profile in the liver tissues of rat offspring. Significant 2-fold changes in gene expression were observed in pups 1 week after the last indirect (via milk) administration of BDE-47. The observed change in gene expression was dose dependent for the majority of altered genes. Multiple signaling and metabolic pathways were affected by BDE-47 or its metabolites in our study.

The protocol of exposure used in this study was designed to simulate exposure of the general population. In contrast to most published experimental studies of PBDE toxicity, we used an intravenous route of exposure for dams to assure the accuracy of internal dosing. As we used very low doses (the high dose used herein, 0.2 mg/kg BW, is among the lowest ever used in experimental studies), intravenous administration allowed avoiding uncertainty in the amount of BDE-47 received. In fact, the rat offspring studied in our experiments received BDE-47 via cord blood and via milk. As BDE-47 was previously detected in both human cord blood and milk (Frederiksen et al. 2009), the chosen route of administration has relevance for humans. The choice of doses in our study was verified by internal doses estimated earlier (Suvorov et al. 2008): BDE-47 concentrations in subcutaneous fat of the dams and pups 1 week after the last injection corresponds to the levels observed in the North American human population.

One of the major findings of the current study is the differential expression of phase I and II metabolic enzymes. This finding is supported by the enriched PANTHER molecular function categories (oxidoreductase and transferase) and biological process categories (electron transport) as well as the following significantly enriched canonical pathways according to IPA analysis: LPS/IL-1-mediated inhibition of retinoid X receptor (RXR) function; pregnane X receptor (PXR)/RXR activation; xenobiotic metabolism signaling; and metabolism of xenobiotics by cytochrome P450 (CYP). All these pathways overlap and partly describe the same cellular processes [see Supplementary Material (doi:10.1289/ehp.0901031.Sl)].

Because induction of cytochrome enzymes may alter numerous metabolic pathways and lead to the formation of oxygen radicals and/or carcinogens, the study of hepatic-enzyme induction has remained within the focus of experimental toxicology from the earliest PBDE studies. It has been demonstrated that both the commercial mixtures and BDE-47 congener induced phase I EROD (ethoxyresorufin-O-deethylase) and PROD (pentoxyresorufin-O-deethylase) and phase II metabolic enzyme activity (uridinediphosphate-glucuronosyltransferase) (Carlson 1980; Hallgren and Darnerud 1998; von Meyerinck et al. 1990; Zhou et al. 2001). In all these studies, however, the named induction was observed at levels of exposure exceeding many-fold environmental exposures (ranging usually from tens to hundreds of milligrams per kilogram BW).

In a study by Sanders et al. (2005), liver expression of CYP1A1, CYP2B, and CYP3A were analyzed after oral administration of DE-71 as well as individual congeners to adult rats on 3 consecutive days in doses ranging from 1.5 to 150 [micro]mol/kg BW/day. The cytochromes chosen were biomarkers for activation of aryl hydrocarbon receptor (AhR), constitutive androstane receptor (CAR), and PXR. The authors concluded that PBDEs, being non-coplanar organohalogens, are very poor AhR inducers and that most of previously reported AhR-inducing properties of PBDE mixtures can be explained by the presence of polybrominated dibenzofurans (PBDF) and polybrominated dibenzodioxins (PBDD) in the mixtures. However, the significant up-regulation of CYP2B and CYP3A by BDE-47 was also achieved at high doses of 4.9 and 49 mg/kg BW/day, respectively.

Similar conclusions concerning the role of PBDD and PBDF in activating AhR by low-grade purified BDE-47 were reported by Wahl et al. (2008) based on a study of AhR-mediated toxicity and gene expression in rat hepatoma cells and in zebrafish embryos. In addition, CYP2B and CYP3A were found to be overexpressed in this study.

Pacyniak et al. (2007) found that CYP3A11 and CYP2B10 (but not CYP1A1) were overexpressed in adult mice livers after 4 consecutive days of intraperitoneal injections of 10 and 100 [micro]mol of different congeners of PBDE (4.9 and 49 mg/kg/ BW/day for BDE-47). Because the two induced cytochromes are known target genes of PXR, the authors conclude that PBDE congeners are PXR activators. This conclusion was supported by luciferase assays, which showed that BDE-47, 99, and 209 activated PXR and its human counterpart, steroid X receptor, but not AhR.

Hence, the evidence obtained by several groups (Pacyniak et al. 2007; Sanders et al. 2005; Wahl et al. 2008) supports the idea that PBDE induces CYP by a mechanism other than AhR mediation. At the same time, induction of CYPs that are targets for receptors other than AhR receptors were also observed at the high doses of PBDE exposure.

According to our data, no CYPs were induced in the AhR pathway. Moreover, all three molecules, GSTM1, GSTA5 and ALDH9A1, differentially expressed downstream of AhR are also regulated through the CAR. It could be assumed, therefore, that AhR does not participate at all in PBDE-induced response.
Table 3. IPA generated canonical pathways significantly enriched in
liver samples obtained from rats perinatally exposed to BDE-47.

Ingenuity canonical          Log (BH      Ratio          Genes
pathways                     p-value)

Signaling pathways

  LPS/IL-1 mediated            1.22 x       7.10 x       ALDH9A1,
  inhibition of RXR function   [10.sup.-7]  [10.sup.-2]  CYP2C,

  PXR/RXR activation           3.60 x       1.30 x       CYP2C,
                               [10.sup.-7]  [10.sup.-1]  CYP2C7,
                                                         G6PC, GSTM1

  Xenobiotic metabolism        2.80 x       4.88 x       ALDH9A1,
  signaling                    [10.sup.-5]  [10.sup.-2]  CYP2C,

  AhR signaling                1.10 x       3.88 x       GSTM1,
                               [10.sup.-2]  [10.sup.-2]  NFIX,

Metabolic pathways

  Lipid metabolism Fatty acid  7.33 x       9.10 x       ALDH9A1,
  metabolism                   [10.sup.-6]  [10.sup.-2]  CYP2C,

  Arachidonic acid             3.96 x       6.94 x       CYP2C,
  metabolism                   [10.sup.-4]  [10.sup.-2]  CYP2C7,

  Bile acid biosynthesis       2.86 x       1.15 x       CYP3A23,
                               [10.sup.-3]  [10.sup.-1]  CYP7A1,

  Linoleic acid metabolism     1.42 x       5.56 x       CYP2C,
                               [10.sup.-2]  [10.sup.-2]  CYP3A23,

  Metabolism of cofactors and  2.80 x       8.10 x       CYP2C,
  vitamins Metabolism of       [10.sup.-5]  [10.sup.-2]  CYP2C7,
  xenobiotics by CYP                                     CYP3A23,

  Carbohydrate metabolism      8.29 x       7.70 x       G6PC, LDHA,
  Glycolysis/gluconeogenesis   [10.sup.-3]  [10.sup.-2]  ALDH9A1

  Propanoate metabolism        8.68 x       7.32 x       SOS, LDHA,
                               [10.sup.-2]  [10.sup.-2]  ALDH9A1

  Amino acid metabolism        8.60 x       5.88 x       ALDH9A1,
  Tryptophan metabolism        [10.sup.-4]  [10.sup.-2]  CYP2C,

  Cysteine metabolism          1.89 x       1.30 x       SDS,
                               [10.sup.-3]  [10.sup.-1]  SULT1B1,

  Metabolism of complex        8.68 x       7.14 x       G6PC,
  carbohydrates Starch and     [10.sup.-3]  [10.sup.-2]  UGT1A1,
  sucrose metabolism                                     SLC3A2

Six CYPs (CYP2C, CYP2C7, CYP3A23/3al, CYP4A1, CYP4A3, and CYP7A1) were 2-fold differentially expressed in our study (Table 3). According to current knowledge, these cytochromes are targets of several nuclear receptors. CAR may participate in the induction of CYP2C (Gerbal-Chaloin et al. 2002), CYP2C7 (Chen et al. 2003), and CYP3A23 (Sueyoshi and Negishi 2001). These three CYPs can be induced by PXR (Kliewer et al. 2002). CYP4A3 and CYP4A1 are known to be regulated by peroxisome proliferator-activated receptor alpha (PPAR[alpha]) (Kroetz et al. 1998). Finally, multiple mechanisms are involved in the control of CYP7A1 transcription, and a variety of transcription factors and nuclear receptors participate in the sophisticated regulatory networks (Gilardi et al. 2007), including PXR, liver X receptor alpha (LXR[alpha]), farnesoid X receptor, and CAR. The common feature of all these receptors is that they represent the dimerization partners for RXRs. In context of RXR pathway, a number of genes were significantly overexpressed at the smallest ever studied exposure doses of BDE-47, 0.002 mg/kg BW. The direct interaction of PBDE with RXR or upstream mechanisms of RXR induction cannot be excluded in light of this evidence. The possibility of direct interaction of xenobiotics with RXRs was recently demonstrated (Alsop et al. 2003; Li et al. 2008) as well as possibility of induction of PPAR and LXR pathways by RXR-selective ligands (le Maire et al. 2009; Mukherjee et al. 1997).

Regulation of several CYPs consistent with activation of PXR may affect concentrations of molecules important for the regulation of the physiological functions of an organism. Thus, according to the enriched PANTHER biological processes, steroid-hormone metabolism was altered in the rat offspring exposed to BDE-47, Two genes activated by PXR, CYP3A23 and UGT1A1, are involved in testosterone hydroxylation and glucuroni-dation, respectively. These reactions result in products that are more polar, water soluble, and more easily excreted from the body than the parent compound (Belanger et al. 2003). Increased testosterone excretion may be responsible for the impairment of sexual development observed in the PBDE-exposed rats, namely, decreased sperm count, feminization of sexually dimorphic behavior, and decreased anogenital distance in rat male offspring (Kuriyama et al. 2005; Lilienthal et al. 2006). The anogenital distance was significantly decreased on PND 66 in the male offspring exposed to 0.2 mg/kg BW BDE-47 from the same litters studied herein (Suvorov and Takser 2008a).

Activation of PXR may be responsible as well for down-regulation of CYP7A1, the rate-limiting enzyme of bile-acid biosynthesis from cholesterol, in G3. In G2, the same enzyme was slightly overexpressed. This nature of nonlinear dose-response expression of CYP7A1 is unclear and probably relates to the sophisticated network of receptors and transcription factors involved in its regulation (Gilardi et al. 2007).

The next major finding consists of activation of a number of metabolic pathways, including metabolism of lipids, carbohydrates, and amino acids. In fact, up-regulation of glucose-6-phosphate phosphatase (G6PC) causes uptake of glucose and its retention in cytoplasm. Overexpression of G6PC corresponds to the previously reported (Suvorov et al. 2009) observation of increased recovery rate of blood glucose levels after oral glucose administration in exposed rats compared with controls. SLC3A2, responsible for the starch hydrolysis with dextrin production, which hydrolyzes further into glucose, is overexpressed as well. Further, LOC500506 is upregulated. This gene is similar to another key enzyme, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which catalyzes the first reaction of the "payoff" phase of glycolysis. Two enzymes responsible for lactate transformation into acetyl-CoA are up-regulated as well. Finally, alternative [alpha] and CO pathways of oxidation of fatty acids are activated in the exposed groups of rats (Table 3). Alteration of carbohydrate metabolism genes, along with genes involved in proton transport, was shown recently in zebrafish embryonic fibroblasts after the treatment by 6-hydroxy-2,2', 4,4'-BDE-47 (van Boxtel et al. 2008). Activation of metabolic pathways corresponds to our previous finding (Suvurov et al. 2009) of increased growth and elevated blood 1GF-1 in rat offspring exposed to low doses BDE-47, using the same protocol as in the present study. In fact, IGF-1 and somatotropin are known to be powerful anabolism promoters (Scarth 2006). In this regard, it is interesting to mention that IGFBP2 was significantly overexpressed by 2-fold in liver of both groups of exposed rats. IGFBP-2 demonstrates cell-surface localization, and it has been suggested that membrane-associated IGFBP-2 may concentrate the IGFs in close vicinity of their receptors, thereby increasing their mitogenic potential (Chesik et al. 2007).


This study has revealed an alteration in gene expression involved in the metabolic and signaling pathways and functions of the organism after perinatal exposure of rat offspring to BDE-47 at doses relevant for general population. This analysis, based on genomic methods, yielded new information that can be used for generating a mechanistic hypothesis for further study of perinatal exposure of PDBE using traditional methods of toxicology.


Alsop D, Hewitt M, Kohli M, Brown S, Van Der Kraak G. 2003. Constituents within pulp mill effluent deplete retinoid stores in white sucker and bind to rainbow trout retinoic acid receptors and retinoid X receptors. Environ Toxicol Chem 22(12):2969-2976.

Antignac JP, Cariou R, Maume D, Marchand P, Monteau F, Zalko D, et al. 2008. Exposure assessment of fetus and newborn to brominated flame retardants in France: preliminary data. Mol Nutr Food Res 52(2):258-265.

Belanger A, Pelletier G, Labrie F, Barbier O, Chouinard S. 2003. Inactivation of androgens by UDP-glucuronosyltransferase enzymes in humans. Trends Endocrinol Metab 14 (0):473-479.

Benjamini Y, Hochberg Y. 1995. Controlling the false discovery rate: a practical and powerful approach to multiple testing. J R Stat Soc B 57:289-300.

Blazejczyk M, Miron M, Nadon R. 2007. FlexArray: a statistical data analysis software for gene expression microarrays. Genome Quebec, Montreal, Canada 2007 Available: http:// [accessed 10 May 2009].

Canadian Council on Animal Care. 1993. Guide to the Care and Use of Experimental Animals. Ottawa:Canadian Council on Animal Care.

Carlson GP. 1980. Induction of xenobiotic metabolism in rats by brominated diphenyl ethers administered for 90 days. Toxicol Lett 6:207-212.

Chen Y, Ferguson SS, Negishi M, Goldstein JA. 2003. Identification of constitutive androstane receptor and glucocorticoid receptor binding sites in the CYP2C19 promoter. Mol Pharmacol 64(2):316-324.

Chesik D, De Keyser J, Wilczak N. 2007. Insulin-like growth factor binding protein-2 as a regulator of IGF actions in CNS: implications in multiple sclerosis. Cytokine Growth Factor Rev 18(3-4):267-278.

Collins FS, Gray GM, Bucher JR. 2008. Toxicology. Transforming environmental health protection. Science 319(5865):906-907.

Darnerud PO. 2008. Brominated flame retardants as possible endocrine disrupters. Int J Androl 31 (2):152-160.

Du P, Kibbe WA, Lin S. 2007. Using lumi, a package processing lllumina Microarray. Available: http://bioconductor. org/packages/2.0/bioc/vignettes/lumi/inst/doc/lumi.pdf [accessed 10 May 2009].

Fox RJ, Dimmic MW. 2006. A two-sample Bayesian t-test for microarray data. BMC Bioinformatics 7:126.

Frederiksen M, Vorkamp K, Thomsen M, Knudsen LE. 2009. Human internal and external exposure to PBDEs--a review of levels and sources. Int J Hyg Environ Health 212(2):109-134.

Gerbal-Chaloin S, Daujat M, Pascussi JM, Pichard-Garcia L, Vilarem MJ, Maurel P. 2002. Transcriptional regulation of CYP2C9 gene. Role of glucocorticoid receptor and constitutive androstane receptor. J Biol Chem 277(1):209-217.

Geyer HJ, Schramm KW, Darnerud PO, Aune M, Feicht EA, Fried K, et al. 2004. Terminal elimination half-lives of the brominated flame retardants TBBPA, HBCD, and lower brominated PBDEs in humans. Organohalogen Compd 66:167.

Gilardi F, Mitro N, Godio C, Scotti E, Caruso D, Crestani M, et al. 2007. The pharmacological exploitation of cholesterol 7alpha-hydroxylase, the key enzyme in bile acid synthesis: from binding resins to chromatin remodelling to reduce plasma cholesterol. Pharmacol Ther 116(3):449-472.

Hallgren S, Darnerud PO. 1998. Effects of polybrominated diphenyl ethers (PBDEs), polychlorinated biphenyls (PCBs), and chlorinated paraffins (CPs) on thyroid hormone levels and enzyme activities in rats. Organohalogen Compd 35:391-394.

Henry CJ, Phillips R, Carpanini F, Corton JC, Craig K, Igarashi K, et al. 2002. Use of genomics in toxicology and epidemiology; findings and recommendations of a workshop. Environ Health Perspect 110:1047-1050.

Johnson-Restrepo B, Kannan K, Rapaport DP, Rodan BD. 2005. Polybrominated diphenyl ethers and polychlorinated biphenyls in human adipose tissue from New York. Environ Sci Technol 39(14):5177-5182.

Kliewer SA, Goodwin B, Willson TM. 2002. The nuclear pregnane X receptor: a key regulator of xenobiotic metabolism. Endocr Rev 23(5):687-702.

Kroetz DL, Yook P, Costet P, Bianchi P, Pineau T. 1998. Peroxisome proliferator-activated receptor alpha controls the hepatic CYP4A induction adaptive response to starvation and diabetes. J Biol Chem 273(47):31581-31589.

Kuriyama SN, Talsness CE, Grote K, Chahoud I. 2005. Developmental exposure to low dose PBDE 99: effects on male fertility and neurobehavior in rat offspring. Environ Health Perspect 113:149-154.

le Maire A, Grimaldi M, Roecklin D, Dagnino S, Vivat-Hannah V, Balaguer P, et al. 2009. Activation of RXR-PPAR heterodimers by organotin environmental endocrine disruptors. EMBO Rep 10(4):367-373.

Li J, Ma M, Wang Z. 2008. A two-hybrid yeast assay to quantify the effects of xenobiotics on retinoid X receptor-mediated gene expression. Toxicol Lett 176(3):198-206.

Lilienthal H, Hack A, Roth-Harer A, Grande SW, Talsness CE. 2006. Effects of developmental exposure to 2,2', 4,4',5-pentabromodiphenyl ether (PBDE-99) on sex steroids, sexual development, and sexually dimorphic behavior in rats. Environ Health Perspect 114:194-201.

Lim JS, Lee DH, Jacobs DR Jr. 2008. Association of brominated flame retardants with diabetes and metabolic syndrome in the U.S. population, 2003-2004. Diabetes Care 31(9):1802-1807.

Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the [MATHEMATICAL EXPRESSION NOT REPRODUCIBLE IN ASCII] Method. Methods 25(4):402-408.

Main KM, Kiviranta H, Virtanen HE, Sundqvist E, Tuomisto JT, Tuomisto J, et al. 2007. Flame retardants in placenta and breast milk and cryptorchidism in newborn boys. Environ Health Perspect 115:1519-1526.

Mazdai A, Dodder NG, Abernathy MP, Hites RA. Bigsby RM. 2003. Polybrominated diphenyl ethers in maternal and fetal blood samples. Environ Health Perspect 111:1249-1252.

Mukherjee R, Davies PJ, Crombie DL, Bischoff ED, Cesario RM, Jow L, et al. 1997. Sensitization of diabetic and obese mice to insulin by retinoid X receptor agonists. Nature 386(6623):407-410.

NCBI (National Center for Biotechnology Information). 2009a. RefSeq. Available:[accessed 4 December 2009].

NCBI (National Center for Biotechnology Information). 2009b. Pubmed. Available:[accessed4December2009].

Pacyniak EK, Cheng X, Cunningham ML, Crofton K, Klaassen CD, Guo GL. 2007. The flame retardants, polybrominated diphenyl ethers, are pregnane X receptor activators. Toxicol Sci 97(1):94-102.

Sanders JM, Burka LT, Smith CS, Black W, James R, Cunningham ML. 2005. Differential expression of CYP1A, 2B, and 3A genes in the F344 rat following exposure to a polybrominated diphenyl ether mixture or individual components. Toxicol Sci 88(1):127-133.

Scarth JP. 2006. Modulation of the growth hormone-insulin-like growth factor (GH-IGF) axis by pharmaceutical, nutra-ceutical and environmental xenobiotics: an emerging role for xenobiotic-metabolizing enzymes and the transcription factors regulating their expression. A review. Xenobiotica 36(2-3):119-218.

Schecter A, Papke O, Harris TR, Tung KC, Musumba A, Olson J, et al. 2006. Polybrominated diphenyl ether (PBDE) levels in an expanded market basket survey of U.S. food and estimated PBDE dietary intake by age and sex. Environ Health Perspect 114:1515-1520.

Schecter A, Pavuk M, Papke O, Ryan JJ, Birnbaum L, Rosen R. 2003. Polybrominated diphenyl ethers (PBDEs) in U.S. mothers' milk. Environ Health Perspect 111:1723-1729.

Sueyoshi T, Negishi M. 2001. Phenobarbital response elements of cytochrome P450 genes and nuclear receptors. Annu Rev Pharmacol Toxicol 41:123-143.

Suvorov A, Battista M-C, Takser L 2009. Perinatal exposure to low-dose 2,2',4,4'-tetrabromodiphenyl ether affects growth in rat offspring: what is the role of IGF-1? Toxicology 260(1-3):126-131.

Suvorov A, Girard S, Lachapelle S, Abdelouahab N, Sebire G, Takser L. 2008. Perinatal exposure to low-dose BDE-47, an emergent environmental contaminant, causes hyperactivity in rat offspring. Neonatology 95(3):203-209.

Suvorov A, Takser L. 2008a. Brominated flame retardants: emerging developmental endocrine disruptors calling for risk assessment (Abstract). Am J Obstet Gynecol 197(6):129.

Suvorov A, Takser L. 2008b. Facing the challenge of data transfer from animal models to humans: the case of persistent organohalogens. Environ Health 7:58.

Talsness CE, Kuriyama SN, Sterner-Kock A, Schnitker P, Grande SW, Shakibaei M, et al. 2008. In utero and lactational exposures to low doses of polybrominated diphenyl ether-47 alter the reproductive system and thyroid gland of female rat offspring. Environ Health Perspect 116:308-314.

van Boxtel AL, Kamstra JH, Cenijn PH, Pieterse B, Wagner JM, Antink M, et al. 2008. Microarray analysis reveals a mechanism of phenolic polybrominated diphenylether toxicity in zebrafish. Environ Sci Technol 42(5):1773-1779.

Viberg H, Johansson N, Fredriksson A, Eriksson J, Marsh G, Eriksson P. 2006. Neonatal exposure to higher brominated diphenyl ethers, hepta-, octa-, or nonabromodiphenyl ether, impairs spontaneous behavior and learning and memory functions of adult mice. Toxicol Sci 92(1):211-218.

von Meyerinck L, Hufnagel B, Schmoldt A, Benthe HF. 1990. Induction of rat liver microsomal cytochrome P-450 by the pentabromo diphenyl ether Bromkal 70 and half-lives of its components in the adipose tissue. Toxicology 61(3):259-274.

Wahl M, Lahni B, Guenther R, Kuch B, Yang L, Straehle U, et al. 2008. A technical mixture of 2,2',4,4'-tetrabromo diphenyl ether (BDE47) and brominated furans triggers aryl hydrocarbon receptor (AhR) mediated gene expression and toxicity. Chemosphere 73(2):209-215.

Wilford BH, Shoeib M, Harner T, Zhu J, Jones KC. 2005. Polybrominated diphenyl ethers in indoor dust in Ottawa, Canada: implications for sources and exposure. Environ Sci Technol 39(18):7027-7035.

Zhou T, Ross DG, DeVito MJ, Crofton KM. 2001. Effects of short-term in vivo exposure to polybrominated diphenyl ethers on thyroid hormones and hepatic enzyme activities in weanling rats. Toxicol Sci 61(1):76-82.

Alexander Suvorov and Larissa Takser

Departement Obstetrique Gynecologie, Faculte de Medecine et des Sciences de la Sante, Universite de Sherbrooke, Sherbrooke, Quebec, Canada

Address correspondence to A. Suvorov, Departement Obstetrique Gynecologic Faculte de Medecine et des Sciences de la Sante, Universite de Sherbrooke, 3001, 12e Avenue Nord, Sherbrooke, Quebec, Canada J1H 5N4. Telephone: (819) 820-6868, ext. 12792. Fax: (819) 820-6434. E-mail: Alexander.

Supplemental Material is available online (doi:10.1289/ehp.0901031.S1 via

This study was supported by Foundation of Stars, a nongovernmental funding source for pediatric research. L. Takser is supported by the Canadian Institute of Health Research (CIHR) New Investigator Award and is a member of Centre de recherche clin-ique Etienne-Le Bel supported by Fonds de Recherche en Sante du Quebec (FRSQ).

The authors declare they have no competing financial interests.

Received 15 May 2009; accepted 17 August 2009.
COPYRIGHT 2010 National Institute of Environmental Health Sciences
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2010 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research
Author:Suvorov, Alexander; Takser, Larissa
Publication:Environmental Health Perspectives
Article Type:Report
Geographic Code:1CANA
Date:Jan 1, 2010
Previous Article:Coumaphos exposure and incident cancer among male participants in the Agricultural Health Study (AHS).
Next Article:Oseltamivir carboxylate, the active metabolite of oseltamivir phosphate (Tamiflu), detected in sewage discharge and river water in Japan.

Related Articles
Tox/Path team takes on differential gene expression.
Microarrays demystified.
Hexachlorobenzene exposure: widespread toxicant produces pervasive effects.
Supervised sorting: training computers to classify toxicants.
Endocrine disruption and flame-retardant chemicals: PBDE-99 effects on rat sexual development.
Global gene expression associated with hepatocarcinogenesis in adult male mice induced by in utero arsenic exposure.
PFOA alters liver gene expression.
Chronic drinking more harmful for liver than acute or binge drinking.
Perinatal exposure to bisphenol A alters early adipogenesis in the rat.
Chronic dietary exposure to a low-dose mixture of genistein and vinclozolin modifies the reproductive axis, testis transcriptome, and fertility.

Terms of use | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters