Printer Friendly

Ginsenoside Rg1 of Panax ginseng stimulates the proliferation, odontogenic/osteogenic differentiation and gene expression profiles of human dental pulp stem cells.

Introduction

Dental pulp plays an important role in the reparative regeneration of tooth tissue. When a tooth injury, dental pulp is involved in reparative dentinogenesis and deposits a new dentin matrix to repair the injured site (Renjen et al. 2009). This is possible because of the presence of progenitor/stem cells in the dental pulp, which are able to form odontoblasts under appropriate microenviron-ments (Hao et al. 2004). Conventional root canal therapy depends on the removal of inflamed or necrotic pulp tissue and subsequent restoration with the insertion of a synthetic material into the root canal system, resulting in the loss of physiological form and function of the dental pulp (Bluteau et al. 2008). Complications such as root fractures can occur especially in teeth with incomplete root formation. Tissue engineering is leading to a great interest in biologic regeneration of damaged dental tissues. Regenerative dentin and pulp are expected to be potential tools for endodontic therapy, although technical problems need to be solved before they can be implemented in clinical applications (Cordeiro et al. 2008). Cells, scaffolds, and bioactive molecules are needed for tooth regeneration (Hung et al. 2011; Nakashima and Akamine 2005). Dental pulp tissue has been recently demonstrated to contain a population of postnatal stem cells (Gronthos et al. 2000, 2002). Gronthos et al. discovered dental pulp stem cells (DPSCs) with properties which are very similar to those of mesenchymal stem cells (MSCs). DPSCs possess stem cell-like properties, including self-renewal capability and multilineage differentiation. They can proliferate and differentiate into odontoblast-like cells under appropriate conditions (Gronthos et al. 2000). DPSCs are considered to be a potential source of cell-based therapy for developing a regenerative endodontic therapy and play an important role in tooth tissue engineering (Caller et al. 2011; Yamada et al. 2010).

Panax ginseng C. A. Mey is a tonic drug in traditional Chinese medicine and has been safely used in China for over 2000 years. Ginsenosides are the major active components of Panax ginseng C A. Mey. Ginsenoside Rgl, abundant in Panax ginseng C. A. Mey, belongs to a family of steroids named steroidal saponins (Attele et al. 1999). It is one of the most active ingredients in Panax ginseng C. A. Mey and has a broad range of activities. Researches indicated that ginsenoside Rgl could enhance bone marrow stromal cells and endothelial progenitor cells proliferation (Lu et al. 2008; Shi et al. 2009). Recent studies stated that ginsenosides Rgl increased the number of osteoblasts, the activity of alkaline phosphatase (ALP) in cultured osteoblasts, increase bone formation while prevented ovariectomized rats bone loss (Gong et al. 2006; Shen et al. 2010). These findings indicated the potential use of ginsenoside Rgl in endodontic biotherapy, reparative dentin formation and tooth tissue engineering.

To understand the behavior of ginsenoside Rgl in dentin formation and reparation, in this study, we investigated the effects of ginsenoside Rg1 on DPSCs proliferation and differentiation into odontoblasts in vitro, and attempted to reveal the underlying mechanism by using microarray to identify the differentially expressed genes in DPSCs treated by ginsenoside Rg1.

Materials and methods

Cell culture

Fifty-nine healthy human impacted third molars were collected from adults (19-28 years old) in the Department of Oral and Maxillofacial surgery, the First Affiliated Hospital of Chongqing Medical University. The Human Ethical Committee of the First Affiliated Hospital of Chongqing Medical University approved our experimental protocols and informed consent was obtained from all subjects. DPSCs were isolated and cultured as previously described (Gronthos et al. 2000, 2002). Briefly, the pulp was separated from the crowns and roots, minced into small pieces, and then digested in a solution of 3mg/ml collagenase type I (Sigma, USA) and 4mg/ml dispase (Sigma, USA) for 30 min to one hour at 37[degrees]C. Single-cell suspensions were obtained by passing these cells through a 70 [mu]m strainer and cells were then cultured in 6-well plates (Costar, Corning, USA) at a density of 1 * 10[.sup.4] cells per well with alpha modification of Eagle's medium ([alpha]-MEM, Hyclone. USA) supplemented with 10% fetal bovine serum (FBS, Hyclone, USA), 100 units/ml penicillin and 100 [mu]g/ml streptomycin (Sigma, USA) at 37[degrees]C under 5% CO[.sub.2] condition. Culture medium was changed every 3 days. Cells at passages 3 or 4 were used for further experiments.

Proliferative ability assays

To investigate the proliferative ability of DPSCs after the treatment of different concentrations of ginsenoside Rg1 (0.1, 0.5, 2.5, 5, 10 and 20 [mu]mol/l), DNA synthesis assay and flow cytometry analysis were applied. Ginsenoside Rgl (purity [greater than or equal to] 95%) was purchased from the Hongjiu biotechnology limited company (Jilin, China). The chemical structure of ginsenoside Rgl is shown in Fig. 1.

DNA synthesis assay

DNA synthesis was investigated by [[.sup.3]H]-thymidine incorporation assay (Balloni et al. 2009). DPSCs were seeded in 96-welI plates containing growth medium at a density of 1 * 10[.sup.4] cells per well and cultured until 70-80% confluence. Then cells were treated with [alpha]-MEM medium containing 10% FBS with different concentrations of ginsenoside Rg1 (0.1, 0.5, 2.5, 5, 10, and 20 [mu]mol/l) for 72 h. Control cultures received the same volume of culture medium without ginsenoside Rg1. During the last 8h of incubation, 0.25 [mu]Ci/well of [[.sup.3]H]-thymidine (Amersham Biosciences, Little Chalfont, United Kingdom) was added. [[.sup.3]H]-thymidine incorporation was determined using a liquid scintillation counter (Wallac, Turku, Finland). The assay was performed in three independent experiments.

Cell cycle analysis

Cells were harvested after 3 days of being cultured in [alpha]-MEM medium containing 10% FBS and 5 [mu]mol/l ginsenoside Rg1. and fixed in 70% ethanol at 4[degrees]C overnight. Then cells were washed twice with 0.05 M PBS (pH 7.4), stained with propidium iodide (PI) at room temperature for 30 min, and analyzed by flow cytometry using CellQuest software for cell cycle analysis.

Odontogenic differentiation assays

To evaluate the odontogenic differentiation of DPSCs after the treatment of ginsenoside Rg1 at a concentration of 5 [mu]mol/1, immunocytochemistry analysis of dentin sialoprotein (DSP) and FQ-PCR for gene expressions of dentin sialophosphoprotein (DSPP), alkaline phosphatase (ALP) and osteocalcin (OCN) were performed.

Immunocytochemistry analysis of dentin sialoprotein (DSP)

DPSCs were seeded in 24-well plates with cover slip on the bottom at a density of 1 * 10[.sup.4] cells per well and cultured in [alpha]-MEM medium containing 10% FBS and final concentration of ginsenoside Rg1 at 5 [mu]mol/1. Controls were cultured in [alpha]-MEM with 10% FBS. The medium was changed every 3 days, and the cultures were maintained for 14 days. Cells were fixed with 4% formalin for 20 min, washed in phosphate-buffered saline (PBS), treated with 3% hydrogen peroxide for 10 min, washed and blocked with 5% normal goat serum for 30 min. Then specimens were incubated with primary antibodies (DSP) (Santa Cruz, 1:250 dilution) for 1 h at room temperature. The secondary antibody (biotinylated goat anti-mouse IgG) was added for 1 h at 37[degrees]C. After washing, streptavidin-peroxidase complex was added and incubated for 30 min at 37[degrees]C followed by washing and the addition of diaminobenzidine (DAB) staining solution for 5 min. Specimen were counterstained with Mayer's hematoxylin solution (Sigma, USA) and mounted with neutral resin. Normal saline instead of the primary antibody was served as the negative control.

Gene expression analysis of DSPP, ALP and OCN

The gene expression of dentin sialophosphoprotein (DSPP), alkaline phosphatase (ALP) and osteocalcin (OCN) was analyzed using fluorescent quantitative reverse transcriptase-polymerase chain reaction (FQ-PCR). After DPSCs were incubated with different medium for 7, 14 and 21 days, respectively, total RNA was extracted from cells by using the Trizol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. Total RNA samples were reverse-transcribed into cDNA using a reverse-transcription kit. FQ-PCR was performed by using an ABI 7300 sequence detection system (Applied Biosystems, Foster City, CA) with SYBR Green reagent (Promega, USA). The primers for gene amplification were shown in Table 1. The reaction mixtures were incubated in a thermal cycle at 94[degrees]C for 2 min, followed by 40 cycles at 94[degrees]C for 15 s, 57[degrees]C for 10 s (DSPP and OCN), or 58[degrees]C for 15 s (ALP). 72[degrees]C for 30 s, and a final extension at 72[degrees]C for 2 min. Measured mRNA levels were normalized to the mRNA copies of GAPDH. All assays were repeated at least three times.

Table 1 Primer sequences used in fluorescent Quantitative RT-PCR.

Gene   Primers

DSPP   Forward: 5' AATGCTGGAGCCACAAAC 3'
       Reverse: 5' GCTTCCTTAGTCCCATTTC 3'

ALP    Forward: 5' GAGCAGGAACAGAACTTTCC 3'
       Reverse: 5' GTTCCAGCCTCTGGAGAGTA 3'

OCN    Forward: 5' CAAAGGTGCAGCCTTTCTGTC 3'
       Reverse: 5' TCACAGTCCGGATTGAGCTCA 3'

BMP-2  Forward: 5' GCCACCCGAGCCAACAC 3'
       Reverse: 5' MATTAAAGAATCTCCGGGTTGT 3'

FCF2   Forward: 5' CCCGACGGCCGAGTTGAC 3'
       Reverse: 5' TTCATAGCCAGGTAACGGTTAGC 3'

CAPDH  Forward: 5' AGTCCACTGGCGTCTTCA 3'
       Reverse: 5' CGGACTTCTCATGGTTCACAC 3'


Determination the gene expression of bone morphogenetic protein-2 (BMP-2) and fibroblast growth factor 2 (FGF2)

The method of FQ-PCR to detect the gene expression of BMP-2 and FGF2 was previously described. After DPSCs were incubated with different medium for 3, 7 and 14 days, respectively, the samples were collected. The primers for gene amplification were also shown in Table 1. The reaction mixtures were incubated in a thermal cycle at 94[degrees]C for 2 min, followed by 40 cycles at 94[degrees]C for 15 s, 58[degrees]C for 15 s, 72[degrees]C for 30 s, and a final extension at 72[degrees]C for 2 min. All assays were repeated at least three times.

Determination the protein expression of bone morphogenetic protein-2 (BMP-2) and fibroblast growth factor 2 (FGF2)

DPSCs (1 * 10[.sup.4] cells/well) were seeded in 24-well plates and cultured for 24 h. The cells were treated with a-MEM medium containing 10% FBS with 5[mu]mol/l ginsenoside Rg1. Medium without ginsenoside Rg1 served as a control. After 3, 7, and 14 days of incubation, culture supernatant was collected and stored at -20[degrees]C. The amounts of BMP-2 and FGF2 were determined by enzyme-linked immunosorbent assay (ELISA) kits (R82D System, Minneapolis, USA) according to the manufacturers' instructions. The assay was performed in three independent experiments.

Gene expression profile microarray analysis

Gene expression in the experimental group and control group of DPSCs was investigated with the Roche Nimblegen Whole Human Genome Expression profile microarray (Roche Nimblegen, USA) system consisting of 44,049 genes. Total RNA was extracted from cells by using the Trizol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. RNA quantity and purity were determined using the Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) and denaturing gel electrophoresis. Microarray experiment was performed in triplicate according to the manufacture protocol. In brief, total RNA samples (5 mg) were amplified and reverse-transcribed into cDNA using a reverse-transcription kit. The synthesized cDNA was labeled with Cy3 dye using a NimbleGen One-Color DNA Labeling Kit. After purification, the labeled cDNA was applied to a Roche Nimblegen Whole Human Genome Expression profile microarray (Roche Nimblegen, USA) and then hybridized in NimbleGen Hybridization System at 60[degrees]C for 17 h. After hybridization and washing, the microarray was scanned on Axon GenePix 4000B microarray scanner (Molecular Devices, USA). Then the scanned image was analyzed and normalized using NimbleScan software. The standard to judge the differentially expressed genes was the ratio of the experimental group and control group [greater than or equal to]2. The differentially expressed genes were classified with gene ontology (GO) analysis according to their functions. Pathway analysis was used to select the statistically significant pathways. The gene expression profiling data complied with the Minimum Information About Microarray Experiments (MIAME) standard (Brazma et al. 2001).

Statistical analysis

The quantitative data were presented as means [+ or -] standard deviation. The results were analyzed by one-way analysis of variance (analysis for DNA Synthesis Assay), factorial design analysis of variance (analysis for EL1SA and FQ-PCR), multivariate analysis of variance (analysis for cell cycle) and multiple comparisons (SNK-q test). Statistical analysis was performed using SPSS statistical software (version 12.0, SPSS Inc., Chicago, IL, USA). Values of pLess than 0.05 were considered to be statistically significant.

Results

DNA synthesis assay

The [[.sup.3]H]-thymidine incorporation assay was used to demonstrate DPSCs proliferation after 72 h incubation with varying concentrations of ginsenoside Rg1 (Table 2). Comparing with the control group, ginsenoside Rg1 significantly promoted the proliferation of DPSCs at concentrations of 0.5, 2.5, 5, and 10 [mu]mol/l, especially 5 [mu]mol/1 (pLess than0.05).

Table 2 [[.sup.3]H]-Thymidine incorporation assay.

Group                  Concentrations   [[.sup.3]H]-TdR
                       of ginsenoside   incorporation value
                       Rg1 ([mu]mol/l)

Control group          0                400.87 [+ or -] 9.17

Ginsenoside Rg1 group  0.1              409.61 [+ or -] 9.31

                       0.5              891.38 [+ or -] 7.17(a)

                       2.5              1045.35 [+ or -] 28.18(a)

                       5                2023.29 [+ or -] 24.48
                                        (a) (b)

                       10               1055.35 [+ or -] 33.91(a)

                       20               417.04 [+ or -] 11.58

Data were presented as the means [+ or -] SD. n = 6.
(a) Compared with control group, p Less than 0.05.
(b) Compared with 0.5, 2.5 and 10 [mu]mol/l ginsenoside Rg1 group,
p Less than 0.05. One-way analysis of variance and multiple
comparisons [SNK-q test].


Cell cycle analysis

The effect of ginsenoside Rg1 on cell cycle distribution of DPSCs was determined by flow cytometry (Table 3). It was shown that 5 [mu]mol/l ginsenoside Rg1 significantly increased the proportion of cells in the proliferative phase (S phase) while decreased the cells in the resting phase (G[.sub.0]/G[.sub.1] phase) (pLess than0.05). The proliferation index (PrI) was also advanced compared with control group (p Less than 0.05).

Table 3 Effect of ginsenoside Rg1 on cell cycle distribution of DPSCs.

Group                  G[.sub.0]/G[.sub.1] phase

Control group          85.74 [+ or -] 2.45

Ginsenoside Rg1 group  65.13 [+ or -] 1.47(a)

G[.sub.2]/M phase            S phase

7.36 [+ or -] 1.80           6.90 [+ or -] 2.43

13.67 [+ or -] 0.96[.sup.a]  21.20 [+ or -] 2.11(a)

Prl(S + G[.sub.2]/M)

14.26 [+ or -] 2.44

34.87 [+ or -] 1.47(a)
Data were presented as the means [+ or -] SD. n = 6.
(a) Compared with control group, p Less than 0.05. Multivariate
analysis of variance.


Immunocytochemistry analysis of DSP

After 14 days of ginsenoside Rg1 treatment on DPSCs, odontogenic differentiation of DPSCs was shown by the positive immunostaining of DSP in ginsenoside Rg1 group (Fig. 2).

Protein expression of bone morphogenetic protein-2 (BMP-2) and fibroblast growth factor 2 (FCF2)

BMP-2 and FGF2 secretions were evaluated by incubating DPSCs in the presence of 5 [mu]mol/l ginsenoside Rg1. The culture supernatants were collected for quantification of protein level at 3, 7 and 14days, respectively. At day 7 of incubation, ginsenoside Rg1 significantly enhanced BMP-2 expression by around 2.7 times compared with the untreated group. At days 14 of incubation, ginsenoside Rg1 significantly stimulated BMP-2 expression by 3.5 times compared with the untreated group (pLess than0.05) (Fig. 3a). At 3, 7 and 14 days, ginsenoside Rg1 significantly stimulated FGF2 secretions by 2 times, 3 times and 3.5 times compared with the untreated group, respectively (pLess than0.05) (Fig. 3b).

Expression of DSPP, ALP, OCN, BPM-2 and FGF2 mRNA

The expressions of DSPP, ALP, OCN, BMP-2 and FGF2 mRNA in the ginsenoside Rg1 group (5 [mu]mol/l) showed a time-dependent increase compared with the control group (pLess than0.05), which remained little change in the period (Fig. 4).

Gene expression profile microarray analysis

The Roche Nimblegen Whole Human Genome Expression profile microarray was used to compare representative gene expression profiles of DPSCs in theginsenoside Rgl (5 [mu]mol/l) groupand control group. The results indicated that 2059 differentially expressed genes out of 44,049 genes were detected between the ginsenoside Rg1 (5 [mu]mol/l) group and control group of 2.0-fold or more. There were 1498 up-regulated genes and 561 down-regulated genes in the ginsenoside Rgl (5 [mu]mol/l) group of 2.0-fold or more. The top thirty up-regulated genes and down-regulated genes were listed in Supplementary Tables 1 and 2, respectively. The most statistically significantly represented GO terms were displayed in Table 4. Gene ontology categories showed that these genes were mainly associated with cell cycle, cellular metabolism, biosynthetic process, signal transduction, growth factor, cell proliferation and apopto-sis of functional gene categories. Table 5 shows the statistically enriched KEGG pathway terms for differentially expressed genes. Pathway analysis found seven statistically significant pathways including cell cycle pathway, MAPK signal pathway and TGF [beta] signal pathway (p Less than 0.05).

Table 4 Gene ontology analysis.

Gene ontology: biological  Genes                             p-Value
process terms

Cell cycle                 CCNB1, CCNB2, MNAT1, CDC2,        2.7 E-14
                           CDKN 1 A, CDKN3, CDKN2A,
                           ANAPC1, CDK10

Cellular metabolism        KRT15, KIF1B, ZNF697,             4.3E-13
                           PRG2, P2RY2,IMMP2L

Growth factor and growth   BMP-2, TCF[beta]1, VEGF,          1.2E-11

factor receptor activity   BMP8B, CSF1, FCFR1, BMPR2,
                           1GF2R, PDCFB, TGFBR2, NRP1,
                           CCR2

Biosynthetic process       CEL, COL11A2, ACPP, MMP14,        1.8E-9
                           CACNB1, ALPL, CDH1, ITGA3,
                           SERPINB10, TAF4B, ABCB10, IRF8

Cell proliferation         ATF3, MK167, S100A6, FTH1, DHCR7  2.1E-8

Signal transduction        MAP2K3, MAPK14, MAP3K10, BAMBI,
                           NDRG2, ECM1, SMAD7    5.5E-7

Apoptosis                  MYC, P53AIP1, ZBTB16, BBC3,       1.3E-5
                           VHL, CASP3, APITD1
Table 5 KEGG pathway analysis.

Pathway ID  KEGG Pathway terms             p-Value

hsa04110    Cell cycle                     2.43531E-7

hsa04010    MAPK signal pathway            6.34004E-6

hsa04350    TGF-beta signaling pathway     5.33899E-5

hsa04115    p53 signaling pathway          2.70418E-4

hsa04512    ECM-receptor interaction       0.01031297

hsa05120    Epithelial cell signaling in   0.01292882
            Helicobacter pylori infection

hsa04062    Chemokine signaling pathway    0.03882413


Discussion

Stem cell biology has become an important field for the understanding of tissue regeneration and implementation of regenerative medicine. Recent advances in stem cell biology have revealed that progenitor cells which are named DPSCs are also present in dental pulp tissue (Gronthos et al. 2000; Miura et al. 2003). DPSCs possess postnatal stem cell characteristics, including multipotent differentiation, self-renewal, clonogenic capacity, and expression of multiple mesenchymal stem cell surface markers (Gronthos et al. 2000, 2002; Shi and Gronthos 2003). DPSCs have gained great importance for use in the regenerative treatment of defective dental tissues, particularly those in the dentin-pulp complex when transplanted into immunocompromised mice by using HA/TCP as a carrier (Yang et al. 2008; Zhang et al. 2008). Therefore, DPSCs are considered to be suitable cells to evaluate odontogenic differentiation both in vitro and in vivo.

Recent reports state that Panax ginseng C. A. Mey and its constituents have anti-neoplastic, anti-oxidation, anti-inflammation, and estrogen-like activities (Attele et al. 1999; Lau et al. 2008; Zhu et al. 2009). Ginsenoside Rg1 promoted cells proliferation, differentiation and bone formation (Gong et al. 2006; Lu et al. 2008; Lu et al. 2009; Shen et al. 2010; Shi et al. 2009).

In this study, the effects of ginsenoside Rg1 on the proliferation and odontogenic differentiation of DPSCs were investigated. Our data showed that ginsenoside Rg1 significantly stimulated DPSCs proliferation and promoted the odontoblast differentiation. Ginsenoside Rg1 induced the production of DSP. The level of DSPP, ALP, and OCN mRNAs increased in a time dependent manner. DSPP, ALP, OCN, and DSP have been reported as mineralization markers for odontogenic/osteogenic differentiation (Jittapiromsak et al. 2010; Lee et al. 2010). The enhanced ALP activity is present as a marker during the early differentiation phase and plays an important role in mineral deposition (Fiorentini et al. 2011; Park et al. 2009). DSP is a dentin extracellular matrix protein that functions as an initiator of mineralization. DSP production is widely recognized as one of the most specific markers of the odontoblast pheno-type. DSP and dentin phosphoprotein (DPP) play important roles in extracellular matrix mineralization and dentinogenesis. DSPP is a dentin extracellular matrix protein that functions as an initiator of mineralization and considered one of the specifically odontoblastic markers (Lee et al. 2010; Suzuki et al. 2009). Osteocalcin, a vitamin K-dependent noncollagenous extracellular matrix protein, is synthesized by osteoblasts and odontoblasts. OCN is frequently used as a marker of odontogenic or osteogenic differentiation. The up-regulation of the dentin-specific genes DSPP, ALP, and OCN in treated DPSCs demonstrates the potential role of ginsenoside Rg1 in dentin regeneration and tooth engineering in conjunction with DPSCs.

BMP-2 plays an important role in tooth and bone formation. This protein has been successful in inducing bone and dentin formation both in vitro and in vivo studies (Ikeda et al. 2011; Yang et al. 2009). BMP-2 promotes odontoblast differentiation and mineral deposition. It accelerates DSPP mRNA expression, but does not influence cell proliferation in human pulp cells (Saito et al. 2004). In the present study, ginsenoside Rg1 increased BMP-2 mRNA levels in DPSCs, which may suggest that BMP-2 promoted the odontogentic differentiation of DPSCs and DSPP expression.

Ginsenoside Rg1 is a kind of potent phytoestrogen which can stimulate bone marrow stromal cells proliferation via the activation of the estrogen receptor-mediated signaling pathway (Lu et al. 2008). Estrogens can activate BMP-2 gene transcription in mouse mesenchymal stem cells and stimulate MSCs differentiation into osteoblasts (Zhou et al. 2003). Since DPSCs possess mesenchymal stem cell characteristics, it might be possible that estrogen receptor-mediated signaling pathway is involved in promoting DPSCs proliferation and differentiation resulted from ginsenoside Rg1 treatment.

FGF is involved in self-renewal of MSCs and the maintenance of their multilineage differentiation potential (Tsutsumi et al. 2001; Yeoh and Haan 2007). It has been reported that FGF2 as a cytokine can exert a significant effect in vitro on hDPSCs proliferation and control extracellular matrix generation during tissue generation and wound healing (He et al. 2008; Nakao et al. 2004). In the present study, FGF2 mRNA and protein were detected in DPSCs treated by ginsenoside Rg1.

In the present study, representative gene expression profiles and functional classifications were compared between the ginsenoside Rg1 and control group on hDPSCs by using a cDNA microarray system and a clustering algorithm. 2059 differentially expressed genes were detected between the ginsenoside Rgl (5 [mu]mol/l) group and control group (1498 up-regulated genes and 561 down-regulated genes). Gene ontology analysis of the differentially expressed genes showed these genes mainly related to the following functional gene categories: cell cycle, cellular metabolism, growth factor and growth factor receptor activity, biosynthetic process, cell proliferation, signal transduction and apoptosis. These genes may play important role in DPSCs proliferation and differentiation. Pathway analysis found seven statistically significant pathways such as cell cycle pathway, MAPK signal pathway and TGF[beta] signal pathway. The TGF[beta] family plays a crucial role in regulating the proliferation, extracellular matrix formation, differentiation, migration, and apoptosis of cells (Chan et al. 2005; Lee et al. 2006).

This in vitro study examined the effects of ginsenoside Rg1 on DPSCs with an attempt to clarify whether the Chinese medicine has a potential of DPSCs proliferation and odontogenic differentiation. The results demonstrated that ginsenoside Rg1 promoted the proliferation and differentiation of DPSCs into odontoblast-like cells by regulating the expression of a series of related genes and pathways. The data presented here indicate that ginsenoside Rg1 may be used in endodontic biotherapy, reparative dentin formation and tooth tissue engineering. This investigation is a first step toward that long-term goal of biological regenerative endodontic therapy and tooth tissue engineering.

Acknowledgments

This work was supported by Natural Science Foundation Project of CQ (No. CSTC 2011jjA10007) and Chongqing Municipal Health Bureau of Medical Scientific Research Projects (No. 2011-2-056).

Appendix A. Supplementary data

Supplementary material related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.phymed.2013.08.021.

[c] 2013 Elsevier GmbH. All rights reserved.

References

Attele, A.S., Wu, J.A., Yuan, C.S., 1999. Ginseng pharmacology: multiple constituents and multiple actions. Biochem. Pharmacol, 58, 1685-1693.

Balloni, S., Calvi, E.M., Damiani. F., Bistoni, G., Calvitti, M., Locci, P., Becchetti, E, Marinucci, L., 2009. Effects of titanium surface roughness on mesenchymal stem cell commitment and differentiation signaling. Int. J. Oral Maxillofac. Implants 24, 627-635.

Bluteau, G., Luder, H.U., De Bari, C., Mitsiadis, T.A., 2008. Stem cells for tooth engineering. Eur. Cell Mater. 31, 1-9.

Brazma, A., Hingamp, P., Quackenbush, J., Sherlock, G., Spellman, P., Stoeckert, C., Aach, J., Ansorge, W., Ball. C.A., Causton. H.C., Caasterland, T., Glenisson, P., Holstege, F.C., Kim, I.F., Markowitz, V., Matese. J.C., Parkinson, H., Robinson, A., Sarkans. U., Schulze-Kremer, S., Stewart, J., Taylor. R., Vilo, J., Vingron, M., 2001. Minimum information about a microarray experiment (MIAME)-toward standards for microarray data. Nat. Genet, 29, 365-371.

Chan, C.P., Lan, W.H., Chang, M.C., Chen, Y.J., Lan, W.C. Chang, H.H., Jeng, J.H., 2005. Effects of TGF-betas on the growth collagen synthesis and collagen lattice contraction of human dental pulp fibroblasts in vitro. Arch. Oral Biol. 50, 469-479.

Cordeiro, M.M., Dong, Z., Kaneko, T., Zhang, Z., Miyazawa, M., Shi, S., Smith, A.J., Nor, J.E., 2008. Dental pulp tissue engineering with stem cells from exfoliated deciduous teeth. J. Endod. 34, 962-969.

Fiorentini. E., Granchi. D., Leonardi, E., Baldini, N., Ciapetti, G., 2011. Effects of osteogenic differentiation inducers on in vitro expanded adult mesenchymal stromal cells. Int. J. Artif. Organs 34, 998-1011.

Galler, K.M., D'Souza, R.N., Federlin, M., Cavender, A.C., Hartgerink, J.D., Hecker. S., Schmalz, G., 2011. Dentin conditioning codetermines cell fate in regenerative endodontics. J. Endod. 37, 1536-1541.

Gong, Y.S., Chen, J., Zhang, Q.Z., Zhang. J.T., 2006. Effect of 17b-oestradiol and ginsenoside on osteoporosis in ovariectomised rats. J. Asian Nat. Prod. Res. 8, 649-656.

Gronthos, S., Mankani, M., Brahim, J., Robey, P.G., Shi, S., 2000. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc. Natl. Acad. Sci. USA 97, 13625-21363.

Gronthos, S., Brahim, J., Li, W., Fisher, L.W., Cherman, N., Boyde, A., DenBesten, P., Robey, P.G., Shi, S., 2002. Stem cell properties of human dental pulp stem cells. J. Dent. Res. 81, 531-535.

Hao, J., Zou. B., Narayanan, K., George, A., 2004. Differential expression patterns of the dentin matrix proteins during mineralized tissue formation. Bone 34, 921-932.

He, H., Yu, J., Liu, Y., Lu, S., Liu, H., Shi, J., Jin, Y., 2008. Effects of FCF2 and TGFP on Che differentiation of human dental pulp stem cells in vitro. Cell Biol. Int. 32, 827-834.

Hung, C.N., Mar, K., Chang, H.C., Chiang, Y.L. Hu. H.Y., Lai. C.C., Chu, R.M., Ma, CM., 2011. A comparison between adipose tissue and dental pulp as sources of MSCs for tooth regeneration. Biomaterials 32, 6995-7005.

Ikeda, H., Sumita, Y., Ikeda. M., Ikeda, H., Okumura, T., Sakai, E., Nishimura, M., Asahina, I., 2011. Engineering bone formation from human dental pulp- and periodontal ligament-derived cells. Ann. Biomed. Eng. 39, 26-34.

Jittapiromsak, N., Sahawat, D., Banlunara, W., Sangvanich, P., Thunyakitpisal, P., 2010. Acemannan an extracted product from Aloe vera, stimulates dental pulp cell proliferation, differentiation, mineralization, and dentin formation. Tissue Eng. Part A 16. 1997-2006.

Lau, W.S., Chan, R.Y., Guo, D.A., Wong, M.S., 2008. Ginsenoside Rg1 exerts estrogenlike activities via ligand-independent activation of ERalpha pathway. J. Steroid Biochem. Mol. Biol. 108, 64-71.

Lee, S.W., Choi, K.Y., Clio, J.Y., Jung. S.H., Song, K.B., Park. E.K., Choi, J.Y., Shin. H.I., Kim. S.Y., Woo, K.M., Baek. J.H., Nam. S.H., Kim. Y.J., Kim, H.J., Ryoo, H.M., 2006. TGF-beta2 stimulates cranial suture closure through activation of the Erk-MAPK pathway. J. Cell. Biochem. 98, 981-991.

Lee, S.K., Lee, S.K., Lee, S.I., Park, J.H., Jang, J.H., Kim. H.W., Kim, E.C., 2010. Effect of calcium phosphate cements on growth and odontoblastic differentiation in human dental pulp cells. J. Endod. 36,1537-1542.

Lu, M.C., Lai, T.Y., Hwang. J.M., Chen, H.T., Chang, S.H., Tsai, F.J., Wang, H.L. Lin, C.C., Kuo, W.W., Huang, C.Y., 2009. Proliferation- and migration-enhancing effects of ginseng and ginsenoside Rg1 through IGF-1- and FGF-2-signaling pathways on RSC96 Schwann cells. Cell Biochem. Funct. 27, 186-192.

Lu, X.Z., Wang, J.H., Wu, X., Zhou, L. Wang, L, Zhang. X.W., Cao, K.J., Huang, J., 2008. Ginsenoside Rg1 promotes bone marrow stromal cells proliferation via the activation of the estrogen receptor-mediated signaling pathway. Acta Pharmacol. Sin. 29, 1209-1214.

Miura, M., Gronthos, S., Zhao, M., Lu. B., Fisher, L.W., Robey, P.G., Shi, S., 2003. SHED: stem cells from human exfoliated deciduous teeth. Proc. Natl. Acad. Sci. USA 100, 5807-6581.

Nakao, K., Itoh, M., Tomita, Y., Tomooka, Y., Tsuji, T., 2004. FGF-2 potently induces both proliferation and DSP expression in collagen type I gel cultures of adult incisor immature pulp cells. Biochem. Biophys. Res. Commun. 325, 1052-1059.

Nakashima, M., Akamine, A., 2005. The application of tissue engineering to regeneration of pulp and dentin in endodontics. J. Endod. 31, 711-718.

Park, B.W., Hah, Y.S., Choi, M.J., Ryu, Y.M., Lee, S.G., Kim, D.R., Kim.J.R., Byun.J.H., 2009. In vitro osteogenic differentiation of cultured human dental papilla-derived cells. J. Oral Maxillofac. Surg. 67, 507-514.

Renjen, R., Maganzini, A.L., Rohrer, M.D., Prasad, H.S., Kraut, R.A.. 2009. Root and pulp response after intentional injury from miniscrew placement. Am. J. Orthod. Dentofacial Orthop. 136, 708-714.

Saito, T., Ogawa, M., Hata, Y., Bessho, K., 2004. Acceleration effect of human recombinant bone morphogenetic protein-2 on differentiation of human pulp cells into odontoblasts. J. Endod. 30, 205-208.

Shen, Y., Li, Y.Q., Li, S.P., Ma. L. Ding, L.J., Ji, H., 2010. Alleviation of ovariectomy-induced osteoporosis in rats by Panax notoginseng saponins. J. Nat. Med. 64, 336-345.

Shi. A.W., Wang, X.B., Lu. F.X., Zhu. M.M., Kong, X.Q., Cao, K.J., 2009. Ginsenoside Rg1 promotes endothelial progenitor cell migration and proliferation. Acta Pharmacol. Sin. 30. 299-306.

Shi, S., Gronthos, S., 2003. Perivascular niche of postnatal mesenchymal stem cells in human bone marrow and dental pulp. J. Bone Miner. Res. 18, 696-704.

Suzuki, S., Sreenath, T., Haruyama, N., Honeycutt, C. Terse. A., Cho, A., Kohler, T., Miiller, R., Goldberg, M., Kulkarni, A.B., 2009. Dentin sialoprotein and dentin phosphoprotein have distinct roles in dentin mineralization. Matrix Biol. 28, 221-229.

Tsutsumi, S., Shimaza, A., Miyazaki, K., Pan, H., Koike, C., Yoshida, E., Takagishi, K., Kato, Y., 2001. Retention of multilineage differentiation potential of mesenchymal cells during proliferation in response to FGF. Biochem. Biophys. Res. Commun. 288, 413-419.

Yamada, Y., Nakamura, S., Ito, K., Sugito, T., Yoshimi, R., Nagasaka, T., Ueda, M., 2010. A feasibility of useful cell-based therapy by bone regeneration with deciduous tooth stem cells dental pulp stem cells, or bone-marrow-derived mesenchymal stem cells for clinical study using tissue engineering technology. Tissue Eng. Part A 16, 1891-1900.

Yang, X., van der Kraan, P.M., Bian, Z., Fan. M., Walboomers, X.F., Jansen. J.A., 2009. Mineralized tissue formation by BMP2-transfected pulp stem cells. J. Dent. Res. 88, 1020-1025.

Yang, X., Walboomers, X.F., van den Dolder. J., Yang, F., Bian, Z., Fan, M., Jansen, J.A., 2008. Non-viral bone morphogenetic protein 2 transfection of rat dental pulp stem cells using calcium phosphate nanoparticles as carriers. Tissue Eng. Part A 14.71-81.

Yeoh, J.S., Haan, G., 2007. Fibroblast growth factors as regulators of stem cell self-renewal and aging. Mech. Ageing Dev. 128, 17-24.

Zhang, W., Walboomers, X.F., van Osch. G.J., van den Dolder, J., Jansen. J.A., 2008. Hard tissue formation in a porous HA/TCP ceramic scaffold loaded with stromal cells derived from dental pulp and bone marrow. Tissue Eng. Part A 14, 285-294.

Zhou, S., Turgeman, G., Harris, S.E., Leitman, D.C., Komm, B.S., Bodine. P.V., Gazit, D., 2003. Estrogens activate bone morphogenetic protein-2 gene transcription in mouse mesenchymal stem cells. Mol. Endocrinol. 17, 56-66.

Zhu, D., Wu, L, Li, C.R., Wang, X.W., Ma. Y.J., Zhong, Z.Y., Zhao, H.B., Cui, J., Xun, S.F., Huang, X.L, Zhou, Z., Wang. S.Q., 2009. Ginsenoside Rg1 protects rat cardiomyocyte from hypoxia/reoxygenation oxidative injury via antioxidant and intracellar calcium homeostasis. J. Cell. Biochem. 108, 117-124.

(a) Department of Stomatology, the First Affiliated Hospital of Chongqing Medical University, Chongqing 400016, China

(b) Department of Operative Dentistry and Endodontics, Cuanghua School of Stomatology. Sun Yat-sen University, Guangzhou 570055, China

(c) Department of Oral and Maxillofacial surgery, the First Affiliated Hospital of Chongqing Medical University, Chongqing 400016, China

ARTICLE INFO

Article history:

Received 23 January 2013

Received in revised form 20 July 2013

Accepted 20 August 2013

* Corresponding author. Tel.: +86 13452146621; fax: +86 023 66296570.

E-mail address: cqcnwp@sina.com (P. Wang).
COPYRIGHT 2014 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2014 Gale, Cengage Learning. All rights reserved.

 
Article Details
Printer friendly Cite/link Email Feedback
Author:Wang, Ping; Wei, Xi; Zhang, Fujun; Yang, Kai; Qu, Chen; Luo, Huiqiong; He, Longzhu
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Article Type:Report
Date:Jan 15, 2014
Words:5472
Previous Article:Effects of ophiopogonin D and spicatoside A derived from Liriope Tuber on secretion and production of mucin from airway epithelial cells.
Next Article:Effect of chito-oligosaccharide on the oral absorptions of phenolic acids of Flos Lonicerae extract.
Topics:

Terms of use | Privacy policy | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters