Printer Friendly

Genotyping for Blast (Pyricularia oryzae) Resistance Genes in [F.sub.2] Population of Supa Aromatic Rice (Oryza sativa L.).

1. Introduction

Rice (Oryza sativa) is a staple food worldwide for more than half of the world population [1]. Consumers prefer rice varieties with good grain quality like aroma, long grain, and amylase content. The aromatic trait enhances the market value of rice [2]. Nonaromatic rice has badh2 gene in chromosome 8 encoding for betaine aldehyde dehydrogenase enzyme with 503 amino acids while in the aromatic one, the number of encoded amino acids is 251. The badh2 gene produces GABA, a four-carbon nonprotein amino acid acting as a natural pesticide playing several roles including detoxification of free radicals, plant development, and plant defense [3]. The aromatic trait is coded by the mutant form of badh2 gene with 8 bp deletion in exon 7 of the badh2 gene, encoding a chemical compound 2-acetyl-1-pyrroline (2AP) [4-6]. The presence of the badh2 mutant gene encoding for the pleasant aroma by producing 2-acetyl-1-pyrroline was established by Nadaf et al. [3] to be associated with some weakness like yield losses, sterility, and susceptibility to abiotic and biotic stresses including blast disease. The mutant form of the badh2 gene has been associated with plant susceptibility to diseases as it suppresses the expression of the badh2 gene [3]. Blast disease which is known to occur in 85 countries worldwide [7, 8] is manifested in temperate and humid regions as the main cause of reduction of rice production [9, 10]. The blast disease can cause high yield loss of 10 to 85% when factors or enhancers of epidemic development (high mean temperature, relative humidity higher than 85-89%, the presence of dew, excessive nitrogen fertilization, and drought stress) are present [11].

Methods used in controlling blast disease include adjustment of planting time, burning diseased tissues, use of healthy seeds, and cultural systems like fungicide and fertilizer management without ignoring the use of resistant plant varieties bearing genes for blast resistance [12, 13]. Molecular screening of major rice blast resistance genes has been determined using molecular markers, which showed close-set linkage to 11 major rice blast resistance genes (Pi-d2, Pi-z, Piz-t, Pi-9, Pi-36, Pi-37, Pi5, Pi-b, Pik-p, Pik-h, and Pi-ta2), in a collection of 32 accessions resistant to Magnaporthe oryzae [13]. Out of the 32 accessions, the Pi-d2 and Pi-z appeared to be omnipresent and gave positive expression. The analysis of QTLs links genetic markers with DNA base variations, like single-nucleotide polymorphisms (SNPs) and simple sequence repeats (SSRs) or microsatellite to the QTLs of interest [14]. The most popular markers used in QTL analysis are SSRs, also known as microsatellites. However, SSR markers have been replaced by SNPs as molecular markers of choice in plant genetic analysis due to their codominant inheritance, their biallelic nature, chromosome-specific location, and genome-wide distribution [15]. The objective of this study was to assess the presence of R genes (Pita and Pi9) for blast resistance and the badh2 gene for aroma in the [F.sub.2] generation using rice genotyping methods. In this study, markers (SNP and InDels) linked to the Pita and Pi9 genes conferring blast resistance and the badh2 gene for aroma inherited in the improved parent (Supa aromatic 234) were genotyped using the KASP method in 103 [F.sub.2] plants which had been phenotypically screened for blast resistance.

2. Materials and Methods

2.1. Rice Seeds. In this study, seeds of 208 individual rice plants of the [F.sub.2] population and 72 seeds of parent or control lines (12 of Supa234, 12 of Vuninzara, 12 of Gigante, 12 of IRBL9-W, 12 of CO39, and 12 of BC3) were obtained from IRRI-ESA Burundi. The [F.sub.2] generations had been developed by IRRI-ESA breeders in Burundi for the purpose of improvement of Supa234 rice (IR97012-27-3-1-1-B) aromatic line for resistance to blast disease. The IRBL9-W, a highly resistant parental monogenic line with the Pi9 gene, and BC3 bearing the Pita gene were used as resistant controls. The Supa234 and CO39 rice lines without genes for blast resistance were used as susceptible controls. Supa234 line (IR97012-27-3-1-1-B, aromatic) containing the badh2 gene for aroma was also used as a positive control for aromatic fragrance. The plants were grown in a randomized complete block design (RCBD) in trays. Rice seeds were sown in Minuro trays (plastic trays 36 cm wide and a depth of 56 cm) filled with soil collected from Gihanga rice-growing areas. The soil was dried under the sun for two weeks, to diminish plant contamination, and then ground. Each Minuro tray had 104 wells (each with a size < 40 [cm.sup.3]) arranged in 8 rows and 13 columns. The seeds were sown at a rate of four per well which were later thinned to one after germination. One hundred and thirty-five plants selected from 208 [F.sub.2] plants, four parents (Supa234, Vuninzara, Gigante, and IRBL9-W), and two controls (CO39 and BC3) were screened for blast resistance at vegetative and reproductive stages. The screening was carried out into petri dishes by inoculating detached leaves with blast spores using the spot inoculation method [16]. Five microliters of conidial/spore suspension were inoculated on both sides of each leaf segment. Each plant sample had its own negative control, which were inoculated with a mixture of Tween 20 and deionized water. After inoculation, the petri dishes containing the leaf segments were maintained at 25 [+ or -] 1[degrees]C under continuous fluorescent light (11 to 12 [micro][Em.sup.-2] [s.sup.-1]) for 24 hours. Excess moisture on the leaflets was removed after 24 h by blotting with sterile pieces of laboratory tissue paper [16]. The leaves were then incubated at 25 [+ or -] 1[degrees]C in the dark room for 10 days. To maintain the moisture level, sterile distilled water was added once every 3 days to the petri dishes to avoid desiccation of the leaf segments during incubation.

2.2. DNA Isolation. Leaf samples from the 135 selected [F.sub.2] individual plants, parents, and controls were collected 21 days after planting. The leaf samples were lyophilized to remove moisture and kept at -80[degrees]C. The DNA for genotyping was extracted from the leaf disks of 103 [F.sub.2] plants (which grew to maturity) among the 135 plants screened for blast resistance, parents, and controls. Parents and the control lines CO39 and BC3 were also screened. IRBL9-W, Vuninzara, and Gigante parents and the BC3 rice line were used as positive controls for the Pi9 and Pita gene markers while Supa234 parents were used as the positive control for the badh2 gene maker. BC3 and Supa234 were also used as negative controls. Leaf tissues weighing 0.5 g from each sample were used to extract genomic DNA. Leaf samples were separately crushed using a mortar and pestle, and the powdered samples were collected in sterilized 1.5 ml Eppendorf tubes. In each tube, 400 [micro]l of CTAB lysis buffer containing 6.25 mM of potassium ethyl xanthogenate, 0.5% CTAB, 700 mM NaCl, 10 mM EDTA, and 100 mM Tris, pH 7.5, was added and mixed by vortexing for 30 s. The tubes were then incubated for 1 hour in a water bath at 65[degrees]C. An equal volume of chilled chloroform isoamyl in the ratio of 24:1 was added to each tube and centrifuged for 10 min at 13,000 rpm at 4[degrees]C. The supernatant was then transferred to new sterilized Eppendorf tubes. In each tube, 400 [micro]l of isopropanol was added and kept overnight at -20[degrees]C for nucleic acid precipitation. This was followed by centrifugation at 13,000 rpm at 4[degrees]C for 8 minutes. The liquid phase was then gently decanted off leaving the DNA pellets. The DNA pellets were washed by adding 400 [micro]l of 70% ethanol followed by centrifugation at 13,000 rpm. The 70% ethanol was then decanted, and the samples air-dried by inverting the Eppendorf tubes on sterilized laboratory tissues. Finally, DNA was dissolved using 100 [micro]l of TE buffer containing 10 mM Tris, pH 7.5, and 0.5 mM EDTA. The extracted DNA was stored at -21[degrees]C before genotyping. The quality and quantity of DNA was determined using agarose gel electrophoresis using 0.8% agarose.

2.3. Genotyping. The extracted genomic DNA samples were genotyped using the Kompetitive Allele Specific PCR (KASP) genotyping technique [17] in the Intertek laboratory in Sweden. The KASP markers for the Pi9 and badh2 genes used were designed by IRRI (Table 1). The SNP-specific KASP assay mix, the universal Master mix (genotyping mixture), and the DNA sample used for all PCR reactions had a total volume of 10 [micro]l. In 96-well plates for the PCR, one well contained a mixture of 5 [micro]l genotyping mixture (4.4 [micro]l of 2x KASP Master mix and 0.6 [micro]l of KASP assay mix) and 5 [micro]l of 50 ng DNA from each sample. Each KASP assay mix comprised three assay-specific nonlabelled oligonucleotides specific to a SNP or InDel marker comprising two allele-specific forward primers and one common reverse primer. Each primer harbored a unique tail sequence corresponding with a universal fluorescence resonant energy transfer (FRET) cassette and a primer-tail was labelled with FAM dye while on the tail of the second primer was labelled with HEX dye. The KASP Master mix on the other hand contained two universal FRET cassettes (HEX and FAM), ROX (passive reference dye), free nucleotides, Taq polymerase, and Mg[Cl.sub.2] in an optimized buffer solution.

The Kompetitive Allele Specific PCR genotyping was performed in the following conditions according to Devran et al. [18]: one cycle for hot activation at 94[degrees]C for 15 min and the DNA denaturation was performed in 10 cycles at 94[degrees]C for 20 sec. The primer annealing and elongation were performed in 10 cycles for 60 seconds by dropping the temperature from 61 to 55[degrees]C at a rate of 0.6[degrees]C per each cycle. After, the temperature was raised to 94[degrees]C for 20 secs in 26 cycles to allow new denaturation and then lowered to 55[degrees]C for 60 seconds during annealing and elongation. When the amplification reactions were completed, 5 [micro]l of the amplified products was transferred into the 384-well plates and detected on a BMG PHERA Star plate reader with a fluorescent resonance energy transfer (FRET) using the genotype cluster analysis Kraken caller software from LGC Genomics assigning a genotype to each produced color. Geotypes were scored according to the guideline of Table 2.

2.4. Data Analysis. The traits associated with each genotype and the positions of each SNP marker were generated by R software [19]. Based on the genotypic traits, a numerical scoring method was used assigning 1 to a positive allele and 0 for a negative allele. The scores were used to calculate the genotypic relationship between the parents and the [F.sub.2] populations and analysis of molecular variance (AMOVA) using GenAlex software version 6.5 [20]. Principal coordinate analysis (PCoA) showing the genetic differentiation between the rice plants was generated using GenAlex software version 6.5. A dendrogram showing the relationship between the plants was drawn based on the genetic dissimilarity using the neighbor-joining method using Darwin software version 6 [21].

3. Results

3.1. Molecular Marker Results. The genotyping results of the rice plants are presented in Table 3. There were 39 plants with the Pita gene for blast resistance represented on two alleles (score 1: 1); among them, 23 plants including 1C2, 1G2, 1C5, 1H7, 1D5, and 1B12 were either resistant or highly resistant in both stages of development (vegetative and reproductive) (Table 3). The Pita gene was also present in allele 1 in 30 plants; among them, 10 were resistant or highly resistant in both stages including 3B1, 1D1, 3E5, and 1D8 (Table 3). The IRBL9-W parent had the Pi9 gene for blast resistance in both alleles (score 1 : 1) while only one [F.sub.2] plant, 3B1, had the Pi9 gene in only one allele (score 1: 0) (Table 3). The Supa234 (IR97012-27-3-1-1-B, the aromatic), Gigante parents, and 27 [F.sub.2] plants had the badh2 gene for aroma present in both alleles (score 1:1); among them, 14 plants including 1G2, 1C5, 3E5, and 1B12 were resistant or highly resistant in both stages. There were fifty-seven [F.sub.2] plants including 1A1, 3B1,1F11, and 1A6 which had the badh2 gene present in one allele (score 1:0) (Table 3). There were also plants including 1C1, 3C6, and 3E8 that did not have any of the targeted genes Pita, Pi9, and badh2 (Table 3).

Among the resistant or highly resistant [F.sub.2] plants, only one plant, 3B1, had a combination of three genes (Pita, Pi9, and badh2), each present in one allele and nine plants (1G2, 1C5, 1D5, 1B12, 1C12, 1E13, 2B2, 2H2, and 2H4) having a combination of Pita and badh2 genes in both alleles (Table 3). However, there were 4 plants, 1H3, 2H5, 1G11, and 4C6, which did not possess the targeted R genes (Pita and Pi9) for blast resistance but were resistant to blast disease in both stages.

3.2. Genetic Variation between Plants. For the analysis of genetic variation within the screened plants, GenAlEX Software version 6.5 [20] grouped the categories into populations where [F.sub.2] plants were grouped in population 1, Gigante parent in population 2, Vuninzara in population 3, Supa234 (IR97012-27-3-1-1-B) in population 4, and IRBL9-W in population 5. The BC3 control plants were grouped in population 6 and CO39 in population 7. Based on the genotype scores, the genetic variation calculated between the populations indicated that the number of observed alleles per locus (Na) ranged between 0.00 and 2.00 while the number of effective alleles (Ne) per locus ranged from 1 to 1.49 (Table 4). The [F.sub.2] plants (pop 1) had the highest number of effective alleles (Ne) (1.49) while all the other rice populations only had one (1) effective allele.

The [F.sub.2] population had the maximal percentage of polymorphic loci (% P) (100%) while the parents and controls had no polymorphic loci (% P) (0%) (Table 4). In this study, high genetic diversity was observed in [F.sub.2] rice plants (pop 1) with the mean Shannon's Information Index I = 0.41 while within the parents, there was no genetic diversity (I = 0) (Table 4). The mean expected heterozygosity (He) ranged from 0 for populations 2, 3, 4, 5, 6, and 7 (parents and control's lines) to 0.28 for pop 1 ([F.sub.2] plants) (Table 4).

3.3. Analysis of Molecular Variance (AMOVA). The analysis of molecular variance (AMOVA) for the seven populations showed that the genetic variation among populations (52%) was slightly higher compared to that within populations (48%). However, the variations were not significant (p > 0.05) (Table 5).

3.4. Principal Coordinate Analysis. The principal coordinate analysis (PCoA) of 103 [F.sub.2] plants, 23 plants from 6 parents, and 19 plants from 2 controls populations clustered differently in the PCoA. The IRBL9-W parent (pop 5) with the Pi9 gene was in its own cluster but in the same quadrant I with the [F.sub.2] plant 3B1 (Figure 1). However, the parents Vuninzara (pop 3) and Gigante (pop 2) bearing the Pita gene clustered together with the BC3 control (pop 6) in quadrant II while Supa234 (IR97012-27-3-1-1, aromatic) parent (pop 4) clustered with CO39 control (pop 7) without any R gene in quadrant IV. Other [F.sub.2] plants clustered with Supa234 parent and CO39 and the remaining part of [F.sub.2] population clustered alone in the PCoA (quadrant III) (Figure 1). There was no genetic differentiation between [F.sub.2] plant 3B1 and IRBL9-W (Pi9) plants. There was also no genetic differentiation between Supa234 parent (IR97012-27-3-1-1) and CO39 control and some of the [F.sub.2] plants (Figure 1). There was no genetic differentiation between parents Vuninzara and Gigante and the control BC3 as they clustered in the same quadrat (Figure 1). The [F.sub.2] plants were distributed in three clusters (quadrants I, III, and IV) while the other populations were found in only one quadrat (Figure 1).

3.5. Phylogenetic Analysis. The neighbor-joining phylogenetic tree based on the genetic dissimilarity grouped the 103 [F.sub.2] plants into three main clusters (clusters A, B, and C) (Figure 2). Cluster A containing Supa234 parents with the badh2 gene for aroma consisted of 35 [F.sub.2] plants including the resistant plants like 1A11, 2C3, 3G12, 3E5, 4C6, and 1G11. Cluster A had three subclusters (1, 2, and 3) in which subcluster 2 contained Supa234 clustering with 4 [F.sub.2] plants with bootstrap support of 43% (Figure 2). The smallest cluster B contained the negative control CO39, IRBL9-W (Pi9 gene donor parent) both without the Pita gene nor the badh2 gene and 9 [F.sub.2] plants which are supported by 40% bootstrap except plant 3B1 (Figure 2). The third cluster C composed of mainly parents and controls with the Pita gene (BC3 control in subcluster 3, Vuninzara parent in subcluster 4, and Gigante parent in subcluster 5) and 58 [F.sub.2] plants. The cluster C had 5 subclusters in which subcluster 3 supported by 41% bootstrap contained BC3 which was the positive control with the Pita gene.

The subcluster 4 contained the Vuninzara parent containing the Pita gene for blast resistance and subcluster 5 supported by 41% bootstrap value contained Gigante (Pita gene donor parent). Twenty resistant [F.sub.2] plants clustered together with Vuninzara and Gigante parents in subclusters 4 and 5. In subcluster 4 containing Vuninzara which has the Pita gene, clustered resistant 13 plants including 1A10, 2H1, 1B10, 2E4, 1H10, 2G3, 1B13, 1G13, 1C2, 1F13, 2B4, 4B3, and 3G10. Subcluster 5, in which Gigante is clustered (parent with Pita gene), contained 7 blast resistant plants including 2H2, 2H4, 1G2, 1C12, 1E13, 1B12, and 1C5 (Figure 2).

4. Discussions

Marker-assisted selection is a breeding technique in which selection is done base on genotype of a marker of dominant or recessive alleles within a population [22]. In this study, marker-assisted selection was used in order to identify [F.sub.2] plants of Supa aromatic rice line which may contain Pita and Pi9 genes for blast resistance and badh2 gene for aroma. KASP genotyping showed that Pita gene was predominant in the [F.sub.2] population (except one plant 3B1 with Pi9 gene) even though not all plants had Pita gene and not all the positive plants for Pita gene were homozygous in both alleles (Table 3). The homozygous genotypes (resistant: resistant or resistant/homozygous) contained the Pita gene represented in both alleles and heterozygous (resistant: susceptible or resistant heterozygous) genotypes were characterized by the presence of the Pita gene on one allele while in the homozygous genotypes (susceptible: susceptible) Pita gene was absent in both alleles. This shows the state of segregation within the [F.sub.2] population. This finding concurs with those reported by Jia et al. [23], in which there was a segregation in the [F.sub.2] population for the Pita gene (resistant/heterozygous and resistant/homozygous). The badh2 gene for aroma was detected in 84 [F.sub.2] plants in both allele or on one allele which demonstrate the inheritance of aroma from parent and segregation. In the present study, there were plants which had both the aroma and blast resistance genes, similar to the findings by Luo et al. [24] who reported a successful development of WH6725 resistant line to blast disease which possessed both genes. In the present study, the presence of Pita gene in resistant or moderately resistant plants may be attributed to the fact that Pita gene has been found to confer a medium-spectrum resistance [25].

The analysis carried out on genetic diversity and gene frequencies in the seven populations of plants used in this study ([F.sub.2] plants, Gigante plants, Vuninzara plants, Supa234 plants, IRBL9-W plants, CO39 plants, and BC3 plants) showed genetic diversity (Shannon's Information Index, I = 0.410) within population 1 ([F.sub.2] plants) while in parent's populations, the Shannon's Information Index I was zero (Table 4). That genetic diversity ranging from 0 to 0.410 show a moderate diversity in the screened plants compared to the moderate genetic diversity ranging from 0.05 to 0.78 observed in fifty SSR markers used in germplasm of fifty red rice by Islam et al. [26]. The heterozygosis of zero found in parents and controls lines demonstrated that parents used in the cross carried out at IRRI-ESA were 100% homozygous or true breeding [27]. However, heterozygosis of 0.28 observed in [F.sub.2] plants is associated to the state of segregation of [F.sub.2] generation (called segregating population by Mendel).

Analysis of molecular variance (AMOVA) in the rice plant populations showed that there was a slightly higher variation among populations (52%) although variation was also observed within populations (48%) however the variations were not significant (P > 0.05). The low genetic variation among the population and within population, respectively, indicate that the plants under this study were closely related. This variation found is different from the reports on variations among population (34%) and within population (66%) [28], and among groups (35.28%) and within groups (64.72%) reported by Chakhonkaen et al. [29].

The [F.sub.2] plants clustered in dendrogram and in PCoA according to the presence of R genes and aroma in alleles. According to the principal coordinate analysis (PCoA), there were no genetic differentiations between 3B1 [F.sub.2] plant and IRBL9-W plants gene due to the presence of Pi9 gene in the 3B1 and IRBL9-W plants. This was also observed in the dendrogram where the two plants, 3B1 and IRBL9-W clustered in the vicinity. However, they were separated due to the presence of a single copy of Pita and badh2 in 3B1. The fact that Supa234 (IR70212-27-3-1-1-B) parent and CO39 control clustered together is due to the absence of the target R genes; hence, the [F.sub.2] plants clustering together do not contain the R genes. The [F.sub.2] plants were distributed in three plot areas as they were distributed in three cluster of dendrogram due to the fact their genetic characteristics differ where some offspring carried genes from one parent while others had genes from both parents and others did not have any of the targeted three genes (Pita, Pi9, and badh2).

5. Conclusion and Recommendation

The molecular marker genotyping of the rice plants for R genes for blast resistance shows the presence of Pita gene conferring resistance to blast disease in many [F.sub.2] plants, represented in either both alleles or on one allele. The Pi9 gene was recovered in only one [F.sub.2] plant 3B1 (represented on one allele). Resistant rice plants including [F.sub.2] population of Supa234 (IR702-23-3-1-1-B, aromatic line) bearing badh2 gene for aroma and Pita gene for blast resistance were identified in this study. The resistant [F.sub.2] line 3B1 obtained in this study combining Pi9, Pita, and badh2 genes can be used for development of an aromatic rice variety (Supa type) with resistance to blast disease.

Based on the above findings, there is a need to for further study on the resistant 3B1 [F.sub.2] plant identified with the 3 targeted genes (Pita, Pi9, and badh2), by testing for blast resistance in field conditions to assess the stability of the resistance. The resistant 3B1 plant, found with aroma gene and resistance genes can be studied further for grain quality (Supa type) in final stage of variety fixation. Further research is necessary to check for other R genes which can be the source of resistance in the five resistant plants with badh2 gene for aroma (1G11, 3E5, 1A11, 3G12, and 2C3) which did not contain the targeted R genes (Pita and Pi9) or contained a single copy of the Pita gene.

https://doi.org/10.1155/2019/5246820

Data Availability

The data used to support the findings of this study are available from the corresponding authors upon request.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

References

[1] L. Nalley, J. Tack, A. Durand et al., "The production, consumption, and environmental impacts of rice hybridization in the United States," Agronomy Journal, vol. 109, no. 1, pp. 193-203, 2017.

[2] K. A. Mottaleb and A. K. Mishra, "Rice consumption and grain-type preference by household: a Bangladesh case," Journal of Agricultural and Applied Economics, vol. 48, no. 3, pp. 298-319, 2016.

[3] A. B. Nadaf, K. V. Wakte, and R. L. Zanan, "2-Acetyl-1-pyrroline biosynthesis: from fragrance to a rare metabolic disease," Journal of Plant Science & Research, vol. 1, no. 1, pp. 102-108, 2014.

[4] O. Napasintuwong, "Survey of recent innovations in aromatic rice," in Paper at the 131st EAAE Seminar at Kasetsart University, Kasetsart University, Thailand, 2012.

[5] GRiSP (Global Rice Science Partnership), Rice almanac, International Rice Research Institute, Los Banos, Philippines, 4th ed. edition, 2013.

[6] W. I. W. H. M. E. H. Wettewa and N. S. Kottearahchi, "Sequence analysis of the mutation in the 7th exon of badh2 gene in traditional aromatic rice varieties in Sri Lanka," Journal of Agricultural Sciences, vol. 9, no. 1, pp. 24-30, 2014.

[7] M. K. Singh, P. Singh, R. P. Singh, and C. Mohapatra, "Association analysis for yield and quality attributes in Indica rice and screening of hybrids against blast Disease (Magnaporthe grisea Barr.)," Journal of Plant Sciences, vol. 8, no. 2, pp. 45-56, 2013.

[8] S. Dutta, "Study on Blast Disease of Rice and it's Management Strategies Faculty of Agriculture," Msc Thesis, Uttar Banga Krishi Viswavidyalaya, Pundibari, Indian, 2017.

[9] Z. N. Hao, L. P. Wang, and R. X. Tao, "Defence genes and antioxidant enzymes in stage-dependent resistance to rice neck blast," Journal of Plant Pathology, vol. 92, no. 3, pp. 747-752, 2010.

[10] L. Nalley, F. Tsiboe, A. Durand-Morat, A. Shew, and G. Thoma, "Economic and environmental impact of rice blast pathogen (Magnaporthe oryzae) alleviation in the United States," PLoS ONE, vol. 11, no. 12, p. e0167295, 2016.

[11] M. Bundo and M. Coca, "Enhancing blast disease resistance by overexpression of the calcium-dependent protein kinase OsCPK4 in rice," Plant Biotechnology Journal, vol. 14, no. 6, pp. 1357-1367, 2016.

[12] H. Kato, "Rice blast disease," in Pesticide Outlook, vol. 12, no. 1-pp. 23-25, Tokyo 103, Japan, The Royal Society of chemistry, 2001.

[13] L. Yan, Y. Bai-Yuan, P. Yun-Lianget al., "Molecular Scree ning of Blast Resistance Genes in Rice Germplasms Resistant to Magnaporthe oryzae," Rice Science, vol. 24, no. 1, pp. 41-47, 2017.

[14] M. Rafiq, S. Liaqat, R. I. Ahmed et al., "An overview of marker assisted selection and QTL mapping in cotton," International Journal of Agronomy and Agricultural Research (IJAAR), vol. 8, no. 1, pp. 71-80, 2016.

[15] S. Thakur, P. K. Singh, R. Rathour et al., "Genotyping and development of single-nucleotide polymorphism (SNP) markers associated with blast resistance genes in rice using GoldenGate assay," Molecular Breeding, vol. 34, no. 3, pp. 1449-1463, 2014.

[16] V. Challagulla, S. Bhattarai, and D. J. Midmore, "In-vitro vs in-vivo Inoculation: Screening for Resistance of Australian Rice Genotypes Against Blast Fungus," Rice Science, vol. 22, no. 3, pp. 132-137, 2015.

[17] L. G. C. Genomics, "KASP genotyping," in Protocol, LGC Limited, 10959203, Germany, 2014.

[18] Z. Devran, A. Goknur, and L. Mesci, "Development of molecular markers for the Mi-1 gene in tomato using the KASP genotyping assay," Horticulture Environment and Biotechnology, vol. 57, no. 2, pp. 156-160, 2016.

[19] F. M. Nogoy, J. Y. Song, S. Ouk et al., "Current applicable DNA markers for marker assisted breeding in abiotic and biotic stress tolerance in rice (Oryza sativaL.)," Plant Breeding and Biotechnology, vol. 4, no. 3, pp. 271-284, 2016.

[20] R. Peakall and P. E. Smouse, "GenAlEx 6.5 : genetic analysis in Excel. Population genetic software for teaching and researchan update," Bioinformatics, vol. 28, no. 19, pp. 2537-2539, 2012.

[21] X. Perrier and J. P. Jacquemoud-Collet, "Darwin software," 2006, December 2018, (http://darwin.cirad.fr/darwin).

[22] M. A. Nadeem, M. A. Nawaz, M. Q. Shahid et al., "DNA molecular markers in plant breeding: current status and recent advancements in genomic selection and genome editing," Biotechnology and Biotechnological Equipment, vol. 32, no. 2, pp. 261-285, 2018.

[23] Y. Jia, Z. Wang, R. G. Fjellstrom et al., "RicePi-tagene confers resistance to the major pathotypes of the rice blast fungus in the United States," Phytopathology, vol. 94, no. 3, pp. 296-301, 2004.

[24] Y. Luo, T. Ma, A. Zhang et al., "Marker-assisted breeding of the rice restorer line Wanhui 6725 for disease resistance, submergence tolerance and aromatic fragrance," Rice, vol. 9, no. 1, p. 66, 2016.

[25] W.-m. Xiao, L.-x. Luo, H. Wang et al., "Pyramiding of Pi46 and Pita to improve blast resistance and to evaluate the resistance effect of the two R genes," Journal of Integrative Agriculture, vol. 15, no. 10, pp. 2290-2298, 2016.

[26] M. Z. Islam, M. Khalequzzaman, M. F. R. K. Prince et al., "Diversity and population structure of red rice germplasm in Bangladesh," PLoS ONE, vol. 13, no. 5, p. e0196096, 2018.

[27] O. Souleymane, B. T. B. Joseph, B. Manneh, K. Ofori, and E. Danquah, "Genetic diversity assessment of four rice varieties using SNP markers," European Journal of Engineering Research and Science, vol. 2, no. 12, 2017.

[28] T. Zhang, X.-l. Ni, K.-f. Jiang et al., "Relationship Between Heterosis and Parental Genetic Distance Based on Molecular Markers for Functional Genes Related to Yield Traits in Rice," Rice Science, vol. 17, no. 4, pp. 288-295, 2010.

[29] S. Chakhonkaen, K. Pitnjam, W. Saisuk, K. Ukoskit, and A. Muangprom, "Genetic structure of Thai rice and rice accessions obtained from the International Rice Research Institute," Rice, vol. 5, no. 1, p. 19, 2012.

L. Kanyange [ID], (1) J. Kamau, (1) O. Ombori [ID], (1) A. Ndayiragije, (2) and M. Muthini (1)

(1) Department of Plant Sciences, Kenyatta University, P.O. Box 43844-00100, Nairobi, Kenya

(2) International Rice Research Institute-Eastern and Southern Africa Office, P.O. Box 5132 Bujumbura, Burundi

Correspondence should be addressed to L. Kanyange; kanyangely@gmail.com and O. Ombori; omwoyo.ombori@ku.ac.ke

Received 14 May 2019; Revised 11 September 2019; Accepted 10 October 2019; Published 15 November 2019

Academic Editor: Francine Durocher

Caption: Figure 1: Principal coordinate analysis (PCoA) for the 103 [F.sub.2] rice plants, 23 parent plants, and 19 control plants. Percentage variation explained by the three axes, 1: 83.71%; 2: 11.59%; 3: 4.70%.

Caption: Figure 2: Dendrogram for the 103 [F.sub.2] rice plants, parents (Supa234, Gigante, Vuninzara, and IRBL9- W) and controls (CO39 and BC3). Letters: cluster; numbers: subclusters. *: resistant or highly resistant plants. The number shown at the node of the dendrogram indicates the percentage of bootstrap support from 1000 iterations. Bootstrap values above 40% are the only ones that are shown.
Table 1: The primer sequences for SNP and InDel markers used in
genotyping [19].

Gene    Marker ID   Primer        Primer sequence
                     name

Pi9     snpOS0007   InDel-F    CGCCGGTTGATAAGTAAAAGCT
                               TGATTATGTTTTTTATGTGGGG

                    InDel-R   CAAGAACTAATATCTACCCATGG

Pita    snpOS0006    SNP-F     CCGTGGCTTCTATCTTTACCTG
                               CCGTGGCTTCTATCTTTACCTT

                     SNP-R     AGTCAGGTTGAAGATGCATAGA

badh2   snpOS0022   InDel-F   ACATAGTGACTGGATTAGGTTCTG
                              CTGGTAAAAAGATTATGGCTTCA

                    InDel-R   CATCAACATCATCAAACACCACT

Gene    Favourable   Unfavourable
          allele        allele

Pi9         --        CGATGGTTTC

Pita        C              A

badh2     TATAT      AAAAGATTATGGC

SNP: single/nucleotide polymorphism; F: forward primer; R: reverse
primer; InDel: insertion/deletion.

Table 2: Characteristics associated with the SNP/InDel markers.

SNP/InDels   Genes   Chr   Position    Markers      Allele 1

Pi-ta        Pita    12    10607554   snpOS0006        A
Pi9-lb        Pi9     6    10381489   snpOS0007b   CGATGGTTTC
BADH2.1-7    badh2    8    20382865   snpOS0022    AAAAGATTA
                                                      TGGC

SNP/InDels   Allele 2         Genotype 1          Genotype 2

Pi-ta           C                 A:A                C:C
Pi9-lb          --       CGATGGTTTC:CGATGGTTTC        /
BADH2.1-7     TATAT     AAAAGATT AT GGC: AAAAGA      TATA
                                TTATGGC            T:TATAT

SNP/InDels    Trait of     Trait of    Score of   Score of
              allele 1     allele 2    allele 1   allele 2

Pi-ta        Susceptible   Resistant      0          1
Pi9-lb       Susceptible   Resistant      0          1
BADH2.1-7        Not       Fragrant       0          1
              fragrant

Key: SNP: single/nucleotide polymorphism; InDel: insertion/deletion;
Chr: chromosome. Alternative alleles existing in the target loci and
corresponding genotype.

Table 3: Determination of the presence or absence of Pita and Pi9
genes for blast resistance and badh2 gene for aroma in F2 rice
plants.

                          Marker gene
             snpOS0006    snpOS0007b     snpOS0022
               Pita          Pi9          badh2

Plant       AL 1   AL 2   AL 1   AL 2   AL 1   AL 2

1A1          0      0      0      0      1      0
*3B1         1      0      1      0      1      0
1C1          0      0      0      0      0      0
*1D1         1      0      0      0      0      0
1 E1         1      0      0      0      0      0
3A2          0      0      0      0      1      0
1B2          1      1      0      0      1      0
*1C2         1      1      0      0      1      0
3D2          1      0      0      0      1      1
3E2          1      0      0      0      1      0
1F2          1      1      0      0      1      0
*1G2         1      1      0      0      1      1
1H2          1      1      0      0      1      0
1A3          0      0      0      0      0      0
1B3          0      0      0      0      1      0
*1C3         1      0      0      0      1      0
1D3          1      0      0      0      1      1
1 E3         1      0      0      0      1      1
1F3          0      0      0      0      1      0
1G3          1      0      0      0      1      0
*1H3         0      0      0      0      0      0
1B4          1      0      0      0      0      0
1C4          0      0      0      0      0      0
1F4          0      0      0      0      1      0
1H4          0      0      0      0      1      0
*1C5         1      1      0      0      1      1
*1D5         1      1      0      0      1      1
*3 E5        1      0      0      0      1      1
1H5          0      0      0      0      1      0
1A6          1      0      0      0      1      0
1B6          1      0      0      0      1      0
3C6          0      0      0      0      0      0
1 E6         0      0      0      0      0      0
1G6          1      0      0      0      1      0
1A7          1      0      0      0      1      1
1D7          1      1      0      0      1      0
1 E7         1      1      0      0      1      1
*1H7         1      1      0      0      0      0
1A8          1      1      0      0      1      0
3B8          0      0      0      0      1      0
*1D8         1      0      0      0      0      0
3E8          0      0      0      0      0      0
1F8          1      1      0      0      1      1
1H8          0      0      0      0      0      0
1C9          1      0      0      0      0      0
1G9          1      1      0      0      1      0
1H9          1      0      0      0      1      1
*1A10        1      1      0      0      1      0
*1B10        1      1      0      0      1      0
1C10         1      0      0      0      1      1
3D10         1      0      0      0      1      0
1 E10        1      0      0      0      0      0
1F10         1      1      0      0      1      1
*3G10        1      1      0      0      1      0
*1H10        1      1      0      0      1      0
*1A11        1      0      0      0      1      1
1F11         1      1      0      0      1      0
*1G11        0      0      0      0      1      1
*1A12        1      0      0      0      1      0
*1B12        1      1      0      0      1      1
*1C12        1      1      0      0      1      1
*1D12        1      0      0      0      1      0
1 E12        0      0      0      0      1      0
*3G12        1      0      0      0      1      1
*1B13        1      1      0      0      1      0
1C13         1      1      0      0      1      0
3D13         0      0      0      0      1      0
*1 E13       1      1      0      0      1      1
*1F13        1      1      0      0      1      0
*1G13        1      1      0      0      1      0
1H13         0      0      0      0      1      0
2A1          0      0      0      0      1      0
2B1          1      1      0      0      1      0
2C1          0      0      0      0      1      1
2D1          1      0      0      0      0      0
4E1          0      0      0      0      1      0
*2H1         1      1      0      0      1      0
2A2          1      0      0      0      1      0
*2B2         1      1      0      0      1      1
2C2          0      0      0      0      0      0
2D2          1      1      0      0      1      0
4E2          1      0      0      0      0      0
2G2          1      1      0      0      1      1
*2H2         1      1      0      0      1      1
2A3          0      0      0      0      1      0
*4B3         1      1      0      0      1      0
*2C3         1      0      0      0      1      1
*2G3         1      1      0      0      1      0
*2B4         1      1      0      0      1      0
4C4          0      0      0      0      1      0
2D4          0      0      0      0      1      1
*2 E4        1      1      0      0      1      0
2G4          1      1      0      0      0      0
*2H4         1      1      0      0      1      1
2A5          0      0      0      0      1      0
2F5          1      0      0      0      1      0
4G5          0      0      0      0      1      0
*2H5         0      0      0      0      1      0
2A6          0      0      0      0      1      1
2B6          0      0      0      0      1      0
*4 C6        0      0      0      0      1      0
2D6          0      0      0      0      1      0
2H6          1      1      0      0      1      0
*Gigante     1      1      0      0      1      1
Vuninzara    1      1      0      0      1      0
Supa234      0      0      0      0      1      1
*IRBL9-W     0      0      1      1      0      0
*BC3         1      1      0      0      0      0
CO39         0      0      0      0      0      0

The plants with *: 37 [F.sub.2] plants; resistant parent and control
plants which were either resistant or highly resistant in both stages;
others are moderately resistant and moderately susceptible. 1A1 to
2H6: [F.sub.2] plants; Gigante and Vuninzara: parent donor of Pita
gene; Supa234: recipient parent with badh2 gene for aroma; IRBL9-W:
Pi9 gene donor parent; BC3: positive control for Pita gene; CO39:
negative control for all target genes (Pita, Pi9, and badh2) genes. AL
1: allele 1; AL 2: allele 2.

Table 4: Means of different allele (Na), number of effective alleles
(Ne), Shannon's Information Index (I), expected heterozygosity (He),
unbiased expected heterozygosity (UHe), and percentage of polymorphic
loci (% P) of the rice plant populations ([F.sub.2] rice plants,
Gigante, Vuninzara, Supa234, IRBL9-W donor, BC3, and CO39).

Pop       N            Na                   Ne

Pop 1    103   2.00 [+ or -] 0.00   1.49 [+ or -] 0.27
Pop 2     6    0.67 [+ or -] 0.33   1.00 [+ or -] 0.00
Pop 3     6    0.67 [+ or -] 0.33   1.00 [+ or -] 0.00
Pop 4     5    0.00 [+ or -] 0.00   1.00 [+ or -] 0.00
Pop 5     6    0.33 [+ or -] 0.33   1.00 [+ or -] 0.00
Pop 6     7    0.67 [+ or -] 0.33   1.00 [+ or -] 0.00
Pop 7    12    0.00 [+ or -] 0.00   1.00 [+ or -] 0.00

Pop               I                    He

Pop 1    0.410 [+ or -] 0.20   0.28 [+ or -] 0.14
Pop 2    0.00 [+ or -] 0.00    0.00 [+ or -] 0.00
Pop 3    0.00 [+ or -] 0.00    0.00 [+ or -] 0.00
Pop 4    0.00 [+ or -] 0.00    0.00 [+ or -] 0.00
Pop 5    0.00 [+ or -] 0.00    0.00 [+ or -] 0.00
Pop 6    0.00 [+ or -] 0.00    0.00 [+ or -] 0.00
Pop 7    0.00 [+ or -] 0.00    0.00 [+ or -] 0.00

Pop             uHe           %P

Pop 1    0.28 [+ or -] 0.14   100
Pop 2    0.00 [+ or -] 0.00    0
Pop 3    0.00 [+ or -] 0.00    0
Pop 4    0.00 [+ or -] 0.00    0
Pop 5    0.00 [+ or -] 0.00    0
Pop 6    0.00 [+ or -] 0.00    0
Pop 7    0.00 [+ or -] 0.00    0

Key: N: no. of plants per population; Na: no. different alleles; Ne =
1-([p.sup.2] + [q.sup.2]); I = -1 * (p * Ln(p) + q * Ln(q)); He = 2 *
p * q; UHe = (2N-(2N--1)) * He. Pop 1: composed of 103 [F.sub.2] rice
plants genotyped; pop 2: represent Gigante parent containing Pita
gene; pop 3: Vuninzara parent containing Pita gene; pop 4: Supa234
(aromatic) recurrent parent blast susceptible; pop 5: IRBL9-W, a Pi9
gene donor parent; pop 6: BC3, a positive control for Pita gene; pop
7: CO39, a negative control for all genes.

Table 5: Analysis of molecular variance (ANOYA) for the 145 rice
plants of the seven categories: 103 [F.sub.2] plants, 23 parent
plants, and 19 control plants based on genotyping genomic DNA.

Source        Df     MS     Est. var.   % mol var.   P value

Among pops     6    4.676     0.373        52%       <0.5175
Within pops   138   0.348     0.348        48%       <0.4372
Total         144             0.721        100%

Df: degree of freedom; MS: mean square; est. var.: estimated variance;
pops: populations; % mol var.: percentage molecular variance.
COPYRIGHT 2019 Hindawi Limited
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2019 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research Article
Author:Kanyange, L.; Kamau, J.; Ombori, O.; Ndayiragije, A.; Muthini, M.
Publication:International Journal of Genomics
Geographic Code:6BURU
Date:Nov 1, 2019
Words:6723
Previous Article:Integrated Metabolome and Transcriptome Analysis Uncovers the Role of Anthocyanin Metabolism in Michelia maudiae.
Next Article:Transcriptome Sequencing Reveals Regulatory Mechanisms of Taxol Synthesis in Taxus wallichiana var. Mairei.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters