Printer Friendly

Genome-Wide Identification, Phylogeny, and Expression Analysis of ARF Genes Involved in Vegetative Organs Development in Switchgrass.

1. Introduction

Auxin, an essential plant hormone, plays vital roles in various aspects of plant growth and development, such as embryogenesis, organogenesis, tropic growth, shoot elongation, root architecture, flower and fruit development, tissue and organ patterning, and vascular development [1-9]. Most of these processes are controlled by auxin response genes, which are regulated at transcriptional level by cis-acting DNA elements in their promoter regions, including the auxin response element (AuxRE, TGTCTC), core of auxin response region (AuxRR-core, GGTCCAT), and TGA-element (AACGAC). Of these, AuxREs are reported to be specifically bound and regulated by a class of transcription factors, called auxin response factors (ARFs) [10, 11]. ARF proteins generally contain a DNA-binding domain (DBD) in the amino (N)-terminal region, a central region that functions as an activation domain (AD) or a repression domain (RD) [12, 13], and a carboxyl (C)-terminal dimerization domain (CTD), which is a protein-protein interaction domain that mediates ARF homo- and heterodimerization and also the heterodimerization of ARF and Aux/IAA proteins, another category of auxin response regulators [12-16].

Because of their important roles in auxin signaling pathways, which are indispensable to plant growth and development, ARF gene families have been studied in many plant species. For example, there are 23 ARF transcription factors in Arabidopsis (Arabidopsis thaliana) [17], 25 in rice (Oryza sativa) [18], 39 in poplar (Populus trichocarpa) [19], 24 in Medicago truncatula [20], and 36 in maize (Zea mays) [21]. In previous studies, ARF proteins were split into three clades (clades A, B, and C) based on phylogenic relationships, which could be traced back to the origin of land plants [22]. In particular, phylogenetic analysis of the ARF gene family in many species has been widely reported. Arabidopsis ARFs were divided into four subgroups, which is in accordance with the phylogenetic classifications of ARFs in rice [18], banana (Musa acuminata L.) [23] and Salvia miltiorrhiza [24]. Maize and poplar ARFs are classified to six subgroups [25], whereas Medicago ARFs were divided into eight subgroups [20]. In general, the wide variety of ARF phylogenetic grouping patterns are based on the diversification of its gene structure and motif locations, which may be the result of gene truncation or alternative splicing [22].

Biochemical and genetic analyses have established the crucial roles of ARF genes in plant growth and development. In Arabidopsis thaliana, AtARF2 regulates floral organ abscission, leaf senescence, and seed size and weight [26-28]. AtARF5 affects vascular development and early embryo formation [29]. AtARF8 controls the uncoupling of fruit development from pollination and fertilization, and loss-of-function mutations in these genes result in seedless fruit [30]. AtARF7 and AtARF19 redundantly regulate auxin-mediated lateral root development [31]. In rice, OsARF1 is required for vegetative and reproductive development [32]. OsARF16 is essential for iron and phosphate deficiency responses in rice [33]. In addition, some ARF genes are involved in the response to abiotic stresses, such as drought, salt, or cold stress [34, 35]. Taken together, these studies have shown that the ARF gene family function in multiple signal transduction pathways to regulate multiple aspects of plant growth and development.

Switchgrass (Panicum virgatum L.) is a warm-season C4 perennial grass used as a bioenergy and animal feedstock [36, 37]. To avoid competing with food crops for arable fields, a large proportion of switchgrass fields will be located on marginal lands where various abiotic stresses, such as salt, drought, and extreme temperatures. The genome sequence of switchgrass has been published recently [38] and provides a powerful resource to identify ARF gene family members. Considering the value of switchgrass as a bioenergy and animal feedstock, we mainly focused on vegetative organs in this study.

Here, we identified 47 switchgrass ARF genes and comprehensively characterized the physical location, conserved motif architecture, and expression profile of the PvARFs. We also subdivided these 47 PvARF genes based on phylogenetic relationships based on the well-studied ARF genes in other species. To determine which ARF genes potentially work on different developmental processes, the temporal-spatial expression pattern in vegetative organs (2nd, 3rd, and 4th internode and leaves) and expression response to auxin treatment in seedlings were determined by real-time PCR (qRT-PCR). Our works provide preliminary information about ARF genes in switchgrass and lays the foundation for the further elucidation of the biological roles of ARF genes in grasses.

2. Materials and Methods

2.1. Plant Materials and Treatments. A widely used and highly productive lowland-type switchgrass cultivar, Alamo, was grown in the greenhouse at 28 [+ or -] 1[degrees]C with 16 h lighting, followed by 8 h darkness. Switchgrass development in our greenhouse was divided into three vegetative stages (V1, V2, and V3), five elongation stages (E1, E2, E3, E4, and E5), and three reproductive stages (R1, R2, and R3). Six different tissues, including the second internode (I2), the third internode (I3), the fourth internode (I4), the second leaf (L2), the third leaf (L3), and the fourth leaf (L4), were collected at the R2 stage [39].

For auxin treatments, plantlets grown in tissue culture until 20 days after rooting were incubated for 1, 2, and 3 h in hormone-supplemented 5 [micro]M naphthylacetic acid (NAA) medium [18]. Control plants were grown in hormone-free medium. Whole seedlings were sampled from NAA-treated and control plants at the same time points. All experiments included three biological replicates. All of the samples were stored at -80[degrees]C.

2.2. Sequence Retrieval and Identification. The conserved ARF domain based on the Hidden Markov Model (HMM) (Pfam06507) was obtained from the Pfam protein family database (http://pfam.sanger.ac.uk/) and used as a query to search against the switchgrass genome database in Phytozome v11 (http://www.phytozome.net/). Sequences were selected for further analysis if the E value was less than 1e-10. Several coding sequences (CDS) were corrected based on the switchgrass unique transcript sequence database [38]. Peptide length, molecular weight, and isoelectric point of each PvARF were calculated using the online ExPASy program (http://www.expasy.org/).

2.3. Phylogenetic Analysis. The putative PvARF proteins from another fifteen species were used to construct a phylogenetic tree. ARF protein sequences were obtained from the public genome database Phytozome. The BlastP program was used to identify putative ARF proteins from the genomic databases of well-sequenced species, including Arabidopsis, sweet orange (Citrus sinensis), Chinese cabbage (Brassica rapa), poplar, Medicago (Medicago truncatula), cotton (Gossypium raimondii), Grandis (Eucalyptus grandis), soybean, tomato (Solanum lycopersicum), grape (Vitis vinifera), maize, rice, foxtail millet (Setaria italica), sorghum (Sorghum vulgare), and Brachypodium distachyon. Multiple sequence alignments of the full-length ARF sequences were performed using Clustal X1.83, and the edges of the alignments were manually trimmed. An unrooted neighbor-joining (bootstrap value = 1000) tree was constructed using MEGA5 and then manually improved by online program EvolView (http:// www.evolgenius.info/evolview/).

2.4. Chromosomal Locations of PvARF Genes. The lowland switchgrass cultivars are allotetraploid (2n = 4x=36) and consist of two highly homologous subgenomes, designated as Chr.a and Chr.b [40]. Specific physical locations of each PvARF were obtained from the Phytozome database. Chromosome locations were then determined using MapChart 2.2 based on the genetic linkage map [41, 42]. Tandem gene duplicates were defined as paralogous genes located within 50 kb and separated by fewer than five nonhomologous spacer genes [43].

2.5. Gene Structure, Conserved Motif, and Cis-Acting DNA Element Analysis. A comparison of each CDS with the corresponding genomic DNA sequence was made to determine the positions and numbers of introns and exons of each PvARF gene using the Gene Structure Display Server (http://gsds.cbi.pku.edu.cn/). Conserved motifs were analyzed using the MEME program (http://meme.nbcr.net/ meme/cgi-bin/meme.cgi). Putative microRNA target sites in PvARFs were identified using the miRanda online software (http://cbio.mskcc.org/microrna_data/manual.html). Cis-acting DNA elements were analyzed using the PLACE online program (https://sogo.dna.affrc.go.jp/) [44]. Ka/Ks calculation was analyzed by PAL2NAL [45].

2.6. Gene Expression Analysis by qRT-PCR. Probesets of PvARF genes were retrieved from public database of switchgrass (https://switchgrassgenomics.noble.org/). qRT-PCR was performed to analyze the transcript abundance of PvARFs in different switchgrass tissue samples. Plant tissue samples were ground in liquid nitrogen using a mortar and pestle. Total RNA was isolated using the TRIZOL reagent according to the manufacturer's supplied protocol (Transgen, China) and subjected to reverse transcription with Superscript PrimeScript[TM] RT reagent Kit (TaKaRa, China) after treatment with TURBO DNase I (TaKaRa, China). The qRT-PCR primers were designed using Primer Premier 5 (Table S1), and their specificity was verified by PCR. qRT-PCR analysis was conducted in triplicate using SYBR[R] Premix Ex Taq[TM] II (TaKaRa, Japan), with PvUBQ as a reference gene, with a Light Cycler 480 real-time PCR system (Roche, Switzerland). The qRT-PCR reactions and data analyses were performed according to previously published methods [46].

3. Results

3.1. Identification and Chromosomal Localization of Switchgrass ARFs. To identify ARF proteins in switchgrass, the Hidden Markov Model (HMM) profile of the conserved ARF domain (Pfam06507) was used as a query to search against the publicly available switchgrass genome database (Phytozome v11) by BlastP and tBlastN program. A total of 47 putative ARF proteins were found, and Pfam analysis confirmed that all of these proteins contain the ARF domain. The putative candidates were designated as PvARF1 to PvARF47, based on the alignments of predicted amino acid sequences. The predicted PvARF proteins ranged from 243 (PvARF34) to 1182 (PvARF13) amino acids (aa) in length and from 27.4kDa to 130.9kDa in molecular weight (Table 1). The isoelectric points (pi) ranged from 5.33 (PvARF8) to 9.52 (PvARF25) (Table 1), suggesting that different PvARFs might have roles in specific subcellular environments.

To examine the chromosomal distribution of PvARFs, the physical locations of the PvARFs on chromosomes (Chrs) were obtained through BlastN searches against the switchgrass genome database in Phytozome. Due to the allotetraploidization of switchgrass (2n = 4x = 36), the PvARF genes exist as paralogous gene pairs in the genome with only one exception, PvARF39, which might be lost in the evolutionary process. Of the 47 PvARFs, 42 were putatively anchored onto seven of the nine switchgrass chromosomes (Figure 1), while the other five PvARFs (PvARF19, 20, 39, 42, and 43) are located on unmapped scaffolds. The chromosomal distribution and density of PvARF genes are not uniform. Chr 1, 4, 5, and 7 contain four PvARF gene pairs, respectively. Chr 3 has three pairs, Chr 6 and 9 have only one pair of PvARFs, and no gene is located on Chr 2 and 8. Consistent with expectations, 14 gene pairs obviously exist on the two set of chromosomes (Figure 1), while the other 7 gene pairs were putatively located on the chromosomes based on their sequence similarity. The indeed relationships among these PvARFs need to be explained by phylogenetic analysis.

3.2. Phylogenetic Analysis of Switchgrass ARFs. To profoundly characterize the phylogenetic relationships of ARF proteins among switchgrass and other land plants, we selected ARFs from another 15 species, which have public genome database in Phytozome, to construct a phylogenetic tree together with PvARFs. These species include five monocots (foxtail millet, maize, sorghum, Brachypodium, and rice) and ten dicots (Arabidopsis, sweet orange, Chinese cabbage, poplar, cotton, soybean, Medicago, tomato, Grandis, and grape). Seven separate clusters of ARF proteins were defined based on the NJ tree topology and bootstrap values (higher than 50%) (Figure 2). As previously reported by Finet et al., three large groups of ARF proteins were classified as clades A, B, and C. In detail, clusters I and II in our study together make up clade C, and clusters III, IV, and V make up clade A. ARF members in these two clades are considered to be more ancient than those in clade B [22], which comprises clusters VI and VII in our study.

Considering that switchgrass is an allotetraploid plant, the gene number of PvARFs in each cluster should be approximately twice than the other monocots, especially in foxtail millet, the most closely relatives to switchgrass among the selected species (Table S2). Cluster VII, which has the largest number (11 out of 47) of PvARFs, contains six foxtail millet ARFs. Cluster I, III, IV, and VI also contain eight switchgrass and four foxtail millet ARFs, and clusters II and V have only two PvARFs, respectively (Table S2). PvARF39 in cluster VII is most closely related to the foxtail millet ARF protein Seita.8G135700.1, which indicates that the paralog of PvARF39 has been lost or mutated gradually during the evolutionary process of switchgrass genome.

In order to comprehensively clarify the evolutionary process of the PvARFs, we carried out the tandem repeat duplication analysis based on the chromosomal location and phylogenetic analysis of the PvARFs. The results showed that no tandem repeat duplication events were found in PvARFs. In addition, we calculated the Ka/Ks analysis between PvARFs and OsARFs. Compared with rice ARF genes, 18 pairs of orthologs originated from positive selection (Ka/Ks ratio was larger than 1), while 6 orthologs showed purifying selection (Ka/Ks ratio was less than 1) (Table 2).

3.3. PvARF Gene Structures and Locations of Conserved Motif. To better understand the phylogenetic relationships of the PvARFs, the exon/intron arrangements were determined by aligning cDNA sequences to genomic sequences. Another phylogenetic tree was firstly constructed only using switchgrass ARF protein sequences. The PvARF genes were clearly displayed in the form of gene pairs (Figure 3(a)), which confirmed the previous speculation in the chromosomal distribution (Figure 1). All PvARFs have introns in the coding sequence (CDS), and the number of introns ranges from 2 to 14 (Table 1, Figure 3(b)). In particular, members belonging to clade C (clusters I and II) contain relatively fewer introns (two to four). In contrast, PvARFs in clade A (clusters III, IV, and V) have much more introns (11 to 14), with the exception of PvARF2, which might have lost the exons in N-terminus. The number of introns in clade B (clusters VI and VII) were ranging from 5 to 13. This variability of intron number might be correlated to the multiple functions of clade B ARFs in higher plants. Additionally, we further identified the putative microRNA target sites of ARF genes in switchgrass. 16 out of 47 PvARFs were found to contain the potential microRNA target sites. Eight PvARFs were predicted to be the targets of miR160 and miR167, respectively (Figure 3(b), Figure 4).

Analysis of motif locations in PvARF proteins was performed to explore structural diversity and to predict their functions. A total of 12 conserved motifs were identified using the MEME program (Figure 3(c), Figure S1). The DNA-binding domain (DBD) (motifs 1, 2, and 9 corresponding to Pfam02362) was lost in four members (PvARF22, 25, 25, and 38). The ARF domain (motifs 3, 5, 8, and 11 corresponding to Pfam06507) exists in all PvARFs. The AUX/IAA domain (motifs 4 and 10 corresponding to cl03528) has been lost in almost all of the PvARFs in clusters I, II, and VI. These results confirm the phylogenetic relationship between the PvARFs in clades A/ C and B and indicate that there has been functional differentiation among PvARFs in different clusters.

3.4. Expression Patterns of PvARFs in Different Organs of Switchgrass. To analyze the expression levels of PvARFs, we firstly acquired the probesets of the PvARFs in switchgrass expression atlas from the public database [38]. The results showed that PvARFs were expressed in root, node, internode, leaf, leaf sheath, flower, and seed but with different expression profile of each PvARF gene. For example, PvARF3/4, 11/12, and 46/47 were highly expressed in all tested organs, while PvARF 1/2, 9/10, 19/20, and 33/34 were extremely lowly expressed in switchgrass (Figure 5).

Biomass yield is one of the most important criteria used to evaluate the quality of switchgrass. Vegetative organs, especially internodes and leaves, are the primary sources of biomass. Auxin is one of the most important phytohormone, which regulate the plant growth and development. To investigate whether and how PvARFs work on vegetative organs, we selected the second, the third, and the fourth internode and the corresponding leaves at the second reproductive (R2) stage to test the expression profile of the PvARFs by qRT-PCR analysis. Eight pairs of PvARF genes and PvARF39 are not expressed or are extremely lowly expressed in the tested tissues, whereas the other 15 pairs of PvARF genes show substantial expression in internodes and leaves. In internodes, 14 pairs of PvARFs have higher expression levels in the upper internode (I4) than the other two internodes (I2 and I3), with one exception (PvARF17/18) having no obvious difference in the expression level in the three internodes (Figure 6). In leaves, ten pairs of PvARF genes (PvARF3/4, 15/16, 21/22, 23/24, 29/30, 35/36, 37/38, 40/41, 44/45, and 46/47) show no significant changes in expression level in the three tested leaves. There was lower expression of PvARF5/6, 7/8, and 17/18 in the upper leaf (L4) than in the bottom leaves (L2 or L3), whereas PvARF11/12 and 42/43 are more highly expressed in L4 compared to L2, and even lower expression is observed in L3 (Figure 6). These results suggest that the biosynthesis and transport of endogenous auxin in switchgrass might affect the expression profile of PvARF genes, especially in the internode.

3.5. Expression Analysis of PvARFs in Response to Auxin Treatment. In order to clarify the biofunctions of PvARF proteins, cis-acting DNA elements were analyzed using 2 kb promoter sequence of PvARFs. The results showed that PvARFs in different clades were putatively involved in specific process. For example, PvARFs in clade A might participate in nodule formation, while clade B genes function on wounding response (Table S3). However, all of the PvARF proteins mostly tended to be involved in plant growth and development, such as phytohormone signaling, abiotic stress response, carbon metabolism, pollen development, and so on (Table S3).

As a key component of the auxin signaling pathway, ARF proteins play vital roles in auxin response. It has been reported that auxin induces or represses the expression of some ARF genes in Arabidopsis [31], rice [18], and maize [21]. To examine the response of PvARF genes to the exogenous auxin, one-month-old switchgrass seedlings were treated with 5 [micro]M NAA for 0, 1, 2, and 3 hours, and the expression patterns of the PvARFs were determined. The qRT-PCR results revealed that auxin repressed the expression of eleven pairs of genes (PvARF5/6, 7/8, 11/12, 15/16, 29/30, 35/36, 37/38, 40/41, 42/43, 44/45, and 46/47) at all three time points, whereas it induced the expression of three pairs of genes (PvARF3/4, 23/24, and 25/26) at 1 hour and then reduced at the latter two time points. In contrast, PvARF21/22 expression was not significantly affected by auxin (Figure 7). These results suggest that exogenous auxin could induce or repress the expression of most PvARF genes to regulate switchgrass growth and development.

4. Discussion

Extensive studies have shown that ARFs play crucial roles in plant growth and developmental processes [10]. However, a systematic analysis of ARF gene members in switchgrass has not been done. In this study, we identified 47 PvARF genes, almost twice than Arabidopsis (23) and rice (25) [18, 31], for the reason of allopolyploidization in switchgrass evolutionary process [41]. Gene structure analysis showed that the number of exons in PvARF genes ranged from 3 to 14, while similar results were found in Arabidopsis [31], rice [18], and tomato [9], which indicates that the plant ARF gene family has highly conserved structures and potentially similar functions across dicotyledonous and monocotyledonous plant species.

Based on phylogenetic analysis, 47 switchgrass ARF genes were assigned to seven separate clusters, which was similar to the previous studies [22]. The number of ARFs of switchgrass in each cluster was about twice than those of five other monocots (maize, rice, sorghum, foxtail millet, and Brachypodium) but not consistent with the number of ARFs in ten dicot species (Arabidopsis, citrus, Chinese cabbage, poplar, cotton, soybean, Medicago, tomato, Grandis, and grape), which indicates that differences in the evolution of ARF genes in monocotyledonous and dicotyledonous plants. According to the phylogenetic tree of ARFs from different species, the orthologous relationship was found to dramatically divorce. In cluster V (PvARF17/18-AtARF5-CiARF5-BrARF5-1/ 5-3-PoptrARF5.1/5.2-GrARF5a/5b-EgrARF5-GmARF40/47-Sl-AF5-VvARF18-ZmARF4/ 29-OsARF11-Seita.3G028100.1-Sobic.006G255300.1-Bra-di5g25157.1), the ratio of orthologous gene number between species is 1: 1 which suggests that the functions might be well-conserved across species. Orthologous clusters with ratios greater or smaller than 1 : 1 were also found, indicating the functional diversity of ARF genes in switchgrass.

In general, the members of a subgroup are characterized by the presence of conserved domains. According to previous studies, the ARF genes contain several conserved domains, such as motifs 1,2, and 9 made up the DNA-binding domain, motifs 3, 5, 8, and 11, which correspond to the ARF domain, and motifs 4 and 10, which are located in the C-terminus and correspond to the AUX/IAA super family domain [10]. The high level of conservation of the various motifs among different species indicates that they are involved in similar regulatory pathway. In our study, the C-terminal AUX/IAA super family domain was missing in several gene members, including PvARF9, 19, 20, 27, 29-36, 39, and 44, which is consistent with the lack of this domain in AtARF3, 13, and 17 and MdARF6, 8, 14, 17, 18, 20, 21, and 28 as well as in SIARF2, 3, 7, and 13 [2, 3, 47]. In addition, PvARF genes which are present in the same clade and possess similar motifs might function redundantly and have similar expression patterns. For example, PvARF5/6 and 7/8 which are members of cluster III and PvARF37/38, 40/41, 42/43, 44/45, and 46/47, which are members of cluster VII exhibit similar expression patterns at the R2 stage.

Switchgrass is an important resource for bioenergy and feedstock materials, and biomass yield is the most important target in molecular breeding of switchgrass. Comprehensive analysis of PvARF gene expression patterns helped us screen for candidate PvARF genes with potentially distinct functions in regulating vegetative organ growth and development. Taken together, 15 pairs of PvARF genes were detected to have high levels of expression in vegetative organs. Similar patterns of expression were also found in tea plants [48], apple [47], and tomato [9]. 13 of the 15 CsARF genes were expressed in root, stem, leaf, flower, and fruit [24]. Eight of the 31 MdARF genes were expressed in stem, leaf, flower, and fruit [46], and 17 SlARF genes were expressed in root, stem, leaf, flower bud, and ovary [9]. In our study, 14 pairs of PvARFs were more highly expressed in the I4 than in the I2 and I3, which suggests that these genes might play vital roles during the formation of young stems, and these results are consistent with the reported function of their homologous genes in Arabidopsis [26, 49]. However, in leaves, the expression level of most PvARFs did not change significantly in different developmental stages. PvARF11/12 is most highly expressed in the fourth leaf, suggesting that these genes may play roles in leaf development like their Arabidopsis homologs, ARF7 and 19 [31]. Of the 47 PvARF genes, 17 were not expressed in the tested tissues, which indicates that they might not function in these organs, or that the functions of these genes may have been lost during evolution. In general, most PvARF genes have different expression profiles in the internodes and leaves, indicating that they might be regulated by the distribution and concentration of endogenous auxin. The in-depth studies will be needed to confirm these results in future.

Because ARF proteins are transcription factors that regulate the expression of auxin response genes, we determined the response of PvARF genes to NAA treatment. The regulation of gene expression in response to auxin has been reported in Arabidopsis [3, 31], rice [20, 32, 34], maize [21], tomato [2], Medicago [20], and so on. In this study, we found that at least 14 pairs of PvARF genes were responsive to NAA treatment in seedlings but showed diverse expression patterns. Eleven pairs of PvARF genes (PvARF5/6, 7/8, 11/12, 15/16, 29/30, 35/36, 37/38, 40/41, 42/43, 44/45, and 46/47) were downregulated by exogenous auxin treatment across all time points, indicating that their expression was negatively regulated by NAA, similar to their homologs in rice and maize (OsARF5, 14, and 21 and ZmARF5 and 18), of which expression levels decreased marginally in response to auxin [21, 32]. In contrast, the other three pairs of PvARF genes (PvARF3/4, 23/24, and 25/26) were upregulated by auxin treatment at 1 hour point and then downregulation at later time points, indicating that NAA significantly induced the target gene in a short period of time, as their homologs in Arabidopsis, rice, and maize (AtARF4, 19; OsARF1, 23; and ZmARF3, 8, 13, 15, 21, 27, and 30). In brief, expression of these ARF genes increased slightly in response to auxin [21, 31, 32], implying that these genes are potential primary auxin responsive genes. Generally, the expression level of the ARF genes was directly regulated by auxin. Considering that the endogenous auxin concentration is sufficient for plant growth and development, the extra auxin (NAA) applied exogenously might act as inhibitor of auxin response genes in our study, and the further study will be carried out in the future to clarify the mechanism of auxin response in grasses.

5. Conclusions

We identified 47 switchgrass ARF genes and established the evolutionary relationship between these genes using phylogenic, gene structure, and conserved protein motif analyses. Expression analyses revealed the potential role of PvARF genes involved in growth and development of switchgrass internodes and leaves and in response to NAA treatment in seedlings. These data provide a solid foundation for future functional characterization of ARF genes and ARF-mediated signal transduction pathway in switchgrass.

https://doi.org/10.1155/2018/7658910

Conflicts of Interest

The authors have declared that no competing interests exist.

Authors' Contributions

Jianli Wang, Changhong Guo, and Guiqing Han conceived and designed the study. Jianli Wang and Zhenying Wu performed the laboratory experiments and the data analysis. Chunxiang Fu, Zhongbao Shen, Dequan Sun, Peng Zhong, Lichao Ma, Zetao Bai, Duofeng Pan, Ruibo Zhang, Daoming Li, and Hailing Zhang assisted in the data analysis. Jianli Wang and Zhenying Wu wrote the manuscript with assistance from Guiqing Han. All authors read and approved the final manuscript. Jianli Wang and Zhenying Wu contributed equally to this work.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (Grant number 31601365), the major research project of Heilongjiang Academy of Agricultural Sciences (Germplasm Resource Renewal of Frozen Crops in Heilongjiang Province).

Supplementary Materials

Figure S1: twelve conserved motifs in PvARF analyzed by MEME search tool. The height of each box represents the specific amino acid conservation in each motif. Table S1: primer sequences used for gene expression analysis by qRT-PCR. Table S2: phylogenetic relationships of ARFs. Table S3: putative cis-acting DNA elements in the promoter of PvARF genes. (Supplementary Materials)

References

[1] J. W. Chandler, "Auxin response factors," Plant, Cell & Environment, vol. 39, no. 5, pp. 1014-1028, 2016.

[2] R. Kumar, A. K. Tyagi, and A. K. Sharma, "Genome-wide analysis of auxin response factor (ARF) gene family from tomato and analysis of their role in flower and fruit development," Molecular Genetics and Genomics, vol. 285, no. 3, pp. 245-260, 2011.

[3] J. S. Li, X. H. Dai, and Y. D. Zhao, "A role for auxin response factor 19 in auxin and ethylene signaling in Arabidopsis," Plant Physiology, vol. 140, no. 3, pp. 899-908, 2006.

[4] K. Ljung, "Auxin metabolism and homeostasis during plant development," Development, vol. 140, no. 5, pp. 943-950, 2013.

[5] K. Mockaitis and M. Estelle, "Auxin receptors and plant development: a new signaling paradigm," Annual Review of Cell and Developmental Biology, vol. 24, no. 1, pp. 55-80, 2008.

[6] A. Santner and M. Estelle, "Recent advances and emerging trends in plant hormone signalling," Nature, vol. 459, no. 7250, pp. 1071-1078, 2009.

[7] Y. H. Su, Y. B. Liu, B. Bai, and X. S. Zhang, "Establishment of embryonic shoot-root axis is involved in auxin and cytokinin response during Arabidopsis somatic embryogenesis," Frontiers in Plant Science, vol. 5, 2015.

[8] A. W. Woodward and B. Bartel, "Auxin: Regulation, action, and interaction," Annals of Botany, vol. 95, no. 5, pp. 707-735, 2005.

[9] J. Wu, F. Y. Wang, L. Cheng et al., "Identification, isolation and expression analysis of auxin response factor (ARF) genes in

Solarium lycopersicum," Plant Cell Reports, vol. 30, no. 11, pp. 2059-2073, 2011.

[10] T. J. Guilfoyle and G. Hagen, "Auxin response factors," Current Opinion in Plant Biology, vol. 10, no. 5, pp. 453-460, 2007.

[11] E. Liscum and J. W. Reed, "Genetics of Aux/IAA and ARF action in plant growth and development," Plant Molecular Biology, vol. 49, no. 3/4, pp. 387-400, 2002.

[12] T. Ulmasov, G. Hagen, and T. J. Guilfoyle, "ARF1, a transcription factor that binds to auxin response elements," Science, vol. 276, no. 5320, pp. 1865-1868, 1997.

[13] T. Ulmasov, G. Hagen, and T. J. Guilfoyle, "Activation and repression of transcription by auxin-response factors," Proceedings of the National Academy of Sciences, vol. 96, no. 10, pp. 5844-5849, 1999.

[14] J. Kim, K. Harter, and A. Theologis, "Protein-protein interactions among the Aux/IAA proteins," Proceedings of the National Academy of Sciences, vol. 94, no. 22, pp. 11786-11791, 1997.

[15] F. Ouellet, P. J. Overvoorde, and A. Theologis, "IAA17/AXR3: biochemical insight into an auxin mutant phenotype," The Plant Cell Online, vol. 13, no. 4, pp. 829-842, 2001.

[16] R. Shin, A. Y. Burch, K. A. Huppert et al., "The Arabidopsis transcription factor MYB77 modulates auxin signal transduction," The Plant Cell Online, vol. 19, no. 8, pp. 2440-2453, 2007.

[17] G. Hagen and T. Guilfoyle, "Auxin-responsive gene expression: genes, promoters and regulatory factors," Plant Molecular Biology, vol. 49, no. 3/4, pp. 373-385, 2002.

[18] D. K. Wang, K. M. Pei, Y. P. Fu et al., "Genome-wide analysis of the auxin response factors (ARF) gene family in rice (Oryza sativa)," Gene, vol. 394, no. 1-2, pp. 13-24, 2007.

[19] U. C. Kalluri, S. P. Difazio, A. M. Brunner, and G. A. Tuskan, "Genome-wide analysis of Aux/IAA and ARF gene families in Populus trichocarpa," BMC Plant Biology, vol. 7, no. 1, p. 59, 2007.

[20] C. J. Shen, R. Q. Yue, T. Sun et al., "Genome-wide identification and expression analysis of auxin response factor gene family in Medicago truncatula," Frontiers in Plant Science, vol. 6, 2015.

[21] Y. J. Wang, D. X. Deng, Y. T. Shi, N. Miao, Y. L. Bian, and Z. T. Yin, "Diversification, phylogeny and evolution of auxin response factor (ARF) family: insights gained from analyzing maize ARF genes," Molecular Biology Reports, vol. 39, no. 3, pp. 2401-2415, 2012.

[22] C. Finet, A. Berne-Dedieu, C. P. Scutt, and F. Marletaz, "Evolution of the ARF gene family in land plants: old domains, new tricks," Molecular Biology and Evolution, vol. 30, no. 1, pp. 45-56, 2013.

[23] W. Hu, J. Zuo, X. W. Hou et al., "The auxin response factor gene family in banana: genome-wide identification and expression analyses during development, ripening, and abiotic stress," Frontiers in Plant Science, vol. 6, 2015.

[24] Z. C. Xu, A. J. Ji, J. Y. Song, and S. L. Chen, "Genome-wide analysis of auxin response factor gene family members in medicinal model plant Salvia miltiorrhiza," Biology Open, vol. 5, no. 6, pp. 848-857, 2016.

[25] C. X. Yang, M. Xu, L. Xuan, X. M. Jiang, and M. R. Huang, "Identification and expression analysis of twenty ARF genes in Populus," Gene, vol. 544, no. 2, pp. 134-144, 2014.

[26] C. M. Ellis, P. Nagpal, J. C. Young, G. Hagen, T. J. Guilfoyle, and J. W. Reed, "Auxin Response Factor1 and Auxin Response Factor2 regulate senescence and floral organ abscission in Arabidopsis thaliana," Development, vol. 132, no. 20, pp. 4563-4574, 2005.

[27] P. O. Lim, I. C. Lee, J. Kim et al., "Auxin response factor 2 (ARF2) plays a major role in regulating auxin-mediated leaf longevity," Journal of Experimental Botany, vol. 61, no. 5, pp. 1419-1430, 2010.

[28] M. C. Schruff, M. Spielman, S. Tiwari, S. Adams, N. Fenby, and R. J. Scott, "The AUXIN RESPONSE FACTOR 2 gene of Arabidopsis links auxin signalling, cell division, and the size of seeds and other organs," Development, vol. 133, no. 2, pp. 251-261, 2006.

[29] C. S. Hardtke and T. Berleth, "The Arabidopsis gene MONOPTEROS encodes a transcription factor mediating embryo axis formation and vascular development," The EMBO Journal, vol. 17, no. 5, pp. 1405-1411, 1998.

[30] M. Goetz, A. Vivian-Smith, S. D. Johnson, and A. M. Koltunow, "AUXIN RESPONSE FACTOR8 is a negative regulator of fruit initiation in Arabidopsis," The Plant Cell Online, vol. 18, no. 8, pp. 1873-1886, 2006.

[31] Y. Okushima, H. Fukaki, M. Onoda, A. Theologis, and M. Tasaka, "ARF7 and ARF19 regulate lateral root formation via direct activation of LBD/ASL genes in Arabidopsis," The Plant Cell Online, vol. 19, no. 1, pp. 118-130, 2007.

[32] K. A. Attia, A. F. Abdelkhalik, M. H. Ammar et al., "Antisense phenotypes reveal a functional expression of OsARF1, an auxin response factor, in transgenic rice," Current Issues in Molecular Biology, vol. 11, Supplement 1, pp. i29-i34, 2009.

[33] C. J. Shen, R. Q. Yue, T. Sun, L. Zhang, Y. J. Yang, and H. Z. Wang, "OsARF16, a transcription factor regulating auxin redistribution, is required for iron deficiency response in rice (Oryza sativa L.)," Plant Science, vol. 231, pp. 148-158, 2015.

[34] M. Jain and J. P. Khurana, "Transcript profiling reveals diverse roles of auxin-responsive genes during reproductive development and abiotic stress in rice," FEBS Journal, vol. 276, no. 11, pp. 3148-3162, 2009.

[35] S. K. Wang, Y. H. Bai, C. J. Shen et al., "Auxin-related gene families in abiotic stress response in Sorghum bicolor," Functional & Integrative Genomics, vol. 10, no. 4, pp. 533-546, 2010.

[36] B. Anderson, J. K. Ward, K. P. Vogel, M. G. Ward, H. J. Gorz, and F. A. Haskins, "Forage quality and performance of yearlings grazing switchgrass strains selected for differing digestibility," Journal of Animal Science, vol. 66, no. 9, pp. 2239-2244, 1988.

[37] S. B. McLaughlin and L. Adams Kszos, "Development of switchgrass (Panicum virgatum) as a bioenergy feedstock in the United States," Biomass and Bioenergy, vol. 28, no. 6, pp. 515-535, 2005.

[38] J. Y. Zhang, Y. C. Lee, I. Torres-Jerez et al., "Development of an integrated transcript sequence database and a gene expression atlas for gene discovery and analysis in switchgrass (Panicum virgatum L.)," The Plant Journal, vol. 74, no. 1, pp. 160-173, 2013.

[39] Z. Wu, Y. Cao, R. Yang et al., "Switchgrass SBP-box transcription factors PvSPL1 and 2 function redundantly to initiate side tillers and affect biomass yield of energy crop," Biotechnology for Biofuels, vol. 9, no. 1, p. 101, 2016.

[40] S. Yuan, B. Xu, J. Zhang et al., "Comprehensive analysis of CCCH-type zinc finger family genes facilitates functional gene discovery and reflects recent allopolyploidization event in tetraploid switchgrass," BMC Genomics, vol. 16, no. 1, p. 129, 2015.

[41] R. E. Voorrips, "MapChart: software for the graphical presentation of linkage maps and QTLs," Journal of Heredity, vol. 93, no. 1, pp. 77-78, 2002.

[42] M. Okada, C. Lanzatella, M. C. Saha, J. Bouton, R. L. Wu, and C. M. Tobias, "Complete switchgrass genetic maps reveal subgenome collinearity, preferential pairing and multilocus interactions," Genetics, vol. 185, no. 3, pp. 745-760, 2010.

[43] S. B. Cannon, A. Mitra, A. Baumgarten, N. D. Young, and G. May, "The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana," BMC Plant Biology, vol. 4, no. 1, p. 10, 2004.

[44] K. Higo, Y. Ugawa, M. Iwamoto, and T. Korenaga, "Plant cis-acting regulatory DNA elements (PLACE) database: 1999," Nucleic Acids Research, vol. 27, no. 1, pp. 297-300, 1999.

[45] N. Goldman and Z. Yang, "A codon-based model of nucleotide substitution for protein-coding DNA sequences," Molecular Biology and Evolution, vol. 11, no. 5, pp. 725-736, 1994.

[46] Z. Y. Wu, X. Q. Xu, W. D. Xiong et al., "Genome-wide analysis of the NAC gene family in physic nut (Jatropha curcas L.)," PLoS One, vol. 10, no. 6, article e0131890, 2015.

[47] X. C. Luo, M. H. Sun, R. R. Xu, H. R. Shu, J. W. Wang, and S. Z. Zhang, "Genomewide identification and expression analysis of the ARF gene family in apple," Journal of Genetics, vol. 93, no. 3, pp. 785-797, 2014.

[48] Y. X. Xu, J. Mao, W. Chen et al., "Identification and expression profiling of the auxin response factors (ARFs) in the tea plant (Camellia sinensis (L.) O. Kuntze) under various abiotic stresses," Plant Physiology and Biochemistry, vol. 98, pp. 46-56, 2016.

[49] N. Fahlgren, T. A. Montgomery, M. D. Howell et al., "Regulation of AUXIN RESPONSE FACTOR3 by TAS3 ta-siRNA affects developmental timing and patterning in Arabidopsis," Current Biology, vol. 16, no. 9, pp. 939-944, 2006.

Jianli Wang (iD), (1,2,3) Zhenying Wu (iD), (2) Zhongbao Shen, (3) Zetao Bai, (2) Peng Zhong, (4) Lichao Ma, (2) Duofeng Pan, (3) Ruibo Zhang, (3) Daoming Li, (3) Hailing Zhang, (3) Chunxiang Fu, (2) Guiqing Han (iD), (1,3) and Changhong Guo (iD) (1)

(1) College of Life Science and Technology of Harbin Normal University, Harbin 150080, China

(2) Key Laboratory of Biofuels, Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao 266101, China

(3) Grass and Science Institute of Heilongjiang Academy of Agricultural Sciences, Harbin, Heilongjiang 150086, China

(4) Rural Energy Research Institute of Heilongjiang Academy of Agricultural Sciences, Harbin, Heilongjiang 150086, China

Correspondence should be addressed to Guiqing Han; ccyj15@163.com and Changhong Guo; guochanghong2016@163.com

Received 16 October 2017; Accepted 11 April 2018; Published 29 April 2018

Academic Editor: Graziano Pesole

Caption: Figure 1: Chromosomal distribution of ARF genes in switchgrass. Distribution on the chromosomes (vertical bar) indicate the position of centromeres. The chromosome numbers (except for Chromosome 2a, 2b, 8a, and 8b) are indicated at the top of each chromosome image. The purple solid lines show the gene pairs, and the red dotted lines represent the putative gene pairs according to the sequence similarity.

Caption: Figure 2: Phylogenetic analysis of the ARF proteins in switchgrass and other plant species. An unrooted neighbor-joining (bootstrap value = 1000) tree was constructed using MEGA5 on the basis of multiple alignments of conserved domain sequences of the ARF proteins from monocot species (switchgrass, foxtail millet, maize, sorghum, rice, and Brachypodium) and dicot species (Arabidopsis, sweet orange, Chinese cabbage, poplar, Medicago, cotton, soybean, tomato, Grandis, and grape). And the detailed information was listed in Table S2.

Caption: Figure 3: Exon/intron structure of PvARF genes. (a) Phylogenetic tree of PvARF proteins constructed using MEGA5 based on the multiple alignments of full-length amino acids. (b) Exon/intron arrangements of PvARF genes. Exons and introns are represented by green boxes (open reading frame in green, untranslated region (UTR) in gray), and black lines, respectively, and their sizes are indicated by the scale at the bottom. The red vertical bar denotes the targets of Osa-miR167a in PvARF genes; the red arrows denotes the targets of Osa-miR160a in PvARF genes. (c) Schematic representation of conserved motifs in the PvARF proteins predicted by MEME. Each motif is represented by a number in the colored box. The black lines represent nonconserved sequences. Lengths of motifs for each PvARF protein were exhibited proportionally.

Caption: Figure 5: Heatmap of expression profiles of the PvARF gene pairs in different tested tissues. The data was collected from switchgrass gene atlas database. Clustering analysis was carried out using Genesis program (v1.7.6).

Caption: Figure 6: The expression of PvARF genes in the vegetative organs. The expression of PvARF genes in the second internodes (I2), the third internodes (I3), the fourth internodes (I4), the second leaves (L2), the third leaves (L3), and the fourth leaves (L4) of switchgrass. Relative transcript levels are calculated by qRT-PCR. Data are means [+ or -] SE of three separate measurements.

Caption: Figure 7: The expression of PvARF genes in response to treatment with 5 NAA solution for 1, 2, and 3 hours. Control plants were grown in hormone-free medium. Error bars represented variability of qRT-PCR results from three replicates. Data are means [+ or -] SE of three separate measurements. Statistically significant differences were assessed using Student's t-tests (** P < 0.01).
Table 1: The information of ARF family genes in switchgrass.

                                           Deduced polypeptide (d)

Gene                        ORF length   Length      MW
name (a)     Gene ID (b)     (bp) (c)     (aa)     (kDa)      pl

PvARF1      Pavir.Ca02838      2685        894      98.5     5.75
PvARF2      Pavir.Cb00190      2136        711       78      6.02
PvARF3      Pavir.Da00065      2739        912     100.8     5.92
PvARF4      Pavir.Db00366      2781        926     102.1     5.81
PvARF5      Pavir.Aa03303      2721        906      99.5     5.58
PvARF6      Pavir.Ab00451      2715        904      99.5     5.54
PvARF7      Pavir.Ga00205      2502        833      92.8     6.03
PvARF8      Pavir.Gb00274      1992        663      73.7     5.33
PvARF9      Pavir.Da01885      1296        431      48.1     8.45
PvARF10     Pavir.Db01975      2205        734       81      5.6
PvARF11     Pavir.Fb01896      3282       1093     121.4     6.07
PvARF12     Pavir.Fa00483      3255       1084     120.3     6.14
PvARF13     Pavir.J00164       3549       1182     130.9     6.29
PvARF14     Pavir.Db00232      3231       1076      120      6.28
PvARF15     Pavir.J32718       3246       1081     120.5     6.08
PvARF16     Pavir.Ab00366      3174       1057     117.6     6.14
PvARF17     Pavir.Gb00117      2829        942     104.3     5.81
PvARF18     Pavir.Ga00157      2838        945     104.5     5.77
PvARF19     Pavir.J03524       1554        517      56.3     6.24
PvARF20     Pavir.J37640       1548        515       56      6.16
PvARF21     Pavir.Ia01695      2040        679      74.4     9.3
PvARF22     Pavir.Ib03238      1374        457      50.1     6.33
PvARF23     Pavir.Da00107      2061        686      74.9     7.04
PvARF24     Pavir.J26437       2067        688      74.8     7.27
PvARF25     Pavir.Aa01271      1836        611      65.4     9.52
PvARF26     Pavir.J17862       1335        444      47.7     8.55
PvARF27     Pavir.Gb00635      1851        616      66.1     8.8
PvARF28     Pavir.J24081       2118        705      75.7     7.35
PvARF29     Pavir.J08401       2214        737      80.5     7.15
PvARF30     Pavir.Ca00928      1716        571      63.3     9.24
PvARF31     Pavir.Eb02716      2133        710      78.5     6.18
PvARF32     Pavir.J35323       1065        354      39.5     7.62
PvARF33     Pavir.J38128       1104        367      40.6     7.98
PvARF34     Pavir.J17623       732         243      27.4     8.97
PvARF35     Pavir.J17853       2214        737      79.7     7.82
PvARF36     Pavir.Eb03157      2049        682      74.1     6.66
PvARF37     Pavir.Cb00753      2202        733       82      6.26
PvARF38     Pavir.Ca02218      1560        519       58      6.66
PvARF39     Pavir.J22605       1143        380      43.1     9.3
PvARF40     Pavir.Eb03734      2430        809      90.7     6.1
PvARF41     Pavir.Ea03860      2433        810      90.8     6.05
PvARF42     Pavir.Ea00026      2064        687      76.6     5.58
PvARF43     Pavir.Eb00045      2064        687      76.7     5.62
PvARF44     Pavir.Ab01961      1440        479      53.7     7.28
PvARF45     Pavir.Aa01676      2136        711      79.3     5.88
PvARF46     Pavir.Gb01617      1986        661      73.5     5.77
PvARF47     Pavir.Ga01750      1923        640      71.1     6.35

Gene        Number of
name (a)    intron (e)     Chr (f)      Chr locations (g)

PvARF1          13            3a        47617320-47623645
PvARF2          7             3b         3249145-3252725
PvARF3          13            4a         1765253-1771355
PvARF4          13            4b         4362788-4368192
PvARF5          13            1a        67423915-67430303
PvARF6          13            1b         4856121-4861815
PvARF7          13            7a         3171190-3179787
PvARF8          11            7b        3192562-3,197923
PvARF9          10            4a        42434950-42439045
PvARF10         13            4b        43526790-43533795
PvARF11         12            6b        48581098-48587963
PvARF12         12            6a         7216236-7223377
PvARF13         14       contig00149       16339-25992
PvARF14         11            4b         3367149-3373291
PvARF15         11       contig39521         1-6360
PvARF16         11            1b         4304985-4314018
PvARF17         12            7b         1282083-1288213
PvARF18         12            7a         2852206-2858929
PvARF19         2        contig04638       11091-14207
PvARF20         3        contig69503         1 -2970
PvARF21         4             9a        20465406-20472448
PvARF22         2             9b        52838875-52843142
PvARF23         2             4a         2050051-2053504
PvARF24         2        contig29414        2799-7192
PvARF25         3             1a        16431915-16436701
PvARF26         2        contig196091        4-1855
PvARF27         2             7b         7512630-7516588
PvARF28         2        contig263498        76-1753
PvARF29         10       contig11657        2523-8428
PvARF30         8             3a        10393086-10397991
PvARF31         9             5b        59020641-59026106
PvARF32         6        contig52555        409-3563
PvARF33         7        contig73490        486-4550
PvARF34         5        contig193925       123-2287
PvARF35         9        contig19600        3358-9328
PvARF36         9             5b        65190090-65198384
PvARF37         11            3b        15971362-15976212
PvARF38         6             3a        36368836-36372762
PvARF39         7        contig24640        4150-7685
PvARF40         13            5b        71953597-71958902
PvARF41         13            5a        61521645-61526769
PvARF42         11            5a          658461-662814
PvARF43         11            5b          655839-660061
PvARF44         12            1b        38024228-38038833
PvARF45         12            1a        22183544-22188794
PvARF46         13            7b        21374440-21379797
PvARF47         12            7a        21881663-21886932

(a) Names referred to the identified PvARF genes in switchgrass in
this work. (b) The alias of each ARF gene in iTAG 2.30 genome
annotation. (c) Length of open reading frame in base pairs. (d) The
number of amino acids, molecular weight (kilodaltons), and
isoelectric point of deduced polypeptide calculated by DNASTAR. (e)
The number of intron. (f,g) Chromosome location from Phytozome
(https://phytozome.jgi.doe.gov/).

Table 2: Ka/Ks calculation of ARF genes between switchgrass and
rice.

                                Ka/Ks
Othologs                        ratio      Selection pattern

PvARF1 (2) versus OsARF25        1.61     Positive selection
PvARF3 (4) versus OsARF6        98.11     Positive selection
PvARF5 (6) versus OsARF17        2.19     Positive selection
PvARF8 (7) versus OsARF12       76.96     Positive selection
PvARF10 (9) versus OsARF16      99.00     Positive selection
PvARF11 (12) versus OsARF21      0.54     Purifying selection
PvARF14 (13) versus OsARF19      7.51     Positive selection
PvARF15 (16) versus OsARF5       9.13     Positive selection
PvARF17 (18) versus OsARF11      0.44     Purifying selection
PvARF19 (20) versus OsARF13      3.91     Positive selection
PvARF21 (22) versus OsARF22     14.81     Positive selection
PvARF23 (24) versus OsARF18      0.93     Purifying selection
PvARF25 (26) versus OsARF8       2.14     Positive selection
PvARF27 (28) versus OsARF10      0.06     Purifying selection
PvARF30 (29) versus OsARF15      2.81     Positive selection
PvARF31 (32) versus OsARF2       3.32     Positive selection
PvARF33 (34) versus OsARF14      3.81     Positive selection
PvARF36 (35) versus OsARF3       3.99     Positive selection
PvARF38 (37) versus OsARF24      0.29     Purifying selection
PvARF39 versus OsARF23           1.22     Positive selection
PvARF40 (41) versus OsARF4       0.61     Purifying selection
PvARF42 (43) versus OsARF1       1.75     Positive selection
PvARF45 (44) versus OsARF7      99.00     Positive selection
PvARF47 (46) versus OsARF9       2.38     Positive selection

Figure 4: Putative microRNA160 and microRNA167 targeted binding
sites of the PvARF genes. (a) Putative microRNA160 targeted binding
sites of the PvARF genes. (b) Putative microRNA167 targeted binding
sites of the PvARF genes.

(a)

PvARF19          1197    TGGCATGCAGGGAGCCAGGCA       1217
PvARF20          1191    TGGCATGCAGGGAGCCAGGCA       1211
PvARF23          1330    -GGCATACAGGGAGCCAGGCA       1349
PvARF24          1330    -GGCATGCAGGGAGCCAGGCA       1349
PvARF25          1086    -GCCATACAGGGAGCCAGGCA       1105
PvARF26           594    -GCCATACAGGGAGCCAGGCA       613
PvARF27          1411    TGGCATGCAGGGAGCCAGGCA       1430
PvARF28          1448    -GGCATGCAGGGACCCAGGCA       1467
OsamiR160a         5'    -UGCCUGGCUCCCUGUAUGCCA-3'

(b)

PvARF1           2435    ACAAGCTGCCAGCCTGATCTT       2415
PvARF2           1886    ACAAGCTGCCAGCCTGATCTT       1866
PvARF3           2492    ACAAGCTGCCAGCCTGATCTC       2472
PvARF4           1534    ACAAGCTGCCAGCCTGATCTC       2514
PvARF5           1474    ACAAGCTGCCAGCCTGATCTC       2454
PvARF6           2468    ACAAGCTGCCAGCCTGATCTT       2448
PvARF7           2354    ACAAGCTGCCAGCCTGATCTA       2334
PvARF8           1937    ACAAGCTGCCAGCCTGATCTA       1917
OsamiR167a         5'    -UGAAGCUGCCAGCAUGAUCUA-3'
COPYRIGHT 2018 Hindawi Limited
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2018 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research Article
Author:Wang, Jianli; Wu, Zhenying; Shen, Zhongbao; Bai, Zetao; Zhong, Peng; Ma, Lichao; Pan, Duofeng; Zhang
Publication:International Journal of Genomics
Date:Jan 1, 2018
Words:7806
Previous Article:Transcriptome Analysis of the Thymus in Short-Term Calorie-Restricted Mice Using RNA-seq.
Next Article:Differential Expression Profiling of Long Noncoding RNA and mRNA during Osteoblast Differentiation in Mouse.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters