Printer Friendly

Genetic polymorphism of manganese superoxide dismutase in Behcet's disease.

Behcet's disease (BD) is a chronic, multi-systemic, relapsing, and inflammatory disorder characterized by ocular manifestations, in particular. (1) It is also characterized by uveitis, recurrent oral ulceration, genital ulceration, and skin lesions. BD exists worldwide, but it is relatively more widespread in Middle Eastern and East Asian countries including Japan. (2) The effect of autoimmune response and genetic factors on etiology of BD was well established. (2) However, the etiologic mechanisms underlying this vascular disease have not been well understood yet. Reactive oxygen species (ROS) have been hypothesized to play an important role in BD. Evidence from several studies suggests that neutrophils from patients with BD generate high levels of ROS and then this stress causes endothelial cell lysis in vitro. (3-5) On the other hand, different data reported in the literature show a variation for the activities of antioxidant enzymes in BD: erythrocyte superoxide dismutase (SOD) activity was found to be increased, (4,6,7) unchanged, (8) and decreased, (5,9) glutathione reductase activity was found to be increased, (7) catalase, glutathione reductase and glutathione peroxidase (GPx) activities were found to be decreased, (5-9) and ultimately, erythrocyte catalase activity was found to be unchanged (4) in BD patients.

Superoxide dismutase is an enzyme catalyzing the dismutation reaction of superoxide radicals to hydrogen peroxide. (10,11) SOD, a key antioxidant enzyme, is a family of enzymes, comprising copper, zink-SOD, manganese (Mn)-SOD, and extracellular SOD, whose function is protection against ROS. (2,12) Mn-SOD gene is located on chromosome 6q25 in mitochondria and it consists of five exons. Valine-to-alanine (Val-to-Ala) substitution at codon 16 of human Mn-SOD might lead to misdirected intracellular trafficking followed by changes in Mn-SOD activity in the mitochondria. (2,13,14) In this study, we aimed to investigate the genetic association between single nucleotide mutation in mitochondrial Mn-SOD and a BD population by using molecular techniques.

PATIENTS AND METHODS

This multicenter study included 93 BD patients (45 males, 48 females; mean age 33.15 [+ or -] 8.99 years; range 17 to 65 years) and 125 controls (58 males, 67 females; mean age 28.33 [+ or -] 7.31 years; range 18 to 62 years) between October 2004 and July 2005. Clinical and demographic data were recorded. The study was approved by the local non-invasive clinical research ethics committee. All of the participants provided written informed consent. Patients were diagnosed according to the International Study Group for BD. (15)

Blood samples (5-10 mL), taken in ethylenediaminetetraacetic acid containing tubes during vascular access established for the normal clinical biochemistry tests of participants, were obtained from volunteer BD patients. Characteristics of patient and control groups were summarized in Table 1. Genomic deoxyribonucleic acid (DNA) was isolated from 300 [micro]L blood using Promega Wizard Genomic DNA purification Kit (Promega Corp., Madison, WI, USA). Isolation process was performed according to the manufacturer's recommendations. (16) The DNA was dissolved in 1X TE buffer by mixing and stored at -20[degrees]C.

The signal sequence-containing region was amplified by polymerase chain reaction (PCR) using Mn-SOD forward and reverse primers in accordance with previous reports. (16-18) Oligonucleotides were purchased from Iontek (Iontek Medical A.$. Molekuler Biyoloji ve Genetik Laboratuvari, Istanbul, Turkey). An Ala/Val polymorphism in the signal peptide of Mn-SOD gene was evaluated using a primer pair (forward 5' ACCAGCAGGCAGCTGGCGCCGG 3' and reverse 5' GCGTTGATGTGAGGT TCCAG 3') to amplify a 107 bp fragment followed by digestion with the NgoM IV gene from Neisseria gonorrhoeae MS11 (NgoM IV) recognizes the nucleotide sequence as a restriction site GCCGGC (Figure 1). PCR amplification of genes was performed in a total volume of 50 [micro]L, containing 50 ng of genomic DNA, 20 pmol [micro][L.sup.-1] of each primer, 1.25 U Taq polymerase (in 50 mM Trishydrochloride, 100 mM sodium chloride, 0.1 mM ethylenediaminetetraacetic acid, 1 mM dithiothreitol, 50% glycerol and 1% Triton X-100), 2 mM deoxy nucleotide triphosphate, 2 mM MgCl2, 1X PCR buffer containing 50 mM potassium chloride, 10 mM Tris-hydrochloride (pH 8.3 at 25[degrees]C) (Promega Madison, WI, USA). The PCR reaction conditions involved an initial denaturation of DNA at 95[degrees]C for five minutes, followed by 35 cycles of amplification at 95[degrees]C for one minute (melting), 61[degrees]C for one minute (annealing) and 72[degrees]C for two minutes, and final extension at 72[degrees]C for seven minutes in a thermal cycler. The resulting 107 bp PCR product was digested with the restriction endonuclease NgoM IV at 37[degrees]C for 16 hours according to the manufacturer's recommendations (5 [micro]L PCR product was digested in total volume of 10 [micro]L using buffer including bovine serum albumin and 1 [micro]L NgoM IV (5 U [micro][L.sup.-1]) restriction enzyme.

Isolated chromosomal DNAs were run on 1% agarose gel at 100V for an hour and stained with ethidium bromide (0.5 g [micro]L-1). Tris-Borateethylenediaminetetraacetic acid buffer (0.5X) was used as running buffer. Digested PCR product was run on 3% MetaPhor agarose. Restriction enzyme digestion results in a 107 bp product (allele 1 Val-9) or 89 and 18 bp products (allele 2 Ala-9).

[FIGURE 1 OMITTED]

Statistical analysis

Allele and genotype frequencies between BD patients and controls were compared by Chi-square test using the SPSS for Windows version 16.0 software program (SPSS Inc., Chicago, IL, USA). Allele frequencies were calculated by Internet based Pop-Gen 3.2 software. Differences in the demographic characteristics of patients were assessed among the three Mn-SOD genotypes using one-way analyses of variance (ANOVA). The Chi-square test was used to compare the distribution of genotypes and allele frequencies for deviations from Hardy-Weinberg equilibrium.

RESULTS

Analysis results showed that maximum cleavage site was between position 18 and 19 (Figure 1).

When restriction amplification region had band sizes of 89 bp and 18 bp, this genotype was called homozygote (Val/Val). When restriction resulted in band sizes of 107 bp, 89 bp, and 18 bp, this genotype was called heterozygote (Ala/Val). The allele and genotype frequencies of the subjects for the Ala-9Val Mn-SOD polymorphism were shown in Table 1. If the -9 codon was GCT (Ala), then digestion with NgoM IV produced two DNA fragments, 89 and 18 bp in length. If codon was GTT (Val), the amplified product was not digested with NgoM IV and remained as a whole 107 bp DNA fragment. Genotype of Ala-9Val polymorphism in BD and control groups were shown in Table 1. The genotype distributions of BD and control groups were within the Hardy-Weinberg equilibrium. There was no sex or age-dependent difference between the groups. Significant difference was found in genotype frequencies between BD and control groups ([X.sup.2]=6.793, df=2, p=0.033). The frequency of Val-9 was more common both in BD patients and controls. No significant difference was found in allele frequencies between BD patients and controls (Table 1, Figure 2).

[FIGURE 2 OMITTED]

DISCUSSION

Proteins secreted out of the cell generally contain an intrinsic signal that governs their passage across membranes and cell walls. Specific amino acid sequences determine whether a protein will pass through a membrane, become integrated into the membrane, or be exported out of the cell. These signal sequences are present either as a short tail at one end of the protein or sometimes located within the protein. The method program is available under the prediction server page of Center for Biological Sequence analysis http://www.cbs.dtu.dk/services/SignalP/). SignalP looks at charge distribution and a unique composition of the hydrophobic region.

It is known that Mn-SOD gene is polymorphic. (13) We identified a significant association between development of BD disease and Mn-SOD Val-9Ala polymorphism. The Val/Val genotype of the Mn-SOD gene can be a novel genetic marker of risk factor for BD in Turkish people. Our results were similar to those of Nakao et al., (2) who showed a significant difference in the allele and genotype frequencies of the Mn-SOD Ala16Val polymorphism between BD patients and control subjects in Japan. On the other hand, Yen et al. (19) found no significant difference in the frequencies of Mn-SOD gene polymorphisms between BD patients and controls in Taiwan.

Many studies were carried out on Mn-SOD polymorphisms in various diseases. While some of these studies report a significant similarity between polymorphisms in patients and controls, some does not. Cox et al. (20) reported that Mn-SOD gene was associated with an increased risk of breast cancer. Whereas Lightfoot et al. (21) suggested that no association was observed between Val16Ala and total non-Hodgkin's lymphoma, diffuse large-B cell lymphoma or follicular lymphoma in the UK and USA. Akyol et al. (18) suggested that when the patients with schizophrenia were divided into three subgroups as disorganized, paranoid and residual, there was a significant difference in Mn-SOD genotypic distribution among the subgroups. It has been shown that SOD Ala-16Val polymorphism is an age-dependent modulator of oxidized low-density lipoprotein cholesterol levels in middle-aged males and elderly females. (22) The Ala-9Val polymorphism in the mitochondrial targeting sequence of the Mn-SOD gene is not associated with juvenile-onset asthma in Turkish population. (23) The Ala-9Val polymorphisms in the mitochondrial targeting sequence may influence the efficiency of Mn-SOD transport into mitochondria. (18) It has been shown that Mn-SOD genotypes containing the variant A allele were found to be associated with a 1.5-fold increased risk of breast cancer compared with those with the homozygous wild-type genotype (Mn-SOD VV). (17)

Taysi et al. (7) found that erythrocyte SOD activities were increased in BD compared to healthy controls whereas the other antioxidant enzymes, glutathione S transferase, catalase, and GPx were decreased. In another study, which investigated the oxidant-antioxidant status in whole blood from BD and controls, GPx was found to be decreased similarly to the previous paper. (8) Aydin et al. (24) found increased malondialdehyde levels, decreased GPx activity and non-significant changes in SOD activity in the serum of the patients. SOD activity was demonstrated to be increased in erythrocyte from BD patients in another study. (4) All of the above-mentioned studies suggest that there is a changing pattern of oxidative stress and antioxidant system in BD and antioxidant system in plasma, erythrocyte, and other body fluids and cells have been commonly declined. This is important because there is huge amount of oxidative stress parameters which were produced by different metabolic processes in physiological metabolism of the body that need to be scavenged by SOD and other antioxidant enzymes. (25-27) Therefore, we aimed to show the genetic clues and supporting data on this topic.

Nakao et al. (2) investigated the association of Mn-SOD and extracellular SOD gene polymorphism as well as endothelial and inducible nitric oxide synthase genes with susceptibility to BD in Japan. They found increased Mn-SOD Val16 frequencies in patients with BD. They alleged that Mn-SOD V/V genotype and human leukocyte antigen-B*5101 had a synergistic role in controlling susceptibility to BD. There were no significant differences in the frequencies of extracellular SOD gene polymorphism (Arg213Gly) as well as nitric oxide synthase gene polymorphism between patients and controls. (2) Our results conform with results of this study and give us some important clues about the underlying mechanism of BD in relation to oxidative stress. Another research on the same topic from Taiwan reported no significant difference in the allele and genotype frequencies of the Mn-SOD Ala/Val polymorphism between BD and control. (19) These differences between the studies might be originated from the racial and ethnic differences for the related genes.

Valine to alanine substitution may increase the targeting efficiency by a conformational change of the targeting sequence, consequently leading to increased mitochondrial ROS scavenging capability. (28) The presence of more than one signal sequence for this enzyme suggests a combinatorial mechanism determining the rates of targeting, membrane translocation and/or signal sequence cleavage with concomitant folding of Mn-SOD. (13) Sutton et al. (29) showed that the Ala-Mn-SOD/mitochondrial targeting sequence allows efficient Mn-SOD import into the mitochondrial matrix, while the Val-variant causes partial arrest of the precursor within the inner membrane and decreased formation of the active Mn-SOD tetramer in the mitochondrial matrix. In conclusion, the results of this study suggest that the Val/Val genotype of the Mn-SOD gene is associated with the physiopathology of BD in a group of Turkish patients.

doi: 10.5606/ArchRheumatol.2016.5645

Declaration of conflicting interests

The authors declared no conflicts of interest with respect to the authorship and/or publication of this article.

Funding

The authors received no financial support for the research and/or authorship of this article.

REFERENCES

(1.) Sogut S, Aydin E, Elyas H, Aksoy N, Ozyurt H, Totan Y, et al. The activities of serum adenosine deaminase and xanthine oxidase enzymes in Behcet's disease. Clin Chim Acta 2002; 325:133-8.

(2.) Nakao K, Isashiki Y, Sonoda S, Uchino E, Shimonagano Y, Sakamoto T. Nitric oxide synthase and superoxide dismutase gene polymorphisms in Behget disease. Arch Ophthalmol 2007; 125:246-51.

(3.) Niwa Y, Miyake S, Sakane T, Shingu M, Yokoyama M. Auto-oxidative damage in Behget's disease--endothelial cell damage following the elevated oxygen radicals generated by stimulated neutrophils. Clin Exp Immunol 1982; 49:247-55.

(4.) Gunduz K, Ozturk G, Sozmen EY. Erythrocyte superoxide dismutase, catalase activities and plasma nitrite and nitrate levels in patients with Behget disease and recurrent aphthous stomatitis. Clin Exp Dermatol 2004; 29:176-9.

(5.) Erkilig K, Evereklioglu C, Cekmen M, Ozkiris A, Duygulu F, Dogan H. Adenosine deaminase enzyme activity is increased and negatively correlates with catalase, superoxide dismutase and glutathione peroxidase in patients with Behget's disease: original contributions/clinical and laboratory investigations. Mediators Inflamm 2003; 12:107-16.

(6.) Dincer Y, Alademir Z, Hamuryudan V, Fresko I, Akcay T. Superoxide dismutase activity and glutathione system in erythrocytes of men with Behchet's disease. Tohoku J Exp Med 2002; 198:191-5.

(7.) Taysi S, Demircan B, Akdeniz N, Atasoy M, Sari RA. Oxidant/antioxidant status in men with Behget's disease. Clin Rheumatol 2007; 26:418-22.

(8.) Buldanlioglu S, Turkmen S, Ayabakan HB, Yenice N, Vardar M, Dogan S, et al. Nitric oxide, lipid peroxidation and antioxidant defence system in patients with active or inactive Behget's disease. Br J Dermatol 2005; 153:526-30.

(9.) Saglam K, Serce AF, Yilmaz MI, Bulucu F, Aydin A, Akay C, et al. Trace elements and antioxidant enzymes in Behget's disease. Rheumatol Int 2002; 22:93-6.

(10.) Akyol S, Erdogan S, Idiz N, Celik S, Kaya M, Ucar F, et al. The role of reactive oxygen species and oxidative stress in carbon monoxide toxicity: an in-depth analysis. Redox Rep 2014; 19:180-9.

(11.) Ucar F, Sezer S, Erdogan S, Akyol S, Armutcu F, Akyol O. The relationship between oxidative stress and nonalcoholic fatty liver disease: Its effects on the development of nonalcoholic steatohepatitis. Redox Rep 2013; 18:127-33.

(12.) Wang LM, Kitteringham N, Mineshita S, Wang JZ, Nomura Y, Koike Y, et al. The demonstration of serum interleukin-8 and superoxide dismutase in Adamantiades-Behget's disease. Arch Dermatol Res 1997; 289:444-7.

(13.) Rosenblum JS, Gilula NB, Lerner RA. On signal sequence polymorphisms and diseases of distribution. Proc Natl Acad Sci U S A 1996; 93:4471-3.

(14.) Shimoda-Matsubayashi S, Matsumine H, Kobayashi T, Nakagawa-Hattori Y, Shimizu Y, Mizuno Y. Structural dimorphism in the mitochondrial targeting sequence in the human manganese superoxide dismutase gene. A predictive evidence for conformational change to influence mitochondrial transport and a study of allelic association in Parkinson's disease. Biochem Biophys Res Commun 1996; 226:561-5.

(15.) Criteria for diagnosis of Behget's disease. International Study Group for Behget's Disease. Lancet 1990; 335:1078-80.

(16.) Akyol O, Canatan H, Yilmaz HR, Yuce H, Ozyurt H, Sogut S, et al. PCR/RFLP-based cost-effective identification of SOD2 signal (leader) sequence polymorphism (Ala-9Val) using NgoM IV: a detailed methodological approach. Clin Chim Acta 2004; 345:151-9.

(17.) Mitrunen K, Sillanpaa P, Kataja V, Eskelinen M, Kosma VM, Benhamou S, et al. Association between manganese superoxide dismutase (MnSOD) gene polymorphism and breast cancer risk. Carcinogenesis 2001; 22:827-9.

(18.) Akyol O, Yanik M, Elyas H, Namli M, Canatan H, Akin H, et al. Association between Ala-9Val polymorphism of Mn-SOD gene and schizophrenia. Prog Neuropsychopharmacol Biol Psychiatry 2005; 29:123-31.

(19.) Yen JH, Tsai WC, Lin CH, Ou TT, Hu CJ, Liu HW. Cytochrome P450 1A1 and manganese superoxide dismutase gene polymorphisms in Behget's disease. J Rheumatol 2004; 31:736-40.

(20.) Cox DG, Tamimi RM, Hunter DJ. Gene x Gene interaction between MnSOD and GPX-1 and breast cancer risk: a nested case-control study. BMC Cancer 2006; 6:217.

(21.) Lightfoot TJ, Skibola CF, Smith AG, Forrest MS, Adamson PJ, Morgan GJ, et al. Polymorphisms in the oxidative stress genes, superoxide dismutase, glutathione peroxidase and catalase and risk of non-Hodgkin's lymphoma. Haematologica 2006; 91:1222-7.

(22.) Dedoussis GV, Kanoni S, Panagiotakos DB, Louizou E, Grigoriou E, Chrysohoou C, et al. Age-dependent dichotomous effect of superoxide dismutase Ala16Val polymorphism on oxidized LDL levels. Exp Mol Med 2008; 40:27-34.

(23.) Gurel A, Tomac N, Yilmaz HR, Tekedereli I, Akyol O, Armutcu F, et al. The Ala-9Val polymorphism in the mitochondrial targeting sequence (MTS) of the manganese superoxide dismutase gene is not associated with juvenile-onset asthma. Clin Biochem 2004; 37:1117-20.

(24.) Aydin E, Sogut S, Ozyurt H, Ozugurlu F, Akyol O. Comparison of serum nitric oxide, malondialdehyde levels, and antioxidant enzyme activities in Behget's disease with and without ocular disease. Ophthalmic Res 2004; 36:177-82.

(25.) Ilhan A, Iraz M, Gurel A, Armutcu F, Akyol O. Caffeic acid phenethyl ester exerts a neuroprotective effect on CNS against pentylenetetrazol-induced seizures in mice. Neurochem Res 2004; 29:2287-92.

(26.) Erdogan H, Fadillioglu E, Ozgocmen S, Sogut S, Ozyurt B, Akyol O, et al. Effect of fish oil supplementation on plasma oxidant/antioxidant status in rats. Prostaglandins Leukot Essent Fatty Acids 2004; 71:149-52.

(27.) Yildirim Z, Turkoz Y, Kotuk M, Armutcu F, Gurel A, Iraz M, et al. Effects of aminoguanidine and antioxidant erdosteine on bleomycin-induced lung fibrosis in rats. Nitric Oxide 2004; 11:156-65.

(28.) Yuce H, Hepsen IF, Tekedereli I, Keskin U, Elyas H, Akyol O. Lack of association between pseudoexfoliation syndrome and manganese superoxide dismutase polymorphism. Curr Eye Res 2007; 32:387-91.

(29.) Sutton A, Khoury H, Prip-Buus C, Cepanec C, Pessayre D, Degoul F. The Ala16Val genetic dimorphism modulates the import of human manganese superoxide dismutase into rat liver mitochondria. Pharmacogenetics 2003; 13:145-57.

Efkan UZ, [1] H. Ramazan YILMAZ, [2] Ramazan YAGCI, [3] Ismail AKYOL, [4] Tugba ERSOY, [5] Gulten SUNGUR, [5] Ayse YIGIT, [1] Sunay DUMAN, [5] Omer AKYOL [6]

[1] Department of Medical Genetics, Medical Faculty of Suleyman Demirel University, Isparta, Turkey

[2] Department of Medical Genetics, Medical Faculty of Mevlana University, Konya, Turkey

[3] Department of Ophthalmology, Medical Faculty of Pamukkale University, Denizli, Turkey

[4] Animal Science Genetics Unit, Kahramanmara$ Sutgu Imam University Faculty of Agriculture, Kahramanmaras, Turkey

[5] Department of Ophthalmology, Ankara Training and Research Hospital, Ankara, Turkey

[6] Department of Medical Biochemistry, Medical Faculty of Hacettepe University, Ankara, Turkey

Received: April 20, 2015 Accepted: August 09, 2015 Published online: December 12, 2015

Correspondence: Efkan Uz, MD. Suleyman Demirel Oniversitesi Tip Fakultesi Tibbi Genetik Anabilim Dali, 32260 Isparta, Turkey. Tel: +90 246-211 32 34 e-mail: efkanuz@yahoo.com
Table 1. Main characteristics of collected samples, genotypes of
Ala-9Val polymorphism and allele frequencies in Behcet's disease
patients and controls

                            Sample descriptions

                    n      Gender      Age (year)

                         Male/Female

Behcet's disease   93       45/48          33
Control            125      58/67          28

                               Genotypes *

                     Ala/Ala      Ala/Val     Val/Val

                     n    %       n    %      n    %

Behcet's disease    13   14.0    42   45.2   38   40.9
Control             27   21.6    67   53.6   31   24.8

                         Allele
                     frequencies **

                     Ala       Val

                      P         p

Behcet's disease    0.366     0.634
Control             0.484     0.516

n: Number of collected or observed samples; * Significant difference
in genotype frequencies between patients and controls ([chi square]
=6.793, df=2, p=0.033). ** No significant difference in allele
frequencies between patients and controls.
COPYRIGHT 2016 Turkish League Against Rheumatism
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:ORIGINAL ARTICLE
Author:Uz, Efkan; Yilmaz, H. Ramazan; Yagci, Ramazan; Akyol, Ismail; Ersoy, Tugba; Sungur, Gulten; Yigit, A
Publication:Turkish Journal of Rheumatology
Date:Mar 1, 2016
Words:3310
Previous Article:Evaluation of sexual dysfunction in females with ankylosing spondylitis.
Next Article:Expression of connexin 43 in synovial tissue of patients with rheumatoid arthritis.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters