Printer Friendly

Genetic evidence for diversity of spiralling whitefly, Aleurodicus dispersus (Hemiptera: Aleyrodidae) populations in India.

The spiralling whitefly, Aleurodicus dispersus Russell (Hemiptera: Aleyrodidae), is an insect pest of many tropical and sub-tropical crops. Aleurodicus dispersus, native to the Caribbean region of Central America (Russell 1965), is a highly polyphagous pest, which has an extensive host range covering 481 plant species belonging to 295 genera from 90 families of vegetables, fruits and ornamentals trees (Srinivasa 2000). In India, it was first recorded in 1993 at Thiruvananthapuram, Kerala on cassava (Palaniswami et al. 1995). Later it was reported from several parts of Kerala (David & Regu 1995; Ranjith et al. 1996), Tamil Nadu (David & Regu 1995), Karnataka (Mani et al. 2000), Andra Pradesh, Maharashtra (Charati et al. 2003), Orissa (CABI/EPPO 2006) and Mizoram (Boopathi 2008). The whitefly might have been introduced into India from neighboring countries like the Maldives (Muniappan 1996), Sri Lanka (Ranjith et al. 1996) and Myanmar (Boopathi 2008). Since 1993 the species has spread throughout the southern and northeastern India, thereafter it has become an important pest of agricultural and horticultural crops (Boopathi & Karuppuchamy 2013; Boopathi et al. 2013a). Direct feeding damage was caused by the piercing and sucking of sap from foliage by immature and adult stages of whiteflies (Boopathi et al. 2013b). When feeding, dense populations of this polyphagous pest caused premature leaf drops and produced ample honeydew which serves as a substrate for sooty mold growth, which led to the abandonment of cassava fields (Akinlosotu et al. 1993). Sooty mold blackens the leaf, decreases photosynthetic activity and decreases vigor often causing disfigurement of the host (Kumashiro et al. 1983; John et al. 2007). However, the colonization process and geographic source of the original population remain unknown. A molecular technique based on the polymerase chain reaction (PCR), the simple sequence repeats--polymerase chain reaction SSR-PCR, is being widely used in applied entomology (Harry et al. 1998). Many works have been done on the sweetpotato whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), including genetic studies (Callejas et al. 2005), but very little on A. dispersus especially in India. Despite the economic importance of A. dispersus, little is known about the level and patterns of genetic variability in A. dispersus populations. Thus, in this project the SSR-PCR technique was used to obtain information on genetic variability of A. dispersus populations of India.

MATERIALS AND METHODS

Insect Collections

Aleurodicus dispersus population was collected from 7 geographic regions of southern and northeastern States of India (Table 1). Aleurodicus dispersus adults were preserved in 70% ethanol until DNA extraction. Five adults from each population were analyzed to determine the genetic diversity of A. dispersus populations in India.

Isolation of DNA

The DNA was isolated by the CTAB (cetyl trimethylammonium bromide) method adopted from Gawel & Jarrett (1991) with necessary modifications. Prior to extraction, 1 adult female was taken into an autoclaved mortar containing 50 [micro]L of pre-heated CTAB extraction buffer and the sample was ground using pestle. The samples were incubated at 65[degrees]C for 45 min with CTAB extraction buffer. Equal volume of chloroform: isoamyl alcohol mixture (24: 1) was added and mixed by inversion for 15 min. The tubes were centrifuged at 12,000 rpm for 15 min. at 4[degrees]C. The clear aqueous phase was transferred to a new sterile tube. One-third volume of ice cold isopropanol was added and mixed gently by inverting the tubes until DNA was precipitated out by incubating the tubes at -20[degrees]C overnight. Then, it was centrifuged at 12,000 rpm for 20 min. in 4[degrees]C to pellet out the DNA. The DNA pellet was washed with 70% ethanol and dissolved in 20 [micro]L of 1X TE buffer (pH 8.0). To eliminate the rNa and protein contamination from DNA, one-tenth volume of RNase (10 mg [mL.sup.-1]) and 1 [micro]L of proteinase K (25 mg [mL.sup.-1]) was added to DNA sample and incubated at 37[degrees]C for 30 min.

SSR-PCR (Polymerase Chain Reaction) Analysis

DNA samples from A. dispersus populations collected from 7 states of India were amplified using a set of 18 SSR primer pairs which included 7 SSR primers of A. dispersus (Ma et al. 2011) and 11 SSR primers of B. tabaci (De Barro et al. 2003; Tsagkarakou & Roditakis 2003; Gauthier et al. 2008) as detailed in Table 2. Preliminary studies were done using SSR primers of B. tabaci to know the genetic variation among the A. dispersus populations.

Polymerase chain reactions were performed in a thermocycler (BIORAD DNA engine, PTC-0200, Mexico). Eighteen different primers were used for amplification. Reactions were performed in a volume of 25.0 [micro]L containing 16.5 [micro]Lof double distilled water, 2.5 [micro]Lof Tag buffer, 1.0 [micro]Lof dNTPS, 0.5 [micro]L of Mg[Cl.sub.2], 1.0 [micro]L of forward primer, 1.0 [micro]L of reverse primer, 0.5 [micro]L of Tag DNA polymerase and 2.0 [micro]L of the extracted Genomic DNA.

The reaction cycle comprised an initial 5.0 min of pre-denaturation at 95[degrees]C, 40 cycles of amplification (1.0 min of denaturation at 95[degrees]C; 1.0 min of annealing temperature ranging from 50.0 to 60.0 [degrees]C for different SSR primers as in Table 2; 1.0 min of extension at 72[degrees]C), and 5.0 min of final extension at 72[degrees]C. Followed the amplification, the samples were subjected to denaturing polyacrylamide gel electrophoresis as detailed below.

Polyacrylamide Gel Electrophoresis

PCR products were run on 6% polyacrylamide gels, using a gel apparatus. The gel was pre-run for about 20 min. before loading the sample and maintained at 70 W for 2 h. After electrophoresis, the gel was separated from the plates and treated for 15 min in fixation solution (double distilled water and 0.5% v/v acetic acid) with gentle shaking, the gel was washed 2-times with distilled water for 2 min. The gel was stained in staining solution (0.1% w/v silver nitrate), the gel was washed 2 times with distilled water for 2 min, and then the gel was transferred to developing solution (1.5% w/v sodium hydroxide, 0.3% formaldehyde). The reactions were stopped by using stopper solution (double distilled water and 0.5% v/v acetic acid). The bands were then visualized by silver staining (Bassam et al. 1991; Chalhoub et al. 1997), dried overnight and photographed.

Statistical Analysis

Images were used to score the data for SSR analysis. Clearly resolved, unambiguous polymorphic bands were scored with the help of AlphaEase[R] FC Software (Version 6.0). The scores were obtained in the form of a matrix with '1' and '0', which indicated the presence and absence of bands in each location, respectively. Allele scoring was done using the 100 bp marker lane as a reference. The sizes of the alleles are approximated by comparing with the band migration distance of the standard 100 bp ladder. The polymorphism information content (PIC) values are calculated for each SSR marker using the following algorithm. PIC = 1-[SIGMA] [f.sub.i.sup.2] i = 1 where [f.sub.i.sup.2] is the frequency of ith allele (Hildebrand et al. 1992).

The data matrix was used to calculate Jaccard's similarity coefficient (Sneath & Sokal 1973) which does not consider the joint absence of a marker as an indication of similarity. A dendrogram was constructed by the Unweighted PairGroup Method (UPGMA) (Sneath & Sokal 1973). The resulting matrix was used to calculate Manhattan distances between all pairs of populations. These analyses were performed using NTSYS-pc software, version 2.0 (Rohlf 1998).

RESULTS

In the SSR analysis, all amplification products obtained were reproducible and consistent. The genetic variation among the seven A. dispersus populations collected from various geographic regions of India was investigated using SSR markers. Eighteen of the 45 primers screened produced clear bands on the SSR amplifications and were used for analysis. These primers amplified a total of 356 alleles (Table 3). The total number of alleles obtained from each primer ranged from 4 (AD26) to 79 (AY145458) with an average of 19.78 alleles per primer. Two hundred and thirty five (66.0%) out of 356 alleles were polymorphic for A. dispersus populations (13.06 polymorphic alleles per primer). Among 18 primers, 16 primers were polymorphic and the polymorphism ranged from 21.4 to 100%. The primers, Btls1-9, AY145464, AY183673, AY183675, AY183678, AY183679, AY183682, AD2, AD13, AD15, and AD26 were produced 100 % polymorphic patterns, while Btls1-14 and Btls1-13 produced monomorphic pattern. The polymorphism information content (PIC) for SSR primers ranged from 0.0000 to 0.9541. The PIC value was the highest in AD12 (0.9541), AY145458 (0.9492), and AD3 (0.9339). The size of amplification products from different primers ranged from 72 to 320 bp. An example of SSR amplification patterns of primer, AD3 is shown in Fig. 1 for different geographical regions of India.

Genetic relationships between populations are shown in Table 4. The average genetic distances were estimated to investigate the level of DNA variation among the 7 geographic populations of A. dispersus. The genetic distance varied from 0.6364 to 0.8182 among the 7 geographic populations of A. dispersus. The lowest average genetic distance was found between populations from Maharashtra and Karnataka (0.6364). The highest average genetic distance (0. 8182) was found between populations from Karnataka and Andhra Pradesh and Meghalaya and Mizoram.

An UPGMA dendrogram based on similarity coefficient was constructed for the 7 populations analyzed (Fig. 2). Three major clusters were evident. The first cluster contained A. dispersus populations from Tamil Nadu, Kerala, Andhra Pradesh and Karnataka. In the first cluster, Tamil Nadu population was separated from the other 3 states. The second cluster had populations from Mizoram and Meghalaya. The third cluster contained A. dispersus populations from Maharashtra which was separated from other 6 states of India. From cluster analysis is evident that Maharashtra and Tamil Nadu populations were distinct from each other.

DISCUSSION

Microsatellites (SSR markers) are short DNA fragments located throughout the genome, which contain tandemly repeated patterns of 2 to 6 base-pairs. Because of their high polymorphism and co-dominance, these markers provide an effective tool of population genetic studies. SSR markers were isolated and utilized for studying genetic diversity in B. tabaci (De Barro et al. 2003; Tsagkarakou et al. 2007; Gauthier et al. 2008). SSR markers have been used to differentiate B. tabaci variants and to estimate the biotypes and genetic relationships of closely related populations from the same geographical location (De Barro et al. 2003; Tsagkarakou et al. 2007; Gauthier et al. 2008). The primer sequences of around 10 SSR markers are publicly available for studying the A. dispersus genome (Ma et al. 2011).

The present study is the first of its kind in India to utilize SSR markers for characterizing A. dispersus populations. Eighteen SSR primers were amplified in A. dispersus and they produced 356 alleles. The number of alleles produced by different primers ranged from 4 (AD26) to 79 (AY145458) with an average of 19.78 alleles per primer. Our SSR survey clearly detected moderate levels of polymorphism among the A. dispersus populations; multiple alleles were identified in many markers. These SSR allele numbers are higher than those reported from B. tabaci, i.e., up to 13 (Tsagkarakou & Roditakis 2003), 16 (De Barro 2005) and 24 (Gauthier et al. 2008) alleles. This might be due to smaller number of populations collected from geographically closer distances in the present study, whereas the populations from different countries across continents were compared in other studies. The polymorphism information content (PIC) value of each SSR marker is a measure of marker's diversity. PIC provides an estimate of discriminatory power of a locus by taking into account not only the number of alleles expressed, but also the relative frequency of those alleles.

In the present study, SSR markers showed 66.0% polymorphic alleles from 7 populations collected from different geographical regions of India. Similar results were reported by Ma et al. (2011) who observed that microsatellite markers had heterozygosity from Hainan and Canary Island, which ranged from 0.100 to 0.933. Several studies have been carried out to characterize the extent of genetic diversity and differentiation of whitefly populations (Rekha et al. 2005; De Barro 2005; Chu et al. 2007; Tsagkarakou et al. 2007). However, earlier Callejas et al. (2005) had reported that there were no differences in RAPD patterns among A. dispersus populations from different islands of the Canaries.

Cluster analysis showed that, in general, A. dispersus populations are scattered independently in the localities where the samples were collected, especially samples from the Maharashtra and Tamil Nadu populations and theses populations were distinct from each other. Nevertheless, some clusters were evident, joining populations according to the regions. This result suggests that a differentiation of populations has already occurred, mainly according to the geographical regions where populations are localized. The cluster analyses of the A. dispersus populations showed the heterogeneous set of groups and sub-groups, probably due to differences between several nutritional and behavioral factors. The differentiation observed could also be explained by the introduction of A. dispersus populations in different geographical regions of India from several rather than a single founder population, by the massive spread of this populations from other countries like Maldives (Muniappan 1996), Sri Lanka (Ranjith et al. 1996) and Myanmar (Boopathi 2008) in these populations that could have affected the allele frequencies in different geographical regions.

Genetic variation was detected in all the populations analyzed. Considering only A. dispersus populations, an average Jaccard similarity of 0.7273 was observed between all populations analyzed. Moreover, UPGMA showed the clustering of individuals by geographical regions. More studies are necessary concerning molecular sequences (mitochondrial and nuclear genomes), host range phenotypes and mating compatibility to elucidate this controversy.

Caption: Fig. 1. SSR profiles of the 7 Aleurodicus dispersus populations collected from southern and northeastern States of India. Abbreviations: TN: Tamil Nadu, AP: Andhra Pradesh, KA: Karnataka, MH: Mahashtra, MZ: Mizoram and ML: Meghalaya.

Caption: Fig. 2. Dendrogram showing the UPGMA clustering of Aleurodicus dispersus populations collected from southern and northeastern States of India based on SSR markers.

ACKNOWLEDGMENT

We are grateful to Dr. Prasad, Associate Professor, Andhra Pradesh, India; Dr. A.N. Shylesha, Principal Scientist, NBAII, Bengaluru, Karnataka, India; Dr. K. Rajasekar, Scientist (Soil Science), ICAR Research Complex for NEH Region, Mizoram Centre, Kolasib, Mizoram, India; Dr. Anjitha Alexander, Scientist (Agricultural Entomology), NRC on Citrus, Nagpur, Maharashtra, India; Dr. U. Amala, Scientist (Agricultural Entomology), NRC on Grapes, Pune, Maharashtra, India; Dr. T. Nagaraja, Ph.D. Scholar, Bengaluru, Karnataka, India; Mr. Amitosh, RA, ICAR Research Complex for NEH Region, Mizoram Centre, Kolasib, Mizoram, India Mr. Muthumariaapan and Mr. Mani for providing samples and helping in the collection of A. dispersus populations.

REFERENCES CITED

AKINLOSOTU, T. A., JACKAI, L. E. N., NITONIFOR, N. N., HASSAN, A. T., AGYAKWA, G. W., ODFBIYI, J. A., AKINGBOHUNGBE, A. E., AND ROSSEL, H. W. 1993. Spiralling whitefly, Aleurodicus dispersus in Nigeria. FAO Plant Prot. Bull. 41: 127-129.

BASSAM, B. J., CAETANO-ANOLLES, G., AND GRESSHOFF, P. M. 1991. Fast and sensitive silver staining of DNA in polyacrylamide gels. Ann. Biochem. 196: 80-83.

BOOPATHI, T. 2008. Monitoring and management of pest complex of fruits, vegetables and spices in Mizoram, pp. 289 IN Annual Report of ICAR Research Complex for NEH Region 2008-2009. ICAR Res. Complex for NEH Region, Umiam, Meghalaya, India.

BOOPATHI, T., AND KARUPPUCHAMY, P. 2013. Evaluation of Ecofriendly Agents against Spiralling Whitefly, Aleurodicus dispersus Russell on Brinjal. Madras Agric. J. 100(4-6): 559-661.

BOOPATHI, T., KARUPPUCHAMY, P., KALYANASUNDARAM, M., MOHANKUMAR, S., AND RAVI, M. 2013a. Relative efficacy of botanicals, an organic salt and fish oil rosin soap in controlling the spiralling whitefly, Aleurodicus dispersus Russell on cassava. Hexapoda 19(2): 59-66.

BOOPATHI, T., KARUPPUCHAMY, P., KALYANASUNDARAM, M., MOHANKUMAR, S., AND RAVI, M. 2013b. Pathogenicity, ovicidal action, and median lethal concentrations (LC50) of entomopathogenic fungi against exotic spiralling whitefly, Aleurodicus dispersus Russell. J. Pathogens. 7 pp. DOI: http://dx.doi. org/10.1155/2013/393787.

CABI/EPPO. 2006. EPPO A1 List of pests recommended for regulation as quarantine pests. EPPO Reporting Service, Paris, France. http://archives.eppo.org/EPPOReporting/ 2006.

CALLEJAS, C., BEITIA, F. J., GOBBI, A., VELASCO, A., AND OCHANDO, M. D. 2005. The use of RAPD markers to detect genetic patterns in Aleurodicus dispersus (Hemiptera: Aleyrodidae) populations from the Canary Islands. European J. Entomol. 102: 289-291.

CHALHOUB, B. A., THIBAULT, S., LAUCOU, V., RAMEAU, C., HOLFE, H., AND COUSIN, R. 1997. Silver staining and recovery of AFLPTM amplification products on large denaturing polyacrylamide gels. Biotechniques 22: 216-220.

CHARATI, S. N., POKHARKAR, D. S., AND GHORPADE, S. A. 2003. Abundance of spiralling whitefly, a newly introduced pest in Maharashtra State. J. Maharashtra Agric. Univ. 28: 83-84.

CHU, D., JIANG, T., LIU, G. X., JIANG, D. F., TAO, Y. L., FAN, Z. X., ZHOU, H. X., AND BI, Y. P. 2007. Biotype status and distribution of Bemisia tabaci (Hemiptera: Aleyrodidae) in Shandong province of China based on mitochondrial DNA markers. Environ. Entomol. 36: 1290-1305.

DAVID, B. V., AND REGU, K. 1995. Aleurodicus dispersus Russell (Aleyrodidae: Homoptera), a whitefly pest new to India. Pestology 19(3): 5-7.

DE BARRO, P. J. 2005. Genetic structure of the whitefly Bemisia tabaci in the Asia-Pacific region revealed using microsatellite markers. Mol. Ecol. 14: 3695-3718.

DE BARRO, P. J., SCOTT, K. D., GRAHAM, G. C., LANGE, C. L., AND SCHUTZE, M. K. 2003. Isolation and characterization of microsatellite loci in Bemisia tabaci. Mol. Ecol. Notes 3: 40-43.

GAUTHIER, N., DALLEAU-CLOUET, C., AND BOUVRET, M. E. 2008. Twelve new polymorphic microsatellite loci and PCR multiplexing in the whitefly, Bemisia tabaci. Mol. Ecol. Resources 8: 1004-1007.

GAWEL, N. J., AND JARRET, R. L. 1991. A modified CTAB DNA extraction procedure for Musa and lpomoea. Plant Mol. Biol. 9: 262-266.

HARRY, M., ROBIN, S., AND LACHAISE, D. 1998. L'utilisation de marqueurs genetiques polymorphes (RAPDs) en entomologie evolutive et appliquee. Ann. entomol. Soc. France 34: 9-32.

HILDEBRAND, C. E., TORNEY, D. C., AND WAGNER, R. P. 1992. Informativeness of polymorphic DNA markers. Los Alamos Sci. 20: 100-102.

JOHN, B., DARRYL, H., AND GREG, P. 2007. Hort Guard TM Initiative AGWeST Spiraling Whitefly Aleurodicus dispersus Exotic Threat to Western Australia. DOI: www.agric.wa.gov.au/objtwr/imported_assets/.../pw/.../fs01800.pdf.

KUMASHIRO, B. R., LAI, P. Y., FUNASAKI, G. Y., AND TERAMOTO, K. K. 1983. Efficacy of Nephaspis amnicola and Encarsia haitiensis in controlling Aleurodicus dispersus in Hawaii. Proc. Hawaiian Entomol. Socie. 24(2 and 3): 261-269.

MA, G. C., WU, X., MA, C. L., WU, H. L., HU, H. Y., NIU, L. M., AND FU, Y. G. 2011. Isolation and characterization of polymorphic microsatellite loci in Aleurodicus dispersus (Hemiptera, Aleyrodidae). Gen. Mol. Res. 10(4): 2523-2526.

MANI, M., DINESH, M. S., AND KRISHNAMOORTHY, A. 2000. Biological control studies on the spiralling whitefly, Aleurodicus dispersus Russell (Aleyrodidae: Homoptera), ln Entomology Congress 2000, Trivandrum, Kerala, India.

MUNIAPPAN, R. 1996. Spiralling whitefly threat. The Hindu, dated 16.3.1996. p. 12.

PALANISWAMI, M. S., PILLAI, K. S., NAIR, R. R., AND MOHANDAS, C. 1995. A new cassava pest in India. Cassava Newsl. 19: 6-7.

RANJITH, A. M., RAO, D. S., AND THOMAS, J. 1996. New host records of the "Mealy Whitefly", Aleurodicus dispersus Russell in Kerala. Insect Environ. 2(2): 35-38.

REKHA, A. R., MARUTHI, M. N., MUNIYAPPA, V., AND COLVIN, J. 2005. Occurrence of three genotypic clusters of Bemisia tabaci and the rapid spread of the B biotype in south India. Entomol. Exper. et Appl. 117: 221-233.

ROHLF, F. J. 1998. NTSYSpc Numerical Taxonomy and Multivariate Analysis System Version 2.0 User Guide. Applied Biostatistics Inc., Setauket, New York. 37 pp.

RUSSELL, L. M. 1965. A new species of Aleurodicus Douglas and two close relatives. The Florida Entomol. 48: 47-55.

SNEATH, P. H. A., AND SOKAL, R. R. 1973. Numerical Taxonomy. W. H. Freeman & Co., San Francisco.

SRINIVASA, M. V. 2000. Host plants of the spiralling whitefly, Aleurodicus dispersus (Hemiptera: Aleyrodidae). Pest Mgt. Horticul. Ecosys. 6: 79-105.

TSAGKARAKOU, A., AND RODITAKIS, N. 2003. Isolation and characterization of microsatellite loci in Bemisia tabaci (Hemiptera: Aleyrodidae). Mol. Ecol. Notes 3: 196-198.

TSAGKARAKOU, A., TSIGENOPOULOS, C. S., GORMAN, K., LAGNEL, J., AND BEDFORD, I. D. 2007. Biotype status and genetic polymorphism of the whitefly Bemisia tabaci (Hemiptera: Aleyrodidae) in Greece: mitochondrial DNA and microsatellites. Bull. Entomol. Res. 97: 29-40.

T. BOOPATHI (1) *, S. MOHANKUMAR (2), P. KARUPPUCHAMY (3), M. KALYANASUNDARAM (3), M. RAVI (4), B. PREETHA (2) AND R. ARAVINTHARAJ (2)

(1) Division of Agricultural Entomology, ICAR Research Complex for NEH Region, Mizoram Centre, Kolasib-796081, Mizoram, India

(2) Department of Plant Biotechnology, Centre for Plant Molecular Biology and Biotechnology, Tamil Nadu Agricultural University, Coimbatore-641 003, Tamil Nadu, India

(3) Department of Agricultural Entomology, Centre for Plant Protection Studies, Tamil Nadu Agricultural University, Coimbatore-641 003, Tamil Nadu, India

(4) Krishi Vigyan Kendra, Tamil Nadu Agricultural University, Sirugamani, Tiruchirappalli-641115, Tamil Nadu, India

* Corresponding author; E-mail: boopathiars@gmail.com

TABLE 1. ALEUBODICUS DISPERSUS DNA SAMPLES COLLECTED FROM 7 GEOGRAPHIC
REGIONS OF SOUTHERN AND NORTHEASTERN STATES OF INDIA.

Code          Locations                    Hosts

TN     Coimbatore, Tamil Nadu    Manihot escalenta Crantz.
KL     Trissur, Kerala           Carica papaya L.
AP     Nandyal, Andhra Pradesh   Psidium guajava L.
KA     Bengaluru, Karnataka      Acalypha hispida Burm. f.
MH     Pune, Mahashtra           Psidium guajava L.
MZ     Kolasib, Mizoram          Psidium guajava L.
ML     Umiam, Meghalaya          Rosa spp.

Code   Collected          Latitude                Longitude

TN     28.12.2012   11[degrees]0'47.39"N    76[degrees]56'14.19"E
KL     06.11.2012   10[degrees]31'34.94"N   76[degrees]12'53.79"E
AP     13.12.2012   15[degrees]28'59.88"N   78[degrees]28'59.88"E
KA     24.04.2012   13[degrees] 1'36.90"N   77[degrees]35'5.07"E
MH     08.01.2013   18[degrees]29'31.69"N   73[degrees]59'12.96"E
MZ     12.01.2013   24[degrees]12'39.57"N   92[degrees]40'35.18"E
ML     02.02.2013   25[degrees]41'24.46"N   91[degrees]55'20.47"E

Code   Altitude (meter)

TN          434.0
KL           26.0
AP          211.0
KA          928.0
MH          556.0
MZ          635.0
ML          965.0

TABLE 2. SSR PRIMERS USED FOR CHARACTERIZATION OF ALEUEODICUS
DISPEESUS POPULATIONS COLLECTED FROM 7 GEOGRAPHIC REGIONS OF
SOUTHERN AND NORTH-EASTERN STATES OF INDIA.

             Sequences (5'-3')

Primer            Forward                  Reverse
name

Btlsl-9    GTGTTTGAGGAGGTGGG        CTATTTATCTATTTGGGTCA
Btlsl-14   CTCGAACTCGATCATCC        ATTGGAAGCCTCGAATAC
Btlsl-13   CTAAGACCGATTCCTCC        CAATACTACACCTTCAATTACC
AY145456   AGCAGCATCAACAGGCTC       CTAGATTCTGCTTGAAAGG
AY145458   gtcTTTgggagagccagaAT     AACAAGACGGTGGCAGCGA
AY145464   TGACGACCTGAGGCTGAGAG     TGCAACGGCAACAGCAAGCAA
AY183673   GAGATCATATCCCCATTGTTTC   ATCACGGGTCATAGATCACG
AY183675   AAATTAACTGCCGCTCAACG     ATATCGATACAATCTTACCCG
AY183678   ATTCGGTTCGTCTTAGGGAC     ACGATGTTTCCAAACTGAGC
AY183679   GCTCAACCGAATACATCCAC     AAGTCTAAAGGAAGCGTGGAA
AY183682   ACGACACAAATTGGCATTACAT   ACAAGTCAACATCCTCTAGGTA
AD2        CTCCATGCTGTTCTTGAT       CAGGCACCTATAAACCG
AD3        CGACGATTTATACGAACGCA     ACACGAATTGAAGTTGAGGG
AD12       TCACCAGACCCCACCCACCGAC   CACAAATGCTCCCAATACC
AD13       CGACAACAGGAAACAACGGT     AAACTGGCAAAGGCGGAC
AD15       CATTGAGTGGGTCCATTGTT     CGGGAAATGATGTCAGGAGG
AD20       TGCGGGCTCCAACTATGT       TGTGGTCGGCAGGATTTA
AD26       TTAAATTGCTCGCATGGC       TAAAATAGGCTTCAGACCC

Primer          AT        Amplification
name       ([degrees]C)     size (bp)

Btlsl-9        55.0          262-282
Btlsl-14       55.0          130-150
Btlsl-13       55.0          113-121
AY145456       50.0          142-262
AY145458       56.0          74-119
AY145464       59.8           72-87
AY183673       50.2          279-305
AY183675       50.2          290-302
AY183678       50.2          152-186
AY183679       50.2          140-142
AY183682       50.2          200-222
AD2            56.7          251-275
AD3            53.0          241-261
AD12           55.3          242-246
AD13           53.0          308-320
AD15           53.0          278-290
AD20           53.0          174-194
AD26           50.2          191-194

AT: Annealing Temperatures

TABLE 3. POLYMORPHISM INFORMATION CONTENT (PIC) OF SSR MARKERS IN
ALEURODICUS DISPERSUS POPULATIONS OF 7 GEOGRAPHIC REGIONS OF SOUTHERN
AND NORTHEASTERN STATES OF INDIA.

S. No   Primer     Number    Number of    % polymorphism   PIC value
        code         of      polymorphi
                   alleles    alleles

1       Btls1-9      34          34           100.0         0.7457
2       Btls1-14     11          0         Monomorphic      0.0000
3       Btls1-13     11          0         Monomorphic      0.0000
4       AY145456     44          33            75.0         0.8704
5       AY145458     79          35            44.3         0.9492
6       AY145464     11          11           100.0         0.3967
7       AY183673     12          12           100.0         0.5972
8       AY183675     11          11           100.0         0.4959
9       AY183678      7          7            100.0         0.4898
10      AY183679      8          8            100.0         0.7188
11      AY183682      5          5            100.0         0.6400
12      AD2          12          12           100.0         0.4444
13      AD3          59          37            62.7         0.9339
14      AD12         14          3             21.4         0.9541
15      AD13         10          10           100.0         0.0000
16      AD15          5          5            100.0         0.0000
17      AD20         19          8             42.1         0.8227
18      AD26          4          4            100.0         0.3750
        Total        356        235
        Mean        19.78      13.06

PIC : Polymorphism Information Content

TABLE 4. AVERAGE GENETIC DISTANCES AMONG 7 ALEURODICUS DISPERSUS
POPULATIONS COLLECTED FROM SOUTHERN AND NORTHEASTERN STATES OF INDIA.

             Tamil    Kerala   Andhra    Karnataka   Maharashtra
              Nadu             Pradesh

Tamil Nadu   1.0000
Kerala       0.7273   1.0000
Andhra       0.7636   0.7818   1.0000
  Pradesh
Karnataka    0.7273   0.7818   0.8182     1.0000
Maharashtra  0.7273   0.7091   0.7455     0.6364       1.0000
Mizoram      0.6909   0.7091   0.7455     0.7091       0.6727
Meghalaya    0.7636   0.6727   0.7818     0.6727       0.6364

             Mizoram   Meghalaya

Tamil Nadu
Kerala
Andhra
  Pradesh
Karnataka
Maharashtra
Mizoram      1.0000
Meghalaya    0.8182     1.0000


----------

Please note: Some tables or figures were omitted from this article.
COPYRIGHT 2014 Florida Entomological Society
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2014 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Boopathi, T.; Mohankumar, S.; Karuppuchamy, P.; Kalyanasundaram, M.; Ravi, M.; Preetha, B.; Aravinth
Publication:Florida Entomologist
Article Type:Report
Geographic Code:9INDI
Date:Sep 1, 2014
Words:4148
Previous Article:Two new Brazilian Sennius (Coleoptera: Chrysomelidae: Bruchinae) species near the Guttifer group.
Next Article:Inexpensive traps for use in mass trapping Anastrepha ludens (Diptera: Tephritidae).
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters