Printer Friendly

Gene Expressions of Heat Shock Proteins in Bombyx mori Egg Parasitized by a Parasitoid Wasp, Telenomus theophilae.

Byline: Lei Wang, Yue Zhao, Cen Qian, Guoqing Wei, Baojian Zhu and Chaoliang Liu

ABSTRACT

Parasitoid wasps inject their eggs into host along with virulent factors to manipulate hosts physiology and immune system. Heat shock proteins (HSPs) are as molecular chaperones and stress proteins induced by heat, cold, anoxia and parasitism. There was no report about the roles of HSP in insect eggs against egg parasitoids. Here, we studied the expression profiles of several HSPs in silkworm eggs after parasitization by Telenomus theophilae. The results showed that expressions of Hsp19.9, Hsp20.1, Hsp20.8 or Hsp23.7 were significant up-regulated at 24 h post-parasitization, but the expressions of Hsp20.4, Hsp21.4, Hsp70, heat shock cognate protein and Hsp90 after 24 h parasitization had no significant difference compared with the control. After 3 h post-prarsitization, the expressions of nine HSPs detected in eggs had no significant changes. Our results indicated HSPs were involved in the host-parasitoid interaction. This helps us to understand the functions of HSP in host against egg parasitoids.

Key words

Egg, parasitoid, heat shock protein, Bombyx mori, parasitoid wasp.

INTRODUCTION

Egg parasitoid wasps are important natural enemies of pests, and have been used in many countries for biological control. Parasitoids inject their eggs into host eggs, along with a variety of substances including venoms, polydnaviruses, ovarian fluids, and other maternal factors (Asgari and Rivers, 2011; Pennacchio and Strand, 2006). At the same time, insect eggs protect themselves from natural enemies, such as viruses, bacterial, fungi and parasitoids. Different with larvae stage, eggs have hard physical barriers egg shell, maternal or paternal endowment with natural chemical products (Abdel-Latief and Hilker, 2008; Jamil et al., 2015; Stanley and Miller, 2006). In contrast to the immune response of larval or adult stage response to parasitoid, little is known about how attack of insect eggs by parasitoids or molecular mechanism of egg defending parasitism (Abdel-Latief and Hilker, 2008; Hamed and Nadeem, 2012).

Heat shock proteins (HSPs) are conserved proteins, which are found in almost all organisms (Zhang et al., 2015). HSPs can be divided into five families, including small heat shock protein (12-42 kDa, sHSP), Hsp60, Hsp70, Hsp90 and Hsp100, based on sequence homology and typical molecular weight (Li et al., 2009). HSPs are known as stress proteins and molecular chaperones, and are induced by several insults, including heat, cold, desiccation, starvation, and anoxia (King and MacRae, 2015). HSPs in host or parasitoid have been reported to be involved in host-parasitoid interactions (Kraaijeveld and Godfray, 2009; Zhu et al., 2013).

Endoparasitoid Telenomus theophilae Wu et Chen (Hymenoptera: Scelionidae), is the predominant parasitoid of Bombyx mandarina eggs, and it also could parasite successful in domestic silkworm Bombyx mori (Sun et al., 2007). In previous studies, nine HSPs (Hsp19.9, Hsp20.1, Hsp20.4, Hsp20.8, Hsp21.4, Hsp23.7, Hsp70, Hsp90 and heat shock cognate protein) were reported expressed highly in B. mori eggs (Fan et al., 2013; Hong et al., 2006). In this study, we examined these nine HSPs gene expression patterns in response to parasitization by Telenomus theophilae. Our aim was to understand the function of HSP in host-parasitoid interactions.

MATERIALS AND METHODS

Experimental insects

Egg parasitoids Telenomus theophilae Wu et Chen, were reared from wild silkworm Bombyx mandarina eggs collected at Tongxiang city, Zhejiang province in China. Once parasitoid eclosion, T. theophilae adults were held together for mating and fed with 50% (v/v) honey solution absorbed on cotton at 251C. Silkworm Bombyx mori (Dazao) larvae were reared with fresh mulberry leaves. Pupae were kept at 25C. After silkworm moths emerged, they were mated. Eggs were collected within 12 h for T. theophilae parasitism.

Parasitism

The silkworm eggs were collected within 1 h and divided into 50 eggs each sample. Each egg sample was exposed to 5 mated female wasps of T. theophilae for parasitism. After 3 and 24 h parasitization, the eggs were collected for RNA extraction. The eggs without parasitism were taken as control. Each treatment was repeated 3 times.

RNA extraction and cDNA synthesis

The eggs were homogenized in mortar with liquid nitrogen. Total RNA was isolated from silkworm eggs with TRIzol reagent (Invitrogen, USA) according to the manufacturer's instructions. The purity and quantity of the extracted RNA were quantified by the ratio of OD260/OD280 by a NanoDrop 1000 spectrophotometer (NanoDrop Technologies Wilmington, DE). The RNA samples were treated with RQI RNase-free DNase (Promega) to remove any contaminating DNA following the manufacturer's instructions. Purified RNA (1 ug) was reverse-transcribed in a 20 ul reaction mixture with random hexamers primer using using M-MLV reverse transcriptase (TAKARA, Japan) according to the manufacture's instruction.

Real time quantitative PCR

Primers for HSPs and Actin A3 (cytoplasmic actin A3, Genbank accession number: U49854) of B.mori were designed using the online Primer3 internet based interface (http: //frodo.wi.mit.edu) (Table I). The real time quantitative PCR (RT-qPCR) was performed in 20 ul reactions containing 10 ul 2 x SYBR Premix Ex TaqII (Tli RNase Plus) (Takara), 1 ul of each primer, 1 ul of 1: 10 diluted cDNA templates and 7 ul RNase-free H2O. RT-qPCR was performed using a CFX96TM real-time detection system (Bio-Rad, California, USA), using the following procedure: initial denaturation at 95C for 30 s, followed by 40 cycles of amplification (95C for 5 s, and 60C for 30 s) and a final extension at 72C for 25 s. A melting curve analysis (65-95C) for each reaction was determined to confirm the unique and specific PCR product. The relative expression level was determined according to the 2-DDCt method (Livak and Schmittgen, 2001).

All cDNA samples were normalized using B. mori Actin A3 as an internal control. Each biological treatment was repeated three times. The data were presented as the means standard error (S.E).

Statistical analysis

Data were analyzed using one-way ANOVA analysis with Tukey's test by DPS software (version 9.50) (Tang and Zhang, 2013). All data were represented as means standard deviation (S.D.). Differences were considered significant at P less than 0.05.

Table I.- Primers used for real-time PCR in this study.

Primer name###Sequence (5'---3')

HSP19.9-S###CCGGAAGATTTTCTCAGTGC

HSP19.9-A###TTGCCTTCAACCACGATGTA

HSP20.1-S###GCCAACGATGTCCAGAGATT

HSP20.1-A###CTGCCTCTCCTCGTGCTTAC

HSP20.4-S###AAGAAAGACGAGCACGGGTA

HSP20.4-A###TCTTCGCTCTGGTCCTTGAT

HSP20.8-S###GACCTCGGTTCCAGCATAAA

HSP20.8-A###GAACCCCGTCTGATGACAGT

HSP21.4-S###CCGAAATGAGGAAGATGGAA

HSP21.4-A###GAATGAGCGGCGAGTTTAAG

HSP23.7-S###GGACGAGCACGGATACATTT

HSP23.7-A###CCGGGCCAGTTTTAGTGATA

HSP70-S###TTCAGCAGGACATGAAGCAC

HSP70-A###ATGCCGGAACTGTGACTACC

HSP90-S###CAAGTCCATGCTTCCCGTAT

HSP90-A###ACACCGATGCACAAAAACAA

Hsc70-4-S###AAGTCTGAGGAGGTGCAGGA

Hsc70-4-A###GCTCGAATTTACCGAGCAAG

Actin A3-S###GCGGCTACTCGTTCACTACC

Actin A3-A###TGGCTTCCATACCCAAGAAC

RESULTS AND DISCUSSION

Expression of small heat shock proteins after parasitization Small heat shock protein (sHSP) as molecular chaperones, protect proteins from being denatured during extreme conditions (Li et al., 2009). Among 16 silkworm sHSPs, six were highly expressed in eggs. Compared with the control, the gene expressions of Hsp19.9, Hsp20.1, Hsp20.8 or Hsp23.7 were significantly up-regulated at 24 h post-parasitization (Fig. 1A,B,D,F). The expressions of Hsp20.4 and Hsp21.4 after 24 h parasitization were also up-regulated but had no significant difference (Fig. 1C,E). At 3 h post-parasitization, mRNA expressions of six sHSP were up-or down-regulated, but all had no significant difference compared with non-parasitization control (Fig. 1). sHSP genes (Hsp19.9, Hsp20.1, Hsp20.4, Hsp20.8, Hsp23.7) from B. mori were induced in the larval fat body, testis and ovary by heat stress, where Hsp21.4 was down-regulated (Li et al., 2012; Sakano et al., 2006).

In flesh fly Sarcophaga crassipalpis response to envenomation by the ectoparasitic wasp Nasonia vitripennis, Hsp23 expression was highly upregulated 13 h after envenomation (Rinehart et al., 2002). The expression of sHSP gene (GenBank Accession No. U94328) in Plodia interpunctella larvae was increased, and did not decrease until 4 days after by envenomation of ectoparasitoid Bracon hebetor (Shim et al., 2008). Hsp20 mRNA in Pieris rapae pupae was clearly up-regulated between 12-48 h post-parasitization by Pteromalus puparum (Zhu et al., 2013).

Expression of Hsp70s after parasitization

The level of Hsp70 in B. mori eggs was up-regulated at 3 h post-parasitization, down-regulated at 24 h, but both had no significant difference compared with control (Fig. 2A). The expressions of Hsc70-4 gene were down-regulated at 3 h and 24 h, and had no significant difference with non-parasitization (Fig. 2B). Hsp70 in the fat body, testis and ovary of B. mori was down-regulated in heat-treated larvae (Li et al., 2012). BmHsc70-4 was expressed at steady-state levels throughout the BmNPV infection (Iwanaga et al., 2014). Hsp70 in S. crassipalpis was highly upregulated 13 h, but Hsc70 in S. crassipalpis was downregulated slightly after envenomation by N. vitripennis (Rinehart et al., 2002). The level of Hsp70 in P. interpunctella larvae was gradually increased and with a high level until 4 days after envenomation by B. hebetor (Shim et al., 2008). The transcription of Hsp75 in P. rapae was down-regulated by P. puparum parasitization (Zhu et al., 2013).

Expression of Hsp90 after parasitization

The expression of Hsp90 in B. mori eggs after parasitization had no signification difference compared with control (Fig. 3). Hsp90 mRNA in nondiapausing larvae of the apple maggot, Rbagoletis pomonella, was strong up-regulated in response to heat (Lopez-Martinez and Denlinger, 2008). The amount Hsp90 in Spodoptera frugiperda was unchanged during infection, but with supportive role in virus replication (Lyupina et al., 2011). Hsp90 in S. crassipalpis were downregulated slightly when compared to unenvenomated controls (Rinehart et al., 2002). The level of Hsp90 gene in P. interpunctella larvae was not influenced by B. hebetor (Shim et al., 2008). The expression of Hsp75 gene in P. rapae was down-regulated by P. puparum parasitization (Zhu et al., 2013).

In conclusion, this study reported the gene expression of the HSPs in B. mori eggs by T. theophilae parasitization. Each HSP gene was differentially influenced by parasitization. Previous studies showed different HSP participated in different physiological process (King and MaCrae, 2015). Upregulation of HSP genes may play important roles in silkworm eggs against parasitoids. The alternated transcript of HSP may be a component of the host syndrome after parasitization, or a physiological change for growth-arrested host (Shim et al., 2008). The information would be helpful to understand the roles of HSPs in host-parasitoid relationship.

ACKNOWLEDGEMENTS

This work was supported by National Nature Science Foundation of China (Grant no. 31301715), Anhui Provincial Natural Science Foundation of China (Grant no. 1308085QC60), Sericulture Biotechnology Innovation Team (2013xkdt-05), PhD programs in Biochemistry and Molecular Biology (xk2013042).

REFERENCES

Abdel-Latief, M. and Hilker, M., 2008. Innate immunity: Eggs of Manduca sexta are able to respond to parasitism by Trichogramma evanescens. Insect Biochem. Mol. Biol., 38: 136-145.

Asgari, S. and Rivers, D.B., 2011. Venom proteins from endoparasitoid wasps and their role in host-parasite interactions. Annu. Rev. Ent., 56: 313-335.

Fan, L.F., Lin, J.R., Zhong, Y.S. and Liu, J.Y., 2013. Shotgun proteomic analysis on the iapauses and non-diapause eggs of domesticated silkworm Bombyx mori. PloS One, 8: e60386.

Hamed, M., Nadeem, S. 2012. Effect of cereals on the development of Sitotroga cerealella (Olivier) (Lepidoptera: Gelechiidae) and subsequent quality of the egg parasitoid, Trichogramma chilonis (Ishii) (Hymenoptera: Trichogrammatidae). Pakistan J. Zool., 44: 923-929.

Hong, S.M., Nho, S.K., Kim, N.S., Lee, J.S. and Kang, S.W., 2006. Gene expression profiling in the silkworm, Bombyx mori, during early embryonic development. Zool. Sci., 23: 517-528.

Iwanaga, M., Shibano, Y., Ohsawa, T., Fujita, T., Katsuma, S. and Kawasaki, H., 2014. Involvement of HSC70-4 and other inducible HSPs in Bombyx mori nucleopolyhedrovirus infection. Virus Res., 179: 113-118.

Jamil, A., Ul Abdin, Z., Arshad, M., Falabella, P., Abbas, S.K., Tahir, M., Jamil, A., Manzoor, A. and Shaina, H., 2015. Multiple effects of host density on egg density and the sex ratio of progeny of Bracon hebetor (Say.) (Hymenoptera: Braconidae). Pakistan J. Zool., 47: 455-460.

King, A.M. and MaCrae, T.H., 2015. Insect heat shock proteins during stress and iapauses. Annu. Rev. Ent., 60: 59-75.

Kraaijeveld, A.R. and Godfray, H.C.J., 2009. Evolution of host resistance and parasitoid counter-resistance. Adv. Parasit., 70: 257-280.

Li, J., Moghaddam, S.H.H., Du, X., Zhong, B.X. and Chen, Y.Y., 2012. Comparative analysis on the expression of inducible HSPs in the silkworm, Bombyx mori. Mol. Biol. Rep., 39: 3915-3923.

Li, Z.W., Li, X., Yu, Q.Y., Xiang, Z.H., Kishino, H. and Zhang, Z., 2009. The small heat shock protein (sHSP) genes in the silkworm, Bombyx mori, and comparative analysis with other insect sHSP genes. BMC Evol. Biol., 9: 215.

Livak, K.J. and Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCT method. Methods, 25: 402-408.

Lopez-Martinez, G. and Denlinger, D.L., 2008. Regulation of heat shock proteins in the apple maggot Rhagoletis pomonella during hot summer days and overwintering iapauses. Physiol. Ent., 33: 346-352.

Lyupina, Y.V., Zatsepina, O.G., Timokhova, A.V., Orlova, O.V., Kostyuchenko, M.V., Beljelarskaya, S.N., Evgen'ev, M.B. and Mikhailov, V.S., 2011. New insights into the induction of the heat shock proteins in baculovirus infected insect cells. Virology, 421: 34-41.

Pennacchio, F. and Strand, M.R., 2006. Evolution of developmental strategies in parasitic hymenoptera. Annu. Rev. Ent., 51: 233-258.

Rinehart, J.P., Denlinger, D.L. and Rivers, D.B., 2002. Upregulation of transcripts encoding select heat shock proteins in the flesh fly Sarcophaga crassipalpis in response to venom from the ectoparasitoid wasp Nasonia vitripennis. J. Inverteb. Pathol., 79: 62-63.

Sakano, D., Li, B., Xia, Q., Yamamoto, K., Banno, Y. and Fujii, H. and Aso, Y., 2006. Genes encoding small heat shock proteins of the silkworm, Bombyx mori. Biosci. Biotechnol. Biochem., 70: 2443-2450.

Shim, J.K., Ha, D.M., Nho, S.K., Song, K.S. and Lee, K.Y., 2008. Upregulation of heat shock protein genes by envenomation of ectoparasitoid Bracon hebetor in larval host of Indian meal moth Plodia interpunctella. J. Inverteb. Pathol., 97: 306-309.

Stanley, D.W. and Miller, J.S., 2006. Eicosanoid actions in insect cellular immune functions. Ent. Exp. Appl., 119: 1-13.

Sun, S.H., Lou, B.G., Yang, T.T. and Gao, Q.K., 2007. Separation and purification of host recognition kairomone of Telenomus theophilae by reversed phase high performance liquid chromatography. Chinese J. Anal. Chem., 35: 1004-1007.

Tang, Q.Y. and Zhang, C.X., 2013. Data processing system (DPS) software with experimental design, statistical analysis and data mining developed for use in entomological research. Insect Sci., 20: 254-260.

Zhang, C.F., Dai, L.S., Wang, L., Qian, C., Wei, G.Q., Li, J., Zhu, B.J. and Liu, C.L., 2015. Inhibitors of eicosanoid biosynthesis influencing the transcripts level of sHSP21.4 gene induced by pathogen infections, in Antheraea pernyi. PloS One, 10: e0121296.

Zhu, J.Y., Wu, G.X., Ye, G.Y. and Hu, C., 2013. Heat shock protein genes (hsp20, hsp75 and hsp90) from Pieris rapae: Molecular cloning and transcription in response to parasitization by Pteromalus puparum. Insect Sci., 20: 183-193.
COPYRIGHT 2016 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Lei Wang; Yue Zhao; Cen Qian; Guoqing Wei; Baojian Zhu; Chaoliang Liu
Publication:Pakistan Journal of Zoology
Article Type:Report
Geographic Code:9PAKI
Date:Apr 30, 2016
Words:2660
Previous Article:Effects of Castration on Penile and Urethral Development in Black Bengal Goat.
Next Article:Effect of Triazophos on Esterase Activity and Protein Contents of Liver, Kidney, Brain, Blood and Muscles of Catla catla, Labeo rohita and Cirrhinus...
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |