Printer Friendly

Gene Expression Profiles in Japanese Pine Sawyer Monochamus alternatus Exposed to a Sublethal Dose of Imidacloprid.

Byline: Tong Lin Huajun Wu and Linlin Luo

Abstract

The Japanese pine sawyer Monochamus alternatus Hope (Coleoptera: Cerambycidae) is a serious pest management concern in stands of pines. Neonicotinoids are classes of insecticides known to selectively target insect nicotinic acetylcholine receptors. Imidacloprid was introduced as the first commercially available product from the neonicotinoid class of insecticides. In order to understand how M. alternatus reacts toxicologically to imidacloprid transcriptional profiling of M. alternatus larvae exposed to a sublethal dose of imidacloprid were monitored using a specific 60-mer oligonucleotide microarray derived from a cDNA library. Treatment of M. alternatus with imidacloprid resulted in a large number of differentially expressed genes principally associated with metabolic pathways and stress responses. A total of 359 unique genes were found to vary at least twofold in terms of accumulation. Of these 359 genes 41 were upregulated and 318 were downregulated.

A gene ontology enrichment analysis reflected a broad spectrum of the analyzed transcriptome. Our study will assist in a further understanding of networks linking imidacloprid and its potential targets. Identifying the molecular mechanisms of toxicity by imidacloprid is necessary for its future use for controlling M. alternatus and other Lepidoptera insects.

Key words: Gene expression profile Monochamus alternatus imidacloprid.

INTRODUCTION

The Japanese pine sawyer Monochamus alternatus Hope (Coleoptera: Cerambycidae) a serious pest management concern in stands of pines occurs widely in China Korea Japan Laos and Vietnam(Sato et al. 1999; Da et al. 2010; Fan et al. 2010). It is the key vector of the exotic pine wood nematode Bursaphelenchus xylophilus throughout Asia (Kobayashi et al. 1984). This nematode is the causal agent of pine wilt disease which has caused widespread pine (Pinus spp.) mortality in Asia. One method to prevent this nematode from damaging forests is to block its transport by controlling M. alternatus.

Neonicotinoids are the fastest-growing class of insecticides in modern crop protection (Jeschke et al. 2011). Additional benefits of neonicotinoids include their relatively low risk for non-target organisms and the environment high target specificity and versatility in application methods (Cheng et al. 2012). Since their introduction onto the market in 1991 they are increasingly used worldwide and sometimes replace the organophosphate and carbamate insecticides (Yassine et al. 2011). Imidacloprid was introduced in the early 1990s as the first major commercial product from the neonicotinoid class of insecticides (Elbert et al. 1990; Qadir et al.2014) and has since become the most successful proprietary insecticide worldwide. As a systemic seed soil or foliar treatment imidacloprid is active against numerous sucking and biting pest insects including aphids whiteflies thrips leaf miners and beetles (Elbert et al. 1998).

Nicotinic acetylcholine receptors are ligand- gated ion channel receptor complexes that mediate fast cholinergic synaptic transmission. They are among the most thoroughly studied molecules in nervous systems. Neonicotinoids are insecticide classes known to selectively target insect nicotinic acetylcholine receptors and each class acts via a different mechanism (EugAnio et al. 2011). Studies performed on dorsal unpaired median and thoracic neurons demonstrated that imidacloprid was a partial agonist of insect nicotinic acetylcholine receptors (Salgado and Saar 2004; Thany 2009). Similar electrophysiological data were also found using mushroom body neurons called Kenyon cells in which imidacloprid was also a partial agonist (Deglise et al. 2002).

Moreover the insecticidal potency is influenced not only by the intrinsic actions on the targets but also by their accessibility to nicotinic acetylcholine receptors and metabolism in insects (Yamamoto et al. 1998). In the green peach aphid Myzus persicae (Sulzer) Yu et al. (2010) speculated that the balance of biochemical processes was disrupted and achieved a new balance after imidacloprid application. Therefore we hypothesized that imidacloprid toxicity is not only the result of nicotinic acetylcholine receptor inhibition but also the result of a number of physiological alterations in nervous and other insect tissues. Furthermore we propose that the transcriptional profiling of larvae exposed to a sublethal insecticide dose could provide unique insights into the reactions of imidacloprid - susceptible larvae by identifying target genes. Because imidacloprid is a relatively new insecticide the genetic basis of insecticidal potency in M. alternatus has not yet been documented.

To identify genes that are involved in the toxicological response of M. alternatus to imidacloprid we monitored the gene expression profile in M. alternatus after a 4 h exposure to imidacloprid using a 60-mer oligonucleotide microarray derived from a cDNA library. The ultimate goal of this work is to identify new potential non-nicotinic acetylcholine receptor biomarkers as imidacloprid targets in order to assess the insecticide's secondary effects on M. alternatus and to gain a better understanding of the networks linking imidacloprid to its targets. Our study could provide a valuable gene resource for the scientific community to study the molecular toxicology of M. alternatus.

MATERIALS AND METHODS

Insects

The M. alternatus used in this study were obtained from dead infested Pinas massoniana trees. The larvae were reared on artificial diets (Xu et al. 2009) in complete darkness at room temperature with a 55% relative humidity (RH) until they reached the third instar larval stage.

Exposure to imidacloprid

The imidacloprid used in the study was a technical grade formulation (95% purity) provided by Huizhou Sino-quick Chemical Co. Ltd. China. The third instar larvae were contacted with filter paper wetted with 1.25 ml of 30 ppm imidacloprid. The sublethal dose of 30 ppm was designed based on previous studies (Ugine et al. 2011; Cheng et al. 2012) to ensure that the insecticide remained present in the insect tissue this dosage resulted in less than 10% mortality of M. alternatus. To assess the level of gene induction shortly after the insects were exposed to the insecticide insects were exposed to imidacloprid for 4 h. The control larvae were placed in contact with water. Each experiment was performed in triplicate with 30 larvae per replicate. At the end of the 4 h exposure the larvae were immediately frozen in liquid nitrogen and stored at - 80C until RNA extraction was performed.

RNA extraction and purification

Total RNA was extracted using TRIzol Reagent from Life Technologies (www.lifetechnologies.com) following the manufacturer's instructions and checked for RNA integrity by assessing the RNA integrity number with an Agilent Bioanalyzer 2100 (www.agilent.com). Qualified total RNA was further purified by an RNeasy Mini Kit and the RNase-Free DNase Set from QIAGEN (http://www.qiagen.com).

cDNA library construction and BLAST search

Standard cDNA libraries were directionally constructed using SMART cDNA Library Construction Kit from Clontech (www.clontech.com) following the manufacturer's instructions. Briefly first strand synthesis was performed using PowerScript Reverse Transcriptase and an anchored oligo d(T) primer 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)30-N1N-3' Double-stranded DNA was synthesized by primer extension of cDNA through three cycles and visualized as a 0.1-4 Kb smear showing a strong band at 900 bp. The amplified double-stranded cDNA was digested using Proteinase K and SfiI size fractionated by Chroma Spin-400 and ligated to a TriplEx2 Vector containing the asymmetrical SfiI sites (A and B) in the MCS. The average insert size of cDNA libraries was routinely determined by performing colony polymerase chain reaction (PCR) on 48 randomly selected colonies from the amplified library.

PCR amplicons were resolved on 1% agarose gels and visually compared to DNA size markers in the 1 kb DNA ladder from Gibco/BRL (www.gelcompany.com). The libraries were then excised into Escherichia coli cells (DH-5a) on LB- ampicillin agar plates and were grown at 31C overnight for colony picking. Clones were picked from the cDNA libraries and sequenced using the (-47) M13 forward (5-: CGCCAGGGTTTTCCCAGTCACGAC -3) and the (-48) M13 reverse (5- AGCGGATAACAATTTCACACAGGA -3) primers. VecScreen (http://www.ncbi.nlm.nih.gov/ VecScreen/VecScreen.html) was used to trim the vector sequence from raw sequence data. The clone sequences were submitted to GenBank by NCBI(http://www.ncbi.nlm.nih.gov). The predicted biological function of each cDNA was determined based on the blastx hit in the GenBank database with a described gene function.

Microarray construction

M. alternatus DNA microarrays were customized using the Agilent eArray 5.0 program according to the manufacturer's recommendations (https://earray.chem.agilent.com/earray/). The customized microarray contained 15000 spots in triplicate with gene-specific 60-mer oligonucleotides representing 3786 protein-coding genes in M. alternatus based on the sequenced clones from the cDNA library.

RNA amplification and labeling

Total RNA was amplified and labeled by the Low RNA Input Linear Amplification kit from Agilent Technologies (www.agilent.com) using 5- (3-aminoallyl)-UTP (Ambion Austin TX US) and Cy3 NHS ester (GE healthcare Biosciences Pittsburgh PA US) by following the manufacturer's instructions. Labeled cRNA were purified by the RNeasy Mini Kit from QIAGEN (http://www.qiagen.com).

Microarray hybridization

Each slide was hybridized with 600 g of Cy3-labeled cRNA at 65C using the Gene Expression Hybridization Kit from Agilent Technologies (www.agilent.com) in a Hybridization Oven from Agilent Technologies (www.agilent.com) following the manufacturer's instructions. After 17 h of hybridization the slides were washed in staining dishes (/www.thermoscientific.com) using the Gene Expression Wash Buffer Kit from Agilent Technologies (www.agilent.com) and dried using the Stabilization and Drying Solution from Agilent Technologies (www.agilent.com) following the manufacturer's instructions.

Scanning data normalization and analysis

The slides were scanned at a 5 m resolution using the Agilent Microarray Scanner (www.agilent.com) and Feature Extraction Software 10.7 (www.agilent.com). Both 10% and 100% photomultiplier tube (PMT) settings were selected and the combined images were exported. The signal intensities of all spots were quantified for each image. The raw data were normalized using the Quantile algorithm using Gene Spring Software 11.0 (www.agilent.com). The average normalized expression value for the three biological replicates for each probe is reported as the expression value of a predicted gene. Differentially expressed genes were identified using the empirical Bayes test (Daglish and Nayak 2012; Smyth et al. 2005) with the application of the Benjamini and Hochberg (2000) multiple testing correction. Genes were considered to be differentially expressed if they possessed both an adjusted p-value less than 0.05 and a log- fold expression change (LFC) greater than |1.0|.

The regulated genes were functionally classified by gene ontology (http://www.geneontology.org/). We used Fisher's exact test to compare the gene ontology terms associated with significantly regulated genes to those associated with genes with unchanged expression following treatment. The significance of enrichment of gene ontology terms was analyzed separately for upregulated and downregulated genes. The criteria for the significance of a gene ontology term required that it possessed both an adjusted P- valueless than 0.05 and that the number of altered targets for that term was =2. To determine the relationship among these differentially expressed genes molecular pathway analysis of the regulated genes was carried out based on the Kyoto Encyclopedia of Genes and Genomes database (http://www.genome.jp/kegg/). Fisher's exact test was used to identify the significant pathways and the threshold of significance was defined by a P- valueless than 0.05.

Verification of expression with RT-qPCR

We verified microarray results with RT-qPCR using the CT method. RNA was extracted following the same procedure used in the microarray experiments and three replicates were performed. Cytoplasmic actin of M. alternatus was used as the endogenous control and normalized to be in equal quantity in every cDNA treatment. Primers for RT-qPCR target genes were designed online by GenScript Real-time PCR Primer Design (https:// www.genscript.com/ssl-bin/app/primer). Melting curves for each template/primer pair were examined for non-specific amplification. The RT- qPCR data were acquired on a LightCycler Real Time PCR using SYBR Premix Ex TaqTM (www.takara-bio.com) and universal thermocycler conditions according to the manufacturer's protocol from Roche Diagnostics (www.roche.com).

Briefly The PCR was conducted in a 20 l final volume reaction with a PCR mix containing 2 l of cDNA at 4 ng/l (i.e. a quantity of cDNA corresponding to 20 ng of total RNA) 10 l of SYBR Premix Ex Taq 0.4 l of PCR Forward Primer 0.4 l PCR Reverse Primer and 7.2 l of dH2O. The amplification scheme was: 95C for 30 sec 95C for 5 sec and 60C for 20 sec. The dissociation curve method was applied according to the manufacturer's protocol (60C to 95C) to ensure the presence of a single specific PCR product. The annealing temperature was 60C and the RT-qPCRs were performed using 40 cycles. For each cDNA three RT-qPCR reactions were performed and standard curves were generated. To minimize the positional effect on PCR reactions because of variations of block temperature the PCR reactions for target gene and reference gene were placed on the cycler in a randomized block design.

The threshold cycle (CT) and the relative expression levels were calculated using the LightCycler480 1.5 software from Roche Diagnostics (www.roche.com).

RESULTS

Microarray overall results

In this study global changes in M. alternatus gene expression were assessed by microarray analyses 4 h after imidacloprid treatment. Some genes were represented with more than one probe set. Therefore the number of responsive probe sets is greater than the number of responsive genes. A total of 1012 probe sets (GenBank accession number: JZ143720-JZ144731) corresponding to 359 genes were found to vary in accumulation at least two-fold. Of these 359 unique genes 41 were upregulated and 318 were downregulated which suggests that the gene repression was more sensitive to imidacloprid than enhanced expression. More than 10 nicotinic acetylcholine receptor genes have been cloned in insects and post-translational modifications have been observed on subunit mRNAs (Grauso et al. 2002; Lansdell and Millar 2002; Matsuda et al. 2005; Millar and Gotti 2009; Sattelle et al. 2005) suggesting the existence of many nicotinic acetylcholine receptor subtypes (Ihara et al. 2006).

Five nicotinic acetylcholine receptor transcripts were identified in this study all of which were downregulated by the imidacloprid treatment.

The unique genes showing altered transcriptional patterns were primarily related to metabolic pathways oxidative phosphorylation and various enzymes (e.g. cytochrome P450 reductase juvenile hormone esterase and serine protease) involved in the general stress response. Imidacloprid serves a more complex function in insect toxicology than previously believed.

Gene ontology enrichment analysis

To infer the relationship between the gene expression pattern and the functional categories gene ontology enrichment analysis was performed to identify the overrepresented categories for both induced and repressed genes (Figs.1-2). The differentially expressed genes were widely distributed among the molecular function biological processes and cellular component categories reflecting a broad spectrum of the analyzed transcriptome.

Among the various molecular functions catalytic activity was the most highly represented term in upregulated genes followed by nucleotide binding structural constituent of cytoskeleton and translation regulator activity. The oxidoreductase atcivity and substrate-specific transporter activity were the most highly represented in downregulated genes. The subcategories associated with the oxidoreductase activity structural constituent of ribosome and substrate-specific transporter activity encompassed the majority of the downregulated genes.

Within the cellular component category the upregulated genes comprised 9 categories among which cell part intracellular and intracellular part each represented more than 29 genes. Intracellular part and protein complex were the most represented Gene ontology terms in the enriched categories from downregulated genes. Other sub-categories such as membrane part synapse part larval serum protein complex and organelle envelope were also identified.

In the biological process category the cellular component organization term was represented most frequently in upregulated genes followed by multicellular organismal development anatomical structure development cellular developmental process and anatomical structure morphogenesis. Among downregulated genes the transport regulation of biological quality and oxidation reduction terms were enriched most frequently.

Molecular pathway analysis

To determine the function and relationship of these differentially expressed genes molecular pathway analysis was performed based on the Kyoto Encyclopedia of Genes and Genomes database.

Molecular pathway analysis showed that a large portion of the differentially expressed genes was associated with metabolic pathways (Table I). For example the genes Ahcy13 ATPsyn-b ATPsyn- d Cyp9f2 fab1 GlcT-1 kdn ND75 UGP ND75 and Odc2 were in metabolic pathways and most were downregulated.

A differential transcription was observed in genes involved in the endocytosis pathway. Six endocytosis pathway-associated genes were enriched in the downregulated gene group including Hsc70-4 and stam coding for heat shock protein cognate 4 and signal transducing adaptor molecule respectively. Additionally the Rab11 gene encoding Rab-protein 11 and Vps4 (CG6842 gene product) were in the upregulated gene group.

It was noted that a single regulated gene may belong to more than one pathway. For instance the Ahcy gene encoding adenosylhomocysteinase was in the cysteine and methionine metabolism selenoamino acid metabolism and metabolic pathways. The gene ATPsyn-b encoding ATP synthase subunit b was in both the oxidative phosphorylation and metabolic pathways.

Confirmation of the gene expression by RT-qPCR

To verify the reliability of the microarray data

Table I.- Molecular pathway analysis of 20 genes that associated with metabolic pathways.

###Percent Enrichment

Name###Hits Total

###(%) test P-value

Arachidonic acid metabolism###2###15###13###0.0284

eta-Alanine metabolism###2###17###12###0.035

Endocytosis###8###86###9###1.00E-04

Fatty acid metabolism###4###34###12###0.0208

Glutathione metabolism###4###63###6###0.0208

Glyoxylate and dicarboxylate

###2###16###13###0.0316

metabolism

Limonene and pinene

###5###82###6###0.0118

degradation

Lysosome###6 89###7###0.0038

Metabolic pathways###42 996###4###0

Oxidative phosphorylation###16 274###6###0

Pentose and glucuronate

###3###39###8###0.0278

interconversions

Pentose phosphate pathway###3###23###13###0.0075

Phenylalanine metabolism###2###20###10###0.0458

Proteasome###3###50###6###0.05

Regulation of autophagy###2###14###14###0.0253

Ribosome###9###89###10###0

Selenoamino acid metabolism###2###16###13###0.0316

Tryptophan metabolism###2###18###11###0.0385

Valine leucine and isoleucine

###4###31###13###0.034

degradation

Wnt signaling pathway###4###74###5###0.034

Table II.- Expression pattern of 9 genes with known functions in the RT-qPCR and the microarray experiments.

###Drosophila

GenBank Accn.###RT-qPCR###Microarray

###homologue

77933472###l(2)efl###0.2549###0.132

JZ143892###Tal###1.56###4.17

JZ144071###Antp###0.7301###0.44

JZ144277###COX2###1.236###2.1148

JZ144285###Ef2b###0.3051###0.201

JZ144463###CG5023###1.32###9.647

JZ144492###Cpr49Aa###1.769###2.24

JZ144519###eRF1###0.6495###0.429

JZ144687###ND4###1.184###2.392

nine genes with known functions that exhibited differential expression in the microarray were randomly analyzed by RT-qPCR.

Table II demonstrates that most genes followed the same expression pattern in the RT-qPCR and the microarray experiments. In the genes for JZ143892 and JZ144463 fold-change values were noticeably different between the RT-qPCR and microarray results likely due to signal amplification in the microarray experiments. However the gene expression patterns observed were identical.

Therefore the microarray experiments give an accurate depiction of the gene expression patterns elicited.

DISCUSSION

This study exploited a DNA microarray platform to identify differentially expressed genes in M. alternatus exposed to imidacloprid.A total of 359 genes were differentially expressed by at least two-fold most of which were downregulated and were related to metabolic detoxification oxidative phosphorylation stress responses.

Differentially expressed genes involved in metabolic detoxification pyrethroid resistance in the Blattella germanica (Pridgeon and Liu 2003) and has been reported to be involved in the resistance of Schistosoma mansoni to praziquantel a drug used to control schistosomiasis (Pereira et al.1998). Our result infers that high imidacloprid-induced COX1 overexpression plays a specific role in metabolic detoxification. Further study of the relationship between COX1 and imidacloprid detoxification will shed light on the importance of COX1 in insecticide detoxification or resistance.

Reduced cuticle permeability is one of the modes of insect resistance to insecticides (Ahmad et al.2006). The putative cuticular protein genes in Leptinotarsa decemlineata were highly induced by the insecticide azinphos-methyl (organophosphorus) 2 to 3 weeks after adult molting. Several cuticular protein genes whose products are associated with the structural constituent of a chitin-based cuticle were identified in our study including Cpr49Aa Cpr67B and Cpr11A. However three cuticular protein genes were significantly downregulated which indicated they might not reduce cuticular penetration and contribute to resistance or tolerance to imidacloprid.

Differentially expressed genes involved in oxidative phosphorylation

Protein phosphorylation is a critical factor in signal transduction. Many physiological processes in the cell are regulated by protein phosphorylation (Greengard 1978). Protein phosphorylation studies have provided solid evidence to elucidate the mechanisms of many molecular events (Miyazawa and Matsumura 1990; Enan and Matsumura 1991; Schuh et al. 2002). In our study the oxidative phosphorylation pathway genes ATPsyn-d mtacp1 and ND75 (encoding ATP synthase subunit d mitochondrial acyl carrier protein 1 and NADH: ubiquinone and reductase 75 kD subunit precursor respectively) were down-regulated suggesting toxicological changes caused by oxidative phosphorylation. We infers that the insecticidal effects on protein phosphorylation may be one imidacloprid toxicity mechanism in M. alternatus and possibly in other insects and proteins that change phosphorylation levels in the insect may provide non-classical targets for insecticides.

Differentially expressed genes involved in stress responses

Several genes displayed decreased transcriptional activity after imidacloprid exposure including those encoding serine protease cytochrome P450 reductase juvenile hormone esterase cysteine proteinase and thioredoxin peroxidase.

Serine proteases are reportedly involved in the immune response (Jiang and Kanost 2000; Jiang et al. 2003ab; Kanost et al. 2004) food protein digestion (Mazumdar and Broadway 2001; Herrero et al. 2005; Broehan et al. 2008) and the molting process (Samuels and Reynolds 1993; Chamankhah et al. 2003; Zhao et al. 2007; He et al. 2009) in insects. Our data shows that imidacloprid repressed the transcription of serine protease. Studies have shown that reduced levels of gut serine proteases may play a role in resistance to Cry toxins (Oppert et al. 1997). In our opinion imidacloprid may induce the defense system in M. alternatus (e.g. melanization) by modulating serine protease gene transcription. Such information will help elucidate the relationship between imidacloprid exposure and serine protease -related immune responses in M. alternatus.

Insect cytochrome P450 reductases have been placed in a critical pathways involving metabolism- based insecticide resistance and were considered to be novel targets for the development of synergists (Lian et al. 2011). The inactivation of all cytochrome P450 reductases has been proposed to cause multiple developmental defects and embryonic lethality in mice (Shen et al. 2002). In this study imidacloprid exposure in M. alternatus downregulated the cytochrome P450 reductase transcript level and thus suggested that imidacloprid may delay insecticide resistance and impede M. alternatus development.

It will be interesting to determine whether M. alternatus proteins are involved in the downregulation of juvenile hormone esterase mRNAs.It has been shown that juvenile hormone esterase inhibition results in supernumerary larval molts (Icen et al. 2005). We found the level of juvenile hormone esterase transcripts in M. alternatus larvae was reduced suggesting that either reduced gene transcription or reduced juvenile hormone esterase RNA stability is responsible for the decrease in juvenile hormone esterase activity and malformation would be formed during the development of M. alternates.

ACKNOWLEDGEMENT

This research was supported by National Natural Science Foundation of China (Grant No. 31170612).

REFERENCES

AHMAD M. DENHOLM I. AND BROMILOW R.H. 2006. Delayed cuticular penetration and enhanced metabolism of deltamethrin in pyrethroid resistant strains of Helicoverpa armigera from China and Pakistan. Pest Manage. Sci. 62:805-810.

BENJAMINI Y. AND HOCHBERG Y. 2000. On the adaptive control of the false discovery rate in multiple testing with independent statistics. J. Educ. Behav. Stat. 25:60-83.

BROEHAN G. KEMPER M. DRIEMEIER D. VOGELPOHL I. AND MERZENDORFER H. 2008. Cloning and expression analysis of midgut chymotrypsin-like proteinases in the tobacco hornworm. J. Insect Physiol. 54:1243-1252.

CHAMANKHAH M. BRAUN L. SHAH S.V. O'GRADY M. BALDWIN D. SHI X. HEMMINGGSEN S.M. MEES M.A. AND HEGEDUS D.D. 2003. Mamestra configurata serpin-1 homologues: cloning localization and developmental regulation. Insect Biochem. Mol. Biol. 33:355-369.

CHENG Y. SHI Z.P. JIANG L.B. GE L.Q. WU J.C. AND JAHN G.C. 2012. Possible connection between imidacloprid-induced changes in rice gene transcription profiles and susceptibility to the brown plant hopper Nilaparvatalugens StAl (Hemiptera: Delphacidae). Pestic. Biochem. Physiol. 102:213-219.

DA D.Y. HU S.J. YE H. HAACK R.A. AND ZHOU P.Y. 2010. Pine wilt disease in Yunnan China: Evidence of non-local pine sawyer Monochamus alternatus (Coleoptera: Cerambycidae) populations revealed by mitochondrial DNA. Insect Sci. 17:439-447.

DAGLISH G..J. AND NAYAK M.K. 2012. Potential of the neonicotinoid imidacloprid and the oxadiazine indoxacarb for controlling five coleopteran pests of stored grain. Insect Sci. 19:96-101.

DEGLISE P. GRUNEWALD B. AND GAUTHIER M. 2002. The insecticide imidacloprid is a partial agonist of the nicotinic receptor of honeybee Kenyon cells. Neurosci. Lett. 321:13-16.

ELBERT A. OVERBECK H. IWAYA K. AND TSUBOI S. 1990. Imidacloprid a novel systemic nitromethylene analogue insecticide for crop protection. In: Proc. Brighton Crop Protect Conf."Pests and Diseases BCPC Farnham Surrey UK pp. 21-28.

ELBERT A. NAUEN R. AND LEICHT W. 1998. Imidacloprid a novel chloronicotinyl insecticide: biological activity and agricultural importance. In: Insecticides with novel modes of action mechanisms and applications (eds. I. Ishaaya and D.Degheele) Springer-Verlag Berlin and Heidelberg GmbH and Co. K. pp. 50-73.

ENAN E. AND MATSUMURA F. 1991. Matsumura stimulation of protein phosphorylation in intact rat brain synaptosomes by a pyrethroid insecticide deltamethrin. Pestic. Biochem. Physiol. 39:182-195.

EUGASNIO E.O. SCHLEICHER S. BASCHGESA A. SCHMIDTA J. KLOPPENBURGA P. AND SALGADO V.L. 2011. Desensitization of nicotinic acetylcholine receptors in central nervous system neurons of the stick insect (Carausius morosus) by imidacloprid and sulfoximine insecticides. Insect Biochem. mol. Biol. 41:872-880.

FAN J.T. MILLER D.R. ZHANG L.W. AND SUN J.H. 2010. Effects of bark beetle pheromones on the attraction of Monochamus alternatus to pine volatiles. Insect Sci. 17:553-556.

GRAUSO M. REENAN R.A. CULETTO E. AND SATTELLE D.B. 2002. Novel putative nicotinic acetylcholine receptor subunit genes Da5 Da6 and Da7 in Drosophila melanogaster identify a new and highly conserved target of adenosine deaminase acting on RNA-mediated A-to-I pre-mRNA editing. Genetics 160:1519-1533.

GREENGARD P. 1978. Phosphorylated proteins as physiological effectors. Science 199:146-152.

HE W.Y. ZHENG Y.P. TANG L. ZHENG S.C. BALIVEAU C. DOUCET D. CUSSON M. AND FENG Q.L. 2009.Cloning expression and localization of a trypsin-like serine protease in the spruce budworm Choristoneura fumiferana. Insect Sci. 16:455-464.

HERRERO S. COMBES E. VAN OERS M.M. VLAK J.M. MAAGD R.A. AND BEEKWILDER J. 2005. Identification and recombinant expression of a novel chymotrypsin from Spodoptera exigua. Insect Biochem. mol. Biol. 35:1073-1082.

ICEN E. ARMUTCU F. BAYAKGAZEL K. AND GAREL A. 2005. Biochemical stress indicators of greater wax moth exposure to organophosphorus insecticides. J. econ. Ent. 98:358-366.

IHARA M. BROWN L.A. ISHID A.C. OKUDA H. SATTELLE D.B. AND MATSUDA K. 2006. Actions of imidacloprid clothianidin and related neonicotinoids on nicotinic acetylcholine receptors of American cockroach neurons and their relationships with insecticidal potency. J. Pestic. Sci. 31:35-40.

JESCHKE P. NAUEN R. SCHINDLER M. AND ELBERT A. 2011. Overview of the status and global strategy for neonicotinoids. J. Agric. Fd. Chem. 59:2897-2908.

JIANG H. AND KANOST M.R. 2000. The clip-domain family of serine proteinases in arthropods. Insect Biochem. mol. Biol. 30:95-105.

JIANG H.B. WANG Y.YU X.Q. AND KANOST M.R. 2003a. Prophenoloxidase activating proteinase-2 from hemolymph of Manduca sexta. J. biol. Chem. 278: 3552-3561.

JIANG H. WANG Y. YU X.Q. ZHU Y. AND KANOST M. 2003b. Prophenoloxidase-activating proteinase-3(PAP-3) from Manduca sexta hemolymph:a clip-domain serine proteinase regulated by serpin-1J and serine proteinase homologs. Insect Biochem. mol. Biol. 33:1049-1060.

KANOST M.R. JIANG H. AND YU X.Q. 2004. Innate immune responses of a lepidopteran insect Manduca sexta. Immunol. Rev. 198:97-105.

KOBAYASHI F. YAMANE A. AND IKEDA T. 1984. The Japanese pine sawyer beetle as the vector of pine wilt disease.Annu. Rev. Ent. 29:115-135.

LANSDELL S.J. AND MILLAR N.S. 2002. Db3 an atypical nicotinic acetylcholine receptor subunit from Drosophila: molecular cloning heterologous expression and coassembly. J. Neurochem. 80:1009-1018.

LIAN L.Y. WIDDOWSON P. MCLAUGHLIN L.A. AND PAINE M.J.I. 2011. Biochemical comparison of Anopheles gambiae and human NADPH P450 reductases reveals different 2 '-5 '-ADP and FMN binding traits. PloS One 6:e20574.

MATSUDA K. SHIMOMURA M. IHARA M. AKAMATSU M. AND SATTELLE D.B. 2005. Neonicotinoids show selective and diverse actions on their nicotinic receptor targets: electrophysiology molecular biology and receptor modeling studies. Biosci. Biotech. Bioch. 69:1442-1452.

MAZUMDAR L.S. AND BROADWAY R.M. 2001. Identification of six chymotrypsin cDNAs from larval midguts of Helicoverpa zea and Agrotis ipsilon feeding on the soybean (Kunitz) trypsin inhibitor. Insect Biochem. mol. Biol. 31:633-644.

MILLAR N.S. AND GOTTI C. 2009. Diversity of vertebrate nicotinic acetylcholine receptors. Neuropharmacology 56:237-246.

MIYAZAWA M. AND MATSUMURA F. 1990. Effects of deltamethrin on protein phosphorylation and dephosphorylation process in the nerve fibers of the American lobster Homerus americanus L. Pestic. Biochem. Physiol. 36:147-155.

OPPERT B. KRAMER K.J. BEEMAN R.W. JOHNSON D. AND MCGAUGHEY W.H. 1997. Proteinase- mediated insect resistance to Bacillus thuringiensis toxins. J. biol. Chem. 272:23473-23476.

PEREIRA C. FALLON P.G. AND CORNETTE J. 1998. Alterations in cytochrome-c oxidase expression between praziquantel-resistant and susceptible strains of Schistosoma mansoni. Parasitology 117:63-73.

PRIDGEON J.W. AND LIU N. 2003.Overexpression of the cytochrome oxidase subunit I gene associated with a pyrethroid resistant strain of German cockroaches Blattella germanica (L.). Insect Biochem. mol. Biol. 33:1043-1048.

QADIR S. LATIF A. ALI M. AND IQBAL F. 2014. EFFECTS OF Imidacloprid on the Hematological and Serum Biochemical Profile of Labeo rohita. Pakistan J. Zool. 46:1085-1090.

SALGADO V.L. AND SAAR R. 2004. Desensitizing and non-desensitizing subtypes of alpha-bungarotoxin- sensitive nicotinic acetylcholine receptors in cockroach neurons. J. Insect Physiol. 50:867-879.

SAMUELS R.I. AND REYNOLDS S.E. 1993. Molting fluid enzymes of the tobacco hornworm Manduca sexta: Timing of proteolytic and chitinolytic activity in relation to pre-ecdysial development. Arch. Insect Biochem. 24:33-44.

SATO M. ISLAM S.Q. AWAYA S. AND YAMASAKI T. 1999. Flavanonol glucoside and proanthocyanidins: oviposition stimulants for the cerambycid beetle Monochamus alternatus. J. Pestic. Sci. 24:123-129.

SATTELLE D.B. JONES A.K. SATTELLE B.M. MATSUDA K. REENAN R. AND BIGGIN P.C. 2005. Edit cut and paste in the nicotinic acetylcholine receptor gene family of Drosophila melanogaster. BioEssays 27:366-376.

SCHUH R.A. LEIN P.J. BECKLES R.A. AND JETT D.A. 2002. Noncholinesterase mechanisms of chlorpyrifos neurotoxicity: altered phosphorylation of Ca2+/cAMP response element binding protein in cultured neurons. Toxicol. appl. Pharmacol. 182:176-185.

SHEN A.L. O'LEARY K.A. AND KASPE C.B. 2002. Association of multiple developmental defects and embryonic lethality with loss of microsomal NADPH- cytochrome P450 oxidoreductase. J. biol. Chem. 277:6536-6541.

SMYTH G.K. MICHAUD J. AND SCOTT H. 2005. Use of within-array replicate spots for assessing differential expression in microarray experiments. Bioinformatics 21:2067-2075.

THANY S.H. 2009. Agonist actions of clothianidin on synaptic and extra synaptic nicotinic acetylcholine receptors expressed on cockroach sixth abdominal ganglion. Neuro Toxicology 30:1045-1052.

UGINE T.A. GARDESCU S. AND HAJEK A.E. 2011. The effect of exposure to imidacloprid on Asian longhorned Beetle (Coleoptera: Cerambycidae) survival and reproduction. J. econ. Ent. 104:1942-1949.

XU J.H. HU X.F. XU H.C. CHENG J.M. JIANG Y. AND FANG W.J. 2009.Rearing and Biological Properties of Monochamus alternatus. J. Zhejiang Sci-Tech Univ. 29:86-88.

YAMAMOTO I. TOMIZAWA M. SAITO T. MIYAMOTO T. WALCOTT E.C. AND SUMIKAWA K. 1998. Structural factors contributing to insecticidal and selective actions of neonicotinoids. Arch. Insect Biochem. 37:24-32.

YASSINE B. LAPIED B. AND THANY S.H. 2011. Neonicotinoid insecticides imidacloprid and clothianidin affect differently neural Kenyon cell death in the cockroach Periplaneta americana. Pestic. Biochem. Physiol. 101:191-197.

YU Y.S. SHEN G.Q. ZHU H.L. AND LU Y.T. 2010. Imidacloprid-induced hormesis on the fecundity and juvenile hormone levels of the green peach aphid Myzus persicae (Sulzer). Pestic. Biochem. Physiol. 98:238-242.

ZHAO L.L. WEI W. KANG L. AND SUN J.H. 2007. Chemotaxis of the Pinewood Nematode Bursaphelenchus xylophilus to volatiles associated with Host Pine Pinus massoniana and its vector Monochamus alternates. J. chem. Ecol. 33:1207-1216.
COPYRIGHT 2015 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Pakistan Journal of Zoology
Article Type:Report
Geographic Code:9JAPA
Date:Feb 28, 2015
Words:5360
Previous Article:Cytotoxic and Genotoxic Effect of Arsenic and Lead on Rat Mesenchymal Stem Cells (rMSCs).
Next Article:Study of Roost Selection and Habits of a Bat Hipposideros armiger in Mainland China.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters