Printer Friendly

GONAD STATUS AND GENE EXPRESSION OF THE MANILA CLAM RUDITAPES GONAD STATUS AND GENE EXPRESSION OF THE MANILA CLAM RUDITAPES.

INTRODUCTION

The Manila clam (Ruditapes philippinarum) is one of the most important aquaculture species in China. This species is popular with farmers because of its short grow-out time. By 2016, the annual production of Manila clams in China exceeded 1.5 million metric tons, which accounted for an estimated 90% of the world's production (DOF 2016, Huo et al. 2016). The development of efficient hatchery techniques (Yan et al. 2006, Zhang & Yan 2006) has allowed selective breeding to be used to improve the growth and reproductive traits of the Manila clam; however, Manila clam production is threatened by serious diseases that cause mass mortality, such as brown ring disease (Paillard & Maes 1995, Park et al. 2006), brown muscle disease (Dang et al. 2009), perkinsosis (Hasanuzzaman et al. 2016), and digenetic trematode infection (Sohn et al. 2017).

Digenetic trematodes primarily infect the gonads of bivalves and thereby affect the productive capacity of their hosts (Khamdan 1998, Lee et al. 2001, Ren & Song 2002). Previously studies have been conducted to understand the histopathology of digenetic trematodes and their infection intensity and prevalence in Manila clams (Cao 1989, Kim & Yu 2001); however, molecular identification of the digenetic trematode species in shellfish is still in its infancy and few published studies are available for reference (Bray et al. 1994, De et al. 2014)

Improving the diagnosis, treatment, and control of parasitic diseases requires identification and classification of the parasite. Compared with traditional methods, molecular identification is preferable because it is not affected by environmental variations (McManus et al. 1997). The most common target molecules used in molecular identification are 18S rRNA, internal transcribed spacers, and certain mitochondrial sequences such as cytochrome oxidase subunit 1 and cytochrome b (Guo et al. 2015).

In addition, the advancement of high-throughput sequencing techniques has allowed rapid and cost-effective transcriptomic analysis of species (Dheilly et al. 2014). Using these techniques, Prado-Alvarez et al. (2009) conducted gene expression analysis of Ruditapes decussatus infected with the parasite Perkinsus olseni. In addition, Romero et al. (2015) studied stress on Manila clams caused by P. olseni trophozoites. In another study, Hasanuzzaman et al. (2016) infected Manila clams with P. olseni in vitro and in vivo. Stimulation in vitro resulted in the expression of several different genes than stimulation in vivo. Most of the genes studied are associated with immunity and stress resistance.

To date, few studies have focused on damages caused by digenetic trematodes in Manila clams. In this study, the digenetic trematode-infected Manila clams were identified by molecular methods. The effects of this parasite on its host were evaluated by comparing the expression levels of genes influencing the reproductive process. The results of this study will provide information on the basic molecular response of the Manila clam reproductive process against trematode infection.

MATERIALS AND METHODS

Materials

Twenty kilograms of Manila clams was randomly collected from the waters around Dalu Island, China, and transported to the laboratory in July 2015. One hundred clams were randomly selected for dissection. (The average shell length is 3.24 [+ or -] 0.64 cm.) Subsequently, the gonads of each clam were collected and the presence/absence of digenetic trematodes was observed under the microscope. Infected individuals were further analyzed to record the morphology and developmental stage of the parasite.

Observation of Gonad Sections

Gonad tissues from 30 infected and 30 uninfected individuals were fixed with Bouin's liquid. Tissues were embedded in paraffin and then sectioned with a microtome (Laika, Shanghai, China) into 8-p.m slices and placed on glass slides. The specimens were washed after fixation and dehydrated in a series of alcohol solutions. After xylene dewaxing and hematoxylin and eosin staining, tissues were observed under an optical microscope.

Identification of the Parasite

The gonads of ten infected individuals were fixed in anhydrous ethanol and placed in a freezer at -20[degrees]C. Total DNA was extracted using the hot-shot method, and the DNA was stored at 4[degrees]C. The forward primer (5'-GGCTCATTAAATCAGCTATGGTT-3') and reverse primer (5'-ACGACI'FFIACTTCCCCTCTAAAT-3') were synthesized by Shenggong Co., Ltd. (Shanghai, China) The amplified fragment size was estimated to be 1861 bp. This pair of primers was generated based on the trematode parasite (Fasciola) found in Qinghai Tibetan sheep (Guo 2015). The target fragment was amplified using a polymerase chain reaction (PCR) instrument (CT004897, BIORAD, Berkeley, CA). The PCR was performed using the PCR amplification kit (cat.# RO11, Takara, Dalian, China) following the manufacturer's instructions with slight modifications. The PCR mixture was set at 50 [micro]L, which contained 1 [micro]L of template DNA (20-50 ng), 5 of 10 x PCR buffer, 4 pl of dNTPs (2.5 mM each), 1 [micro]L of upstream primer (10 [micro]M), 1 [micro]L of downstream primer (101.1M), 0.5 [micro]L of Takara Taq, and 37.5 pl of sterile dd[H.sub.2]O. The PCR parameters were set as follows: 94[degrees]C for 2 min, 35 cycles of 94[degrees]C for 30 sec, 58[degrees]C for 30 sec, and 72[degrees]C for 2 min. A final extension was performed at 72[degrees]C for 10 min, after which reactions were carried out at 4[degrees]C. Products were detected in a 1.5% agarose gel using an electrophoresis apparatus (Liuyi, Beijing, China). The target fragments were cut and recovered using the Takara gel extraction kit (Takara, Dalian, China) The purified PCR products were stored at 4[degrees]C. The products were sent to Shenggong Co., Ltd. for bidirectional sequencing.

RNA Extraction and Reverse Transcription

Four infected clams and four uninfected clams were randomly selected for subsequent gene expression analysis. The gill, mantle, and gonad tissues of these selected clams were collected for total RNA isolation. Tissue samples were quickly frozen on collection using liquid nitrogen. Total RNA was isolated using an RNA extraction kit (Tiangen Biotech, Beijing, China) following the manufacturer's instructions. RNA concentration was examined using a nucleic acid analyzer (Thermo NANODROP 200, Shenyang, China). For cDNA synthesis, 600 ng of RNA was used with the Takara PrimerScriptRT reagent kit following the manufacturer's instructions. The synthesized cDNA was preserved at -20[degrees]C.

Primer Design

As the parasite-conferred infection may interfere with the immune system, metabolism, and reproduction in the hosts, genes involved in these biological processes were selected to decipher the molecular mechanisms underlying such infection. The whole genome sequence databases of the Manila clam (unpublished data) were searched for all eDNA sequences of the gene sodium--glucose transport protein (SGLTI), cytochrome P450 family 1 subfamily A member 1 (CYP1A1), lambdacrystallin (CRY), collagen alpha-1(IV) chain (COL4A), inhibitor of apoptosis protein (IAP), and 17[beta]-hydroxysteroid dehydrogenases (17-[beta]HSD). [beta]-actin was used as the reference gene. All primers were designed using primer premier 5.0 software and synthesized by Sangon Co. Ltd., Shanghai Shi, China (Table 1).

Real-Time PCR

Two microliters of the diluted cDNA was used as the template for the real-time PCR using a LightCycler 480 realtime PCR instrument (Roche, Shanghai, China). The 20-4[micro]L reaction mixtures consisted of 10 tL of SYBRPremix Ex Taq II (2x), 0.8 [micro]L each of forward and reverse primers (10 p.M), 6.4 [micro]L of dd[H.sub.2]O, and 2 [micro]L of cDNA. For each sample, the real-time PCR was performed in triplicate. The reaction parameters were 95[degrees]C for 30 sec, 40 cycles of 95[degrees]C for 5 sec, and 60[degrees]C for 30 sec. The reaction conditions for the melting curves were 95[degrees]C for 15 sec, 60[degrees]C for 1 min, and 60[degrees]C [right arrow] 95[degrees]C increasing at 0.11[degrees]C/sec, 50[degrees]C for 30 sec. The specificity and amplification efficiency of each pair of primers were investigated before performing the expression analysis. Melting curves of all the primer pairs used for the expression analysis showed single and sharp curves, demonstrating the absence of primer dimmers and the specificity of the primers. Serially diluted cDNA (2[degrees], [2.sup.1], [2.sup.2], [2.sup.3], [2.sup.4], and [2.sup.5]) was used as templates to examine the amplification efficiency of the primers, and the results showed that amplification for all the primer pairs was optimal ([R.sup.2] > 0.99).

Statistical Analysis

The [DELTA][DELTA]CT model was used to analyze data in this experiment. Relative expression of all target genes was calculated as the average value of three replicates [+ or -]SD. Analysis of variance, independent sample t-tests, and Duncan's test were used to analyze data in SPSS 18.0 and Excel. A P < 0.05 was considered to be statistically significant.

RESULTS

Observation of the Parasite and Infected Tissue

Noninfected clam gonads were milky white, whereas gonads infected with parasites were orange and relatively thinner (Fig. 1).

The mature sporocyst of the digenetic trematode was cylindrical, 3,900-4,250 gm long, and 370-470 gm wide. It contained a dark brown granular substance, an embryo cell, an embryo ball, and a large number of cercariae larvae. The heads of the cercariae were circular or elliptical, with length of 230-260 gm and width of 185-228 gm. The mid gut was very short, and its end was connected to the middle section of the "V" excretory cystic duct. The tail size was 254-410 x 38-60 gm, and the two sides of the tail had tail hairs (Fig. 2).

Eggs (Fig. 3) and sperms (Fig. 4) were only visible in the gonad of uninfected Manila clams but were absent in all thirty infected gonadal tissues (Fig. 5). Moreover, gonad damage was severe, and almost no complete gonadal tissue was present in infected clams.

Molecular Identification of the Parasite in Manila Clams The DNA sequence of the 18S rRNA gene of the parasite found in Manila clams was used for a BLAST search against the NCBI nucleotide database. The results revealed that the closest homologous species of the parasite was Steringophorus margolisi (AJ287578.1; Fig. 6), with a 92.47% identity under a 99% query cover. Other homologous species include Prosogonarium angelae, Paramphistomum cervi, Gastrothylax crumenifer, Stichorchis subtriquetrus, etc.

Gene Expression Results

Figure 7A--F shows the expression of all genes separately, which was compared between and within uninfected and infected clams. The overall expression of all representative genes in infected clams was higher than that in the control group; however, some exceptions were found in the gill tissue where CRY, IAP, and 173-HSD genes were expressed more highly in the control group than in infected clams. In the infected clams, the expression of SGLT1 in all three tissues was upregulated, and the expression in the gonad was significantly higher than that in the gills (P < 0.05; Fig. 7A), whereas, CYPIA1 expression was significantly downregulated in the gills (P < 0.05) but significantly upregulated in the mantle and gonad (P < 0.05; Fig. 7C) in the infected group. Furthermore, in infected clams, the expression of CRY and IAP was significantly higher in the gills and gonad than that in the mantle (P < 0.05), but the CRY gene did not differ significantly between the gonad and gills. This was not the case for the control group (P > 0.05; Fig. 7B, E). The expression of COL4A1 in infected clams was significantly higher (P < 0.05) in the gonads than that in the gill and mantle tissue (P < 0.05; Fig. 7D). The expression of 17[beta]-HSD was significantly upregulated in the mantle and gonad (P < 0.05; Fig. 7F) but downregulated in the gill, whereas among the control group, the expression of all genes in the gill tissue was significantly higher than that in the mantle and gonad (P < 0.05; Fig. 7).

DISCUSSION

According to the morphological characteristics, the digenetic trematode found in Manila clams was similar to the digenetic trematode type I (Vesicocoelium solenophagum). This pathogen was previously described from the coast of Zhuanghe city of China (Tang & Xu 1979, Shi 1999a, i999b, 1999c). According to the BLAST result using its 18S rRNA sequence, the digenetic trematode might be a close relative of Steringophorus margolisi. Steringophorus spp. have been found in deep-sea fishes (Bray1995) such as Monomitopus agassizii and Antimora rostrata (Bray & Campbell 1995). Marianne (1979) reported that Steringophorus furciger may only have two hosts without a metacercaria stage: the clam Nuculana minuta (Lande 1976) and the flatfish (Pleuronectiformes; Ronald 1960, Brinkmann 1975). This developmental pattern differs from that of other digenetic trematodes. For example, Acanthoparyphium tyosenense has several first intermediate hosts (Lunatia fortunei, Neverita didyma, Tympanotonus microptera, Cerithidea largillierti, and Cerithidea cingulate), several second intermediate hosts (Mactra veneriformis, Solen strictus, and R. philippinarum), and two final hosts Larus crassirostris and Melanitta fusca stejnegeri (Kim & Yu 2001). The first intermediate hosts of Bacciger harengulae were reported to be Solen strictus, Meretrix lusoria, R. philippinarum, and Laternula limicola; the second intermediate host was Palaemon (Exopalaemon) carinicauda; and the final hosts were Konosirus punctatus and Harengula zunasi (Kim & Chun 1984).

Most digenetic trematodes infect the gonad, but some infect the mantle and kidney (Cao 1989) of shellfish. In the north of China, the Manila clam has two breeding seasons: May--July and September--October (Yan et al. 2005). The observed results show that uninfected clams had entered a maturing stage of development during May--June season and contained a large number of gametes. By contrast, the gonads of infected clams were full of parasites and the tissue had greatly deteriorated (Fig. 5). Moreover, no male or female gametes were visible. Thus, infection with the trematode may negatively affect artificial breeding throughout the reproductive season.

Previous studies have reported the effects of parasite infection on gene expression in the host molluscan species, including clams, although relatively rare. The genus Perkinsus was frequently reported as the parasite. Wang et al. (2010) found that the expression levels of metallothioneins (IVC, IIE, and IIF), histone (H3.3 and H2B), and C-type lectin 1, which are related to defense, immunity, and apoptosis, respectively, were strongly upregulated in Crassostrea virginica infected with Perkinsus marinus. By contrast, calcium-binding genes such as the BTD domain containing 19 EF-hand domains and two EFhand domains, as well as member B, Cox 15 protein, troponin c, and calmodulin-binding protein, were downregulated. The expression analysis indicated that these changes were related to calcium homeostasis and immune response. Prado-Alvarez et al. (2009) reported that the expression levels of certain immune-related

genes (adiponectin-Clq, DAD-1, prosaposinlike multidomain-related protein, and thrombin) were upregulated in Ruditapes decussatus infected with Perkinsus olseni. In Manila clams, Cu/Zn- and Mn-dependent superoxide dismutase (SOD) genes were found to be differentially expressed under P. olseni infection (Hasanuzzaman et al. 2016). These researchers also reported variation in the expression of the SOD gene under P. olseni infection, which is responsible for the removal of reactive oxygen species (ROS). ROS production is an important oxygen-dependent response of bivalves against pathogens (Pipe 1992, Anderson 1994), but excessive ROS levels can cause cell damage and antioxidant paradox, in which SODs catalyze the ROS decomposition cascade (Downs et al. 2001, Droge 2002).

SGLT (sodium-dependent glucose transporter) is a cell membrane protein that absorbs glucose for energy and plays an important role in energy metabolism and transportation, as well as in immunity (Ikari et al. 2005, Palam et al. 2008). CRY (lambdacrystallin) belongs to the 3-acyl coenzyme A dehydrogenase family and participates in [beta]-oxidation during the process of fat metabolism (Zhong 2014). The expression of SGLT1 and CRY in infected Manila clam gonads was 55 times higher than that in the control group, and the expression of CRY was 12.8 times higher than that in the control group. Both genes were highly upregulated in the gills and gonads of infected clams, which indicates that infected clams accelerated the transport of sugars and the decomposition of fatty acids in response to colonization by the digenetic trematode.

Cytochrome P450 family genes have endogenous and exogenous chemical properties and play an important role in the oxidative metabolism of hazardous environmental chemicals (Hook et al. 2008). Upregulation of CYP450 was reported by Deng et al. (2014)and Zhang (2012) in Chlamys farreri and Manila clams, respectively. Similarly, Manila clams infected with the parasite in the present study exhibited increased expression of CYP1A1 in the gonad; CYP1A1 is the gene that encodes a member of the cytochorome P450 family, which serves as the terminal oxidase enzymes in the electron transfer chain. Upregulation of CYP1A1 might be related to the metabolization of toxins produced by the digenetic trematode.

Integrin is a transmembrane receptor that mediates the connection between the cell and the extracellular matrix (ECM). It interacts with actin to form a focal adhesion to connect cells and the ECM. In addition, integrin binds with collagen (an important component of the ECM) and plays an important role in the tissue scaffold. Deng et al. (2014) explored the gene expression patterns of Chlamys farreri under benzo[a]pyrene (BaP) stress and found that the expression of the integrin gene ITGA9 and the collagen gene COL6A increased at first and then decreased. In the present study, the expression of the collagen gene COL4A1 (collagen, type IV, alphal) was upregulated in the gonads of infected clams but downregulated in both the gill and mantle tissue. Like COL6A, COL4A1 is also a gene that encodes a type of a collagen protein, which is the main component of the basement membrane of all tissues. These findings indicate that damage to the ECM was caused by the activity and metabolism of parasites and that the host accelerated the synthesis of collagen to repair the tissue damage.

The inhibitor of apoptosis proteins (IAPs) belong to a highly conserved endogenous antiapoptotic factor family. IAPs inhibit cell apoptosis by inhibiting caspase activity and participating in the regulation of nuclear factor-k-gene binding k (NF-xB). Qu et al.(2015) reported that CgIAP2, which encodes a homologue of IAPs, could probably inhibit apoptosis and play a significant role in immune defense, as its highest expression was found in the gills of Crassostrea gigas and it was stimulated on bacterial challenge. Prado-Alvarez et al. (2012) found that live Vibrio splendidus and a mixture of inactivated Micrococcus luteus, V. splendidus, and Vibrio anguillarum both induced upregulation of IAP in Manila clams. In the present study, upregulation of IAP in infected clams was also observed. Parasites can cause severe damage to the gonads, and the host can lose the ability to reproduce. Under stress conditions, clams can resist infection by inhibiting cell apoptosis; however, in gonads, the formation of sperm and eggs is related to apoptosis (Chen et al. 2014); thus, the inhibition of apoptosis impacts this process. It is noteworthy that almost no sperms or eggs were visible in the gonads of infected clams.

17[beta]-hydroxysteroid dehydrogenase (17[beta]-HSD) is a type of NAD (P) H/NAD (P) + dependent oxidoreductase. The main function of 17[beta]-HSD is to participate in the metabolism of sex hormones. It plays an important role in the reproductive system by regulating the level of intracellular steroid hormones (Su et al. 2014). Some studies have shown that sex steroid hormones are closely related to the emission of shellfish gametes (Wang & Croll 2003, 2006). Liu (2014) found that expression of the 17[beta]-HSDs-8 gene in male and female gametes of Chlamys farreri decreased gradually as gametes developed and matured. In a study of reproductive endocrinology in Crassostrea angulata, the expression of 17[beta]-HSD was lower during gonad maturation and higher before development and after discharge. In the present study, the expression of 17[beta]-HSD in the gonad of the control group was low, which may be due to the gonadal maturation stage of the clams. In comparison with the control group, the infected Manila clams showed higher expression of 17[beta]-HSD in the mantle and gonad, suggesting that the parasite might have an effect on the reproductive hormones and inhibited the development and maturation of gametes.

To date, studies focusing on digenetic trematode-associated infection in shellfish are rare. Molecular mechanisms underlying the parasite-host interactions remain largely unknown. This study explored a first approach to identify the molecular mechanism that underlies the stress response of Manila clams infected with a digenetic trematode. Gene expression analyses provided preliminary data about how trematode infection affects the reproductive process in clams. Further study is required to gain insight into the molecular process of reproductive failure in Manila clams.

ACKNOWLEDGMENTS

We thank the anonymous reviewers for their helpful comments on this work. This research was supported by the Chinese Ministry of Science and Technology through the National Key Research and Development Program of China (2018YFD0901400), General project of Liaoning Province of China (L201604), Dalian high-level talent innovation support program (2017RQ062), Liao Ning Revitalization Talents Program (XLYC 1807271), and funds earmarked for Modern Agroindustry Technology Research System (CARS-49).

LITERATURE CITED

Anderson, R. S. 1994. Hemocyte-derived reactive oxygen intermediate production in four bivalve mollusks. Dev. Comp. Immunol. 18:89-96.

Bray, R. A. & R. A. Campbell. 1995. Fellodistomidae and Zoogonidae (Digenea) of deep-sea fishes of the NW Atlantic Ocean. Syst. Parasitol. 31:201-213.

Bray, R. A. 1995. Steringophorus odhner, 1905 (Digenea: Fellodistomidae) in deep-sea fish. Can. J. Fish. Aquas. Sci. 52:71-77.

Bray, R. A., A. Soto & D. Rollinson. 1994. The status and composition of the genus Steringophorus odhner, 1905 (Digenea: Fellodistomidae), based on partial small subunit rRNA sequences. Int. J. Parasitol. 24:433-435.

Brinkmann, A. J. R. 1975. Trematodes from Greenland. Meddr Grl1ffiland 205:1-88.

Cao, H. 1989. A new species of oriental fluke in bivalves and its life history. Dong Wu Xue Bao 35:58-65.

Chen, Q. S., J. H. Zeng, Y. X. Zhao & H. J. Chen. 2014. Study on the relationship between sperm development regulation and apoptosis. In: Guangxi Animal Husbandry and Veterinary Society 2014 Annual Meeting.

Dang, C., P. Gonzalez, N. Mesmer-Dudons, J. R. Bonami, N. Caill-Milly & X. de Montaudouin. 2009. Virus-like particles associated with brown muscle disease in Manila clam, Ruditapes philippinarum, in Arcachon Bay (France). J. Fish Dis. 32:577-84.

De, M. X., H. Bazairi, K. A. Mlik & P. Gonzalez. 2014. Bacciger bacciger (Trematoda: Fellodistomidae) infection effects on wedge clam Donax trunculus condition. Dis. Aquat. Organ. 111:259-267.

Deng, X., L. Pan, J. Miao, Y. Cai & F. Hu. 2014. Digital gene expression analysis of reproductive toxicity of benzo[a]pyrene in male scallop Chlamys farreri. Ecotoxicol. Environ. Sal. 110:190-196.

Department of Fisheries (DOF). 2016. China fisheries statistic year book. Beijing, China: China Agriculture Press. 33 pp.

Dheilly, N. M., C. Adema, D. A. Raftos, B. Gourbal, C. Grunau & L. Du Pasquier. 2014. No more non-model species: the promise of next generation sequencing for comparative immunology. Dev. Comp. Immunol. 45:56-66.

Downs, C. A., J. E. Fauth & C. M. Woodley. 2001. Assessing the health of grass shrimp (Palaemonetes pugio) exposes to natural and anthropogenic stressors: a molecular biomarker system. Mar. Biotechnol. (NY) 3:380-397.

Droge, W. 2002. Free radicals in the physiological control of cell function. Physiol. Rev. 82:47-95.

Guo, M. G., W. Li, G. Chen & M. Kang. 2015. Observation and identification of fasciola in Qinghai. Anim. Husb. Vet. Med. 47:101-103.

Hasanuzzaman, A. F. M., D. Robledo, A. Gomez-Tato, J. A. A. Dios, P. W. Harrison, A. Cao & S. Fernandez-Boo. 2016. Transcriptomic profile of Manila clam (Ruditapes philippinarum) haemocytes in response to Perkinsus olseni infection. Aquaculture 467:170-181.

Hook, S. E., M. E. Cobb, J. T. Oris & J. W. Anderson. 2008. Gene sequences for cytochromes p450 IA1 and 1A2: the need for biomarker development in sea otters (Enhydra lutris). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 151:336-348.

Huo, Z. M., X. T. Li & Q. Sun. 2016. Growth performance of larval and juvenile Manila clam (Ruditapes philippinarum) from divergently selected individuals of a full-sib family. J. Ocean Univ. China 15:1046-1050.

Ikari, A., Y. Nagatani, M. Tsukimoto, M. Miwa & K. Takagi. 2005. Sodium-dependent glucose transporter reduces peroxynitrite and cell injury caused by cisplatin in renal tubular epithelial cells. Biochim. Biophys. Acta. 1717:109-117.

Khamdan, S. A. A. 1998. Occurrence of Bucephalus sp. trematode in the gonad of the pearl oyster, Pinctada radiata. Environ. Int. 24:117-120.

Kim, Y. G. & S. K. Chun. 1984. Studies on the life history of bacciger harengulae. J. Korean Soc. Surv. Geod. Photogramm. Cartogr. 1724:66-69.

Kim, Y. G. & J. E. Yu. 2001. Studies on the life history of Acanthoparyphium tyosenense Yamaguti, 1939. Korean Fish. Soc. 34:720-728.

Lande, R. 1976. Food and feeding habits of the Dab (Limanda limanda (L.)) in Borgentjjorden, North Trondelag, Norway. Norw. J. Zool. 24:225-230.

Lee, M. K., B. Y. Cho, S. J. Lee, J. Y. Kang, H. D. Jeong, S. H. Huh & M. D. Huh. 2001. Histopathological lesions of Manila clam Tapes philippinarum, from Hadong and Namhae coastal areas of Korea. Aquaculture 201:199-209.

Liu, J. G. 2014. The potential role of sex steroid hormones and 17[beta]-HSD 8 in the development of the gonads. Qingdao City, China: Ocean University of China.

Marianne, K. 1979. On the morphology and life-history of Monascus [=Haplocladus] filiformis (Rudolphi, 1819) Looss, 1907 and Steringophorus furciger (Olsson, 1868) Odhner, 1905 (Trematoda, Fellodistomidae). Ophelia 18:113-132.

McManus, D. P., J. Bowles & B. Wu. 1997. The value of molecular genetic methods in identification and classification of parasites. Int. J. Med. Parasitol. 5:201-206.

Paillard, C. & P. Maes. 1995. The Brown ring disease in the Manila clam, Ruditapes philippinarum: II. Microscopic study of the brown ring syndrome. J. Invertebr. Pathol. 65:101-110.

Palazzo, M., S. Gariboldi, L. Zanobbio, S. Sellen, G. F. Dusio, V. Mauro, A. Rossini, A. Balsari & C. Rumio. 2008. Sodiumdependent glucose transporter-1 as a novel immunological player in the intestinal mucosa. J. Immunol. 181:3126-3136.

Park, K. I., C. Paillard, C. P. Le & K. S. Choi. 2006. Report on the occurrence of brown ring disease (BRD) in Manila clam, Ruditapes philippinarum, on the west coast of Korea. Aquaculture 255:610-613.

Pipe, R. K. 1992. Generation of reactive oxygen metabolites by the hemocytes of the mussel Mytilus eduli.s. Dev. Comp. Immunol. 16:111-122.

Prado-Alvarez, M., C. Gestal, B. Novoa & A. Figueras. 2009. Differentially expressed genes of the carpet shell clam Rudirges decussatus against Perkinsus olsem. Fish Shellfish Immunol. 26:72-83.

Prado-Alvarez, M., A. Romero, P. Balseiro, S. Dios, B. Novoa & A. Figueras. 2012. Morphological characterization and functional immune response of the carpet shell clam (Ruditapes decussatus) haemocytes after bacterial stimulation. Fish Shellfish Immunol. 32:69-78.

Qu, T., L. Zhang, W. Wang, B. Huang, Y. Li, Q. Zhu, L. Li & G. Zhang. 2015. Characterization of an inhibitor of apoptosis protein in Crassostrea gigas clarifies its role in apoptosis and immune defense. Dev. Comp. Immunol. 51:74-78.

Ren, S. L. & W. B. Song. 2002. Histopathology of bucephalidae larvae caused disease in Meretrix meretrix. Shuichan Xuebao 26:459-464.

Romero, A., G. Forn-Cuni, R. Moreira, M. Milan, L. Bargelloni, A. Figueras & B. Novoa. 2015. An immune-enriched oligo-microarray analysis of gene expression in Manila clam (Venerupis philippinarum) haemocytes after a Perkinsus olseni challenge. Fish Shellfish Immunol. 43:275-286.

Ronald, K. 1960. The metazoan parasites of the heterosomata of the Gulf of St. Lawrence. VI.Digenea. Can. J. Zool. 38:923-937.

Sohn, W. M., B. K. Na, S. H. Cho & W. J. Lee. 2017. Prevalence and density of digenetic trematode metacercariae in clams and oysters from western coastal regions of the Republic of Korea. Korean J. Parasitol. 55:399-408.

Shi, L. 1999a. Scanning electron microscopic observation on the sporocyst and cercariae of Vesicocoelium solenophagum. J. Parasitol. Med. Entomol. 4:208-212.

Shi, L. 1999b. Histologic and histochemical observation of the different developmental stages of cercariae of Vesicocoelium solenophagum. J. Xiamen Univ. 38:471-476 (Natural Science Edition).

Shi, L. 1999c. Pathological and histochemical study on Vesicocoelium solenophagum diseases in Sinonovacula constricta. J. Parasitol. Med. Entomol. 6:153-160.

Su, W., H. M. Xu, J. H. Kang & Y. F. Guan. 2014. Function of 17 beta hydroxy steroid dehydrogenase. Prog. Physiol. Sci. 45:27-31.

Tang, C. T. & Z. Z. Xu. 1979. Study on Vesicocoelium solenophagum in Sinonovacula constricta on Jiulong Estuary in Fujian. Dong Wu Xue Bao 25:336-345.

Wang, C. & R. P. Croll. 2003. Effects of sex steroids on in vitro gamete release in the sea scallop, Placopecten magellanicus. Invertebr. Reprod. Dev. 44:89-100.

Wang, C. & R. P. Croll. 2006. Effects of sex steroids on spawning in the sea scallop, Placopecten magellanicus. Aquaculture 256:423-432.

Wang, S., E. Peatman, H. Liu, D. Bushek, S. E. Ford, H. Kucuktas, J. Quilang, P. Li, R. Wallace, Y. P. Wang, X. M. Guo & Z. J. Liu. 2010. Microarray analysis of gene expression in eastern oyster (Crassostrea virginica) reveals a novel combination of antimicrobial and oxidative stress host responses after dermo (Perkinsus marinus) challenge. Fish Shellfish Immunol. 29:921-929.

Yan, X. W., G. F. Zhang, F. Yang & J. Liang. 2005. Biological comparisons between putian population and dalian population of Manila clams Ruditapes philippenarum. Acta Ecol. Sin. 25:3329-3334.

Yan, X. W., G. F. Zhang & F. Yang. 2006. Effects of diet, stocking density and environmental factors on growth, survival and metamorphosis of Manila clam Ruditapes philippinarum larvae. Aquaculture 253:350-358.

Zhang, G. F. & X. W. Yan. 2006. A new three-phaseculture method for Manila clam, Ruditapes philippinarum, farming in northern China. Aquaculture 258:452-461.

Zhang, L. B. 2012. Study on molecular biomarkers of stress response to Ruditapes philippinarum. Qingdao City, China: University of Chinese Academy of Sciences.

Zhong, R. 2014. Differential proteomic analysis of Panonychus citri response to avermectin stress. Chongqing City, China: Southwestern University.

XIANGYU MENG, YUE TAN, ([dagger]) WENWEN YANG, GOLAM RBBANI, XIWU YAN, LEI FANG (*) AND ZHONGMING HUO (*)

Engineering Research Center of Shellfish Culture and Breeding in Liaoning Province, College of Fisheries and Life Science, Dalian Ocean University, 52 Heishijiao Street, Shahekou District, Dalian 116023, China

(*) Corresponding authors. E-mails: fanglei2014@dlou.edu.cn or huozm@dlou.edu.cn

([dagger]) These authors contributed equally to this work.

DOI: 10.2983/35.038.0207
TABLE 1.
Primers used for the target genes.

Name of the gene        Primers (5'-3')

     SGLT1        F CTTTTCTTATCTCGTTGATGTGGAC
                  R CAAAATAGAGAACAACGGAAGACAC
     CYPIA1       F ATTATCCAGGTCAAGGTTGATTGG
                  R AATGGCCCACTGGAGTGATGTA
      CRY         F ATAGGTTCATCGTCGTACATCCG
                  R GAACCACGTCCGAATCTACCC
     COL4A        F GCGATTGGTGTAGGAAATGGAA
                  R CCATGCTGCGTATGCTGTACTGTTA
      IAP         F TTGGATGATTACATTCGGGATAGAC
                  R ATA CTG CTCGTGGAAAGTCGTTG
  17-[beta]HSD    F ATAAAGGAGGCCATTGAGAAGAC
                  R TCATCTATTGAAGAAGGCCCTG
  [beta]-Actin    F CTCCCTTGAGAAGAGCTACGA
                  R GATACCAGCAGATTCCATACCC
COPYRIGHT 2019 National Shellfisheries Association, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2019 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Meng, Xiangyu; Tan, Yue; Yang, Wenwen; Rbbani, Golam; Yan, Xiwu; Fang, Lei; Huo, Zhongming
Publication:Journal of Shellfish Research
Article Type:Report
Geographic Code:9CHIN
Date:Aug 1, 2019
Words:5009
Previous Article:MACROFAUNAL COMMUNITY STRUCTURE FOLLOWING THE RESTOCKING OF NORTHERN QUAHOG (MERCENARIA MERCENARIA) TO GREAT SOUTH BAY, LONG ISLAND, NY.
Next Article:GROWTH VARIATIONS IN THE GEODUCK PANOPEA GLOBOSA IN DIFFERENT CLIMATOLOGICAL REGIONS OF NORTHWESTERN MEXICO.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters