Printer Friendly

First Report of the Molecular Characterization of the Endosymbiont Candidatus portiera aleyrodidarum from Cotton Whiteflies Collected from Pakistan.

Byline: Ayesha Bibi, Muhammad Shafiq, Saima Arif, Asma Tanveer, M. Tariq Manzoor and Muhammad Saleem Haider

Abstract

Candidatus portiera aleyrodidarum is an obligate primary endosymbiont harboured by whiteflies including the cotton whitefly, Bemisia tabaci (Gennadius). A survey of C. portiere endosymbionts was conducted by using polymerase chain reaction with universal primers for 16SrDNA within Pakistani whitefly population collected from different cotton growing areas of the Punjab, further analysed by cloning of the PCR products, RFLP analysis. Finally sequences were obtained from commercial labs and phylogenetic analysis were done of all the detected C. portiera clones. This is the first report regarding the identification of C. protiera from the Pakistan. The C. portiera was detected almost in all the samples of whiteflies from 16 different locations of Punjab, Pakistan. This study aims to contribute to the understanding of the primary endosymbionts, their host specificity and their diversity across the world.

Keywords: Whitefly; Primary endosymbiont; 16S rDNA; Candidatus portiera

Introduction

Endosymbionts are universal in nature and responsible for the evolution of the insects for millions of years (Baumann, 2005). Primarily, insect endosymbionts can be grouped into primary and secondary endosymbionts (Werren, 1997). Endosymbionts have been stabilized within host by fulfilling their nutritional requirement for their physiological functions and metabolism. From DNA and protein metabolism to glycolysis, from lipid biosynthesis to cell processes, there are several functions in which these endosymbionts are involved, ultimately reaching epic level of vertical transmission to next progeny (Ahmed et al., 2010). Endosymbionts are mainly grouped in two categories; primary also called P-endosymbionts and secondary also called as S-endosymbionts (Baumann and Baumann, 2005). First group of endosymbionts are mostly present in individuals of all hosts and provides important nutrients to the individual and transmitted vertically.

According to Baumann and Baumann (2005), P- endosymbionts have evolved with insects individual for long time and have a close relationship with individual hosts. Second group of endosymbionts (S-endosymbionts) are transmitted in insects individuals vertically and horizontally while having facultative relationship with their host (Thao et al., 2002; Thao and Baumann, 2004; Bing et al., 2013). S-endosymbionts play negative role in the survival of host as well as create contribution to the insect hosts. For example, the types of S- endosymbionts, which can provide nutrients are Rickettsia, Regiella, Wolbachia, Hamiltonella and Serratia (Thao et al., 2002; Thao and Baumann, 2004; Bing et al., 2013) and improve tolerance to heat stress (Rosic et al., 2010; Ratzka et al., 2011; Weston et al., 2012; Nachappa et al., 2012; Cayetano and Vorburger, 2013; Donati et al., 2013; Mavrianos et al., 2013; Gauthier et al., 2015; Enders et al., 2015).

Simultaneously, S-endosymbionts are likely to be parasitic rather than beneficial to the insect hosts, for example Cardinium, Arsenophonus, Wolbachia and Rickettsia (Thao et al., 2002; Thao and Baumann, 2004; Bing et al., 2013).

The insect's reproduction manipulate by them by forcing asexuality, feminizing genetic males, killing males and inducing cytoplasmic incompatibility (CI) together with parthenogenesis. The spread of infection into the host population is being assisted by this apparent effect (Werren, 1997; Clark et al., 2008).

Candidatus portiera is an obligate primary endosymbiont harboured by Bemisia tabaci, it is localized in specialized cells known as 'Bacteriocytes" (Baumann and Baumann, 2005). C. portiera is thought to be associated with whiteflies for approximately 180 million years. It is known to have been associated with carotenoid biochemical pathway of whiteflies thus providing essential nutrient to its host (Sloan and Moran, 2012). In whiteflies, the bacterial homologues of the fungal carotenoid biosynthesis genes are exhibited by C. portiera.

Bemisia tabaci (Family: Aleyrodidae) is small sap sucking insect commonly known as sweet potato or cotton whitefly (Ahmed et al., 2010). By direct feeding on phloem and also by transmitting Geminiviruses, this insect reduces the plant vigour (Bedford et al., 1994; Perefarres et al., 2012), while B. tabaci consists of 24 identical species known as biotypes (De Barro et al., 2011). The most invasive biotypes are Q and B which are involved in economic losses worth of millions annually" (Khasdan et al., 2005). "These biotypes differ on the basis of biochemical polymorphism, host range insecticide resistance and transmission competency (Ahmed et al., 2010). Endosymbionts can potentially induce population differentiation. We investigate the C. Portiera community in B. tabaci from Pakistan. This work would further help to explore bacterial endosymbiont-host association at a small evolutionary scale and the role of these communities in the evolution of B. tabaci species complex.

Materials and Methods

Sampling and DNA Extraction

The whiteflies, B. tabaci samples were collected from different districts of Punjab (Pakistan) from cotton fields during the year 2012. Collection details are summarized in Table 1 (location and host). Samples were preserved in ethanol (95%) and kept at -20C before DNA extraction. De Barro and Driver method was used for total genomic DNA extraction from whitefly individuals (De Barro et al., 2011).

Amplification of 16S-rRNA Gene

DNA extracted from B. tabaci was verified by agarose gel electrophoresis. Verification of C. portiera that targeted 16S-rRNA gene, primers was used. For specific forward primer 16S-rRNA gene, the sequence was F, 5'- TGCAAGTCGAGCGGCATCAT -3' while for reverse primer, it was R 5'- AAAGTTCCCGCCTTATGCGT -3' (Gueguen et al., 2010). PCR was performed by hot start method by using reaction mixture of 25 uL containing 5 uL of template DNA, 2.5 uL of 10X PCR buffer, 0.25uL of Taq DNA polymerase, 2.5 uL of MgCl2 (25 mM), 2.5 uL of dNTPs (2 mM in each), primer (0.5 uL in each) and double distilled water up to 12.25 uL for the reaction mixture. PCR conditions were: hot lid at 112C, Denaturation time was 94C for three minutes followed by 30 cycles at 94C for 30 s, annealing temperature was 55C for 30 sec followed by elongation time 30 s at 72C. Final extension time was 10 min at 72C. The PCR product was confirmed at 0.1% agarose gel.

Cloning and Sequencing

The amplifications were ligated in pTZ57R/T cloning vector. Vector containing products were transformed further into E. coli DH5a using heat-shock method (42C, for 2 min). The transformants were cultured on LB-plates supplemented with Ampicillin, IPTG and X-gal for selection of positive clones based on blue-white selection. The white colonies were transferred to culture tubes and plasmids were purified using plasmid extraction kit (Fermentas). The positive clones were confirmed via restriction analyses using EcoR1 and Pst1 enzymes. Positive clones were sequenced by Macrogen Korea.

Phylogenetic Analysis

Primary analysis of clones for assembling and analysing was done with the aid of Laser gene Software (DNAStar Inc., Madison, WI, USA), which was submitted to GenBank. Phylogenetic dendrograms were obtained by using MEGA 6 and alignment was done by MUSCLE v. 3.7.

Results

The PCR assay based investigation using the C. portiera specific universal primers yielded amplification for the endosymbiont. It is revealed that C. portiera is present among the B. tabaci population as all the samples from different locations yielded amplifications. The 16S - rRNA gene was successfully amplified from samples produced an amplicon of an average size of 1070bp. The clones obtained from amplified samples were named as A12 (Acce. No LN717258), A13 (Acce. No LN717259), A14 (Acce. No LN717260). The sequence analyses revealed these clones to show 95-99 percent similarities with the BLAST results of NCBI. However, clones identified in this study showed higher (99.2%) similarities with the sequences from Indian and Chinese samples (Chu et al., 2006; Pan et al., 2012).

Present results have clearly established that B. tabaci population were infected with C. portiera in Vehari and Mianwali. The computational analyses were carried out for the sequenced 16S-rRNA genes using various software. A total of 30 aligned sequences of C. portiera for 16S- rRNA gene belonging to whitefly were included in the analyses (Fig. 1).

By using the maximum Parsimony method, the evolutionary history was determined. The 5 most parsimonious trees were used to construct the consensus tree (Fig. 1). Branches equivalent to partitions reproduced in less than 64% trees were collapsed. The index of consistency was 0.949045 (0.714286), the index of retention is 0.836735 (0.836735) and the index of composite was 0.794099 (0.597668) for all parsimony-informative sites and all sites (in parentheses). By using the Subtree-Pruning-Regrafting (SPR) algorithm (Nei, 2000) with search level 0 in which the initial trees were obtained by the random addition of sequences (10 replicates), the MP tree was obtained.

The analysis involved 30 nucleotide sequences. Codon positions included were 1st+2nd+3rd+Noncoding. All positions containing gaps and missing data were eliminated.

Table 1: Characterization of C. portiera 16S rDNA sequence isolated from B. tabaci

Clone###LOCATION###Size bps###Highest homology with Gene Bank sequence###% homology

A12###Vehari###1099###AF400459_Portiera_2002_USA_host_Bemisia_tabaci###99.2

A13###Vehari###1079###AF400459_Portiera_2002_USA_host_Bemisia_tabaci###98.3

A14###Mianwali###1092###JN204488_Portiera_2012_India_host_Bemisia_tabaci###99.1

There were a total of 904 positions in the final dataset. Evolutionary analyses were conducted using MEGA6. The analyses involved 30 nucleotide sequences. Codon positions were included. All positions containing gaps and missing data were eliminated. There were a total of 904 positions in the final dataset. Evolutionary analyses were conducted in MEGA6.

It is clearly evident from the phylogenetic tree that the clones A12, A13, A14 formed a separate clade with Indian and Chinese clones (Chu et al., 2006; Pan et al., 2012)

These clones have about 95-99.2% similarity (Table 1).

Discussion

C. Portiera is obligate, primary endosymbiotic bacterium of whiteflies, including the sweet potato whitefly B. tabaci, and provides essential nutrients to its host (Jiang et al., 2012; Ito et al., 2012; Kuechler et al., 2013; Santos-Garcia et al., 2014). Complete genome of this bacterium from the B and Q biotypes of B. tabaci was also sequenced (Jiang et al., 2012). B. tabaci samples collected from different cotton growing regions in Punjab were positive for prevalence of this primary endosymbiont. Previous studies have revealed that PCR amplification of the 16S rRNA gene, a highly conserved region within the bacterial genome, is helpful in the detection and identification of the prokaryotes (Mariani and Tuan, 1998). For the same reason, 16S specific primers were used in this study for detection of the C. portiera in whitefly populations.

The phylogenetic analyses suggested high degree of genetic similarity among the C. portiera's clones of B. tabaci from Pakistan and further suggested high degree of genetic ancestral lineage among these clones. These results suggested a definite but undefined pattern of genetic lineages. In addition, all the whitefly populations tested in this study, harboured the endosymbiont suggesting that C. portiera is evenly distributed among the whitefly population in different cotton growing regions.

Additionally, P-endosymbionts were phylogenetically analysed to distinguish their evolutionary relationships. Results of this recent study in the laboratory may be effective in the field population and will provide basic knowledge of endosymbionts associated with B. tabaci.

References

Ahmed, M.Z., S.X. Ren, X. Xue, X.X. Li, G.H. Jin and B.L. Qiu, 2010. Prevalence of endosymbionts in Bemisia tabaci populations and their in vivo sensitivity to antibiotics. Curr. Microbiol., 61: 322-328

Baumann, L. and P. Baumann, 2005. Cospeciation between the primary endosymbionts of mealybugs and their hosts. Curr. Microbiol., 50: 84-87

Baumann, P., 2005. Biology of bacteriocyte-associated endosymbionts of plant sap-sucking inscets. Annu. Rev. Microbiol., 59: 155-189

Bedford, I.D., R.W. Briddon, J.K. Brown, R. Rosell and P.G. Markham, 1994. Geminivirus transmission and biological characterisation of Bemisia tabaci (Gennadius) biotypes from different geographic regions. Anna. Appl. Biol., 125: 311-325

Bing, X.L., Y.M. Ruan, Q. Rao, X.W. Wang and S.S. Liu, 2013. Diversity of secondary endosymbionts among different putative species of the whitefly Bemisia tabaci. Insect Sci., 20: 194-206

Cayetano, L. and C. Vorburger, 2013. Effects of heat shock on resistance to parasitoids and on life history traits in an aphid/endosymbiont system. PLoS One, 8: e75966

Chu, D., Y.J. Zhang, J.K. Brown, B. Cong, B.Y. Xu, Q.J. Wu and G.R. Zhu, 2006. The introduction of the exotic Q biotype of Bemisia tabaci from the Mediterranean region into China on ornamental crops. Florida Entomol., 89: 168-174

Clark, M.E., C. Bailey-Jourdain, P.M. Ferree, S.J. England, W. Sullivan, D.M. Windsor and J.H. Werren, 2008. Wolbachia modification of sperm does not always require residence within developing sperm. Heredity (Edinb), 101: 420-428

De Barro, P.J., S.S. Liu, L.M. Boykin and A.B. Dinsdale, 2011. Bemisia tabaci: a statement of species status. Annu. Rev. Entomol., 56: 1-19

Donati, A.J., H.I. Lee, J.H. Leveau and W.S. Chang, 2013. Effects of indole-3-acetic acid on the transcriptional activities and stress tolerance of Bradyrhizobium japonicum. PLoS One, 8: e76559

Enders, L.S., R.D. Bickel, J.A. Brisson, T.M. Heng-Moss, B.D. Siegfried, A.J. Zera and N.J. Miller, 2015. Abiotic and biotic stressors causing equivalent mortality induce highly variable transcriptional responses in the soybean aphid. G3 (Bethesda), 5: 261-270

Gauthier, J.P., Y. Outreman, L. Mieuzet and J.C. Simon, 2015. Bacterial communities associated with host-adapted populations of pea aphids revealed by deep sequencing of 16S ribosomal DNA. PLoS One, 10: e0120664

Gueguen, G., F. Vavre, O. Gnankine, M. Peterschmitt, D. Charif, E. Chiel, Y. Gottlieb, M. Ghanim, E. Zchori-Fein, and F. Fleury, 2010. Endosymbiont metacommunities, mtDNA diversity and the evolution of the Bemisia tabaci (Hemiptera: Aleyrodidae) species complex. Mol. Ecol., 19: 4365-4376

Ito, A., J. Matsuo, S. Nakamura, A. Yoshida, M. Okude, Y. Hayashi, H. Sakai, M. Yoshida, K. Takahashi and H. Yamaguchi, 2012. Amoebal endosymbiont Protochlamydia induces apoptosis to human immortal HEp-2 cells. PLoS One, 7: e30270

Jiang, Z.F., F. Xia, K.W. Johnson, E. Bartom, J.H. Tuteja, R. Stevens, R.L. Grossman, M. Brumin, K.P. White and M. Ghanim, 2012. Genome sequences of the primary endosymbiont "Candidatus Portiera aleyrodidarum" in the whitefly Bemisia tabaci B and Q biotypes. J. Bacteriol., 194: 6678-6679

Khasdan, V., I. Levin, A. Rosner, S. Morin, S. Kontsedalov, L. Maslenin and A. Horowitz, 2005. DNA markers for identifying biotypes B and Q of Bemisia tabaci (Hemiptera: Aleyrodidae) and studying population dynamics. Bull. Entomol. Res., 95: 605-613

Kuechler, S.M., G. Gibbs, D. Burckhardt, K. Dettner and V. Hartung, 2013. Diversity of bacterial endosymbionts and bacteria-host co-evolution in Gondwanan relict moss bugs (Hemiptera: Coleorrhyncha: Peloridiidae). Environ. Microbiol., 15: 2031-2042

Mariani, B.D. and R.S. Tuan, 1998. Advances in the diagnosis of infection in prosthetic joint implants. Mol. Med. Today, 4: 207-213

Mavrianos, J., E.L. Berkow, C. Desai, A. Pandey, M. Batish, M.J. Rabadi, K.S. Barker, D. Pain, P.D. Rogers, E.A. Eugenin and N. Chauhan, 2013. Mitochondrial two-component signaling systems in Candida albicans. Eukaryot Cell, 12: 913-922

Nachappa, P., J. Levy and C. Tamborindeguy, 2012. Transcriptome analyses of Bactericera cockerelli adults in response to "Candidatus liberibacter solanacearum" infection. Mol. Genet. Genom., 287: 803-817

Nei, M.K.S., 2000. Molecular Evolution and Phylogenetics, p: 333. Oxford University Press, New York, USA

Pan, H., X. Li, D. Ge, S. Wang, Q. Wu, W. Xie, X. Jiao, D. Chu, B. Liu and B. Xu, 2012. Factors affecting population dynamics of maternally transmitted endosymbionts in Bemisia tabaci. PLoS One, 7: e30760

Perefarres, F., M. Thierry, N. Becker, P. Lefeuvre, B. Reynaud, H. Delatte and J.M. Lett, 2012. Biological invasions of geminiviruses: case study of TYLCV and Bemisia tabaci in Reunion Island. Viruses, 4: 3665-3688

Ratzka, C., C. Liang, T. Dandekar, R. Gross and H. Feldhaar, 2011. Immune response of the ant Camponotus floridanus against pathogens and its obligate mutualistic endosymbiont. Insect Biochem. Mol. Biol., 41: 529-536

Rosic, N.N., M. Pernice, S. Dunn, S. Dove and O. Hoegh-Guldberg, 2010. Differential regulation by heat stress of novel cytochrome P450 genes from the dinoflagellate symbionts of reef-building corals. Appl. Environ. Microbiol., 76: 2823-2829

Santos-Garcia, D., A. Latorre, A. Moya, G. Gibbs, V. Hartung, K. Dettner, S.M. Kuechler and F.J. Silva, 2014. Small but powerful, the primary endosymbiont of moss bugs, Candidatus evansia muelleri, holds a reduced genome with large biosynthetic capabilities. Genom. Biol. Evol., 6: 1875-1893

Sloan, D.B. and N.A. Moran, 2012. Endosymbiotic bacteria as a source of carotenoids in whiteflies. Biol. Lett., 8: 986-989

Thao, M.L. and P. Baumann, 2004. Evidence for multiple acquisition of Arsenophonus by whitefly species (Sternorrhyncha: Aleyrodidae). Curr. Microbiol., 48: 140-144

Thao, M.L., P.J. Gullan and P. Baumann, 2002. Secondary (gamma- Proteobacteria) endosymbionts infect the primary (beta- Proteobacteria) endosymbionts of mealybugs multiple times and coevolve with their hosts. Appl. Environ. Microbiol., 68: 3190-3197

Werren, J.H., 1997. Biology of Wolbachia. Annu Rev. Entomol., 42: 587-609

Weston, A.J., W.C. Dunlap, J.M. Shick, A. Klueter, K. Iglic, A. Vukelic, A. Starcevic, M. Ward, M.L. Wells, C.G. Trick and P.F. Long, 2012. A profile of an endosymbiont-enriched fraction of the coral Stylophora pistillata reveals proteins relevant to microbial-host interactions. Mol. Cell. Proteomics, 11: 1-19
COPYRIGHT 2016 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Bibi, Ayesha; Shafiq, Muhammad; Arif, Saima; Tanveer, Asma; Manzoor, M. Tariq; Haider, Muhammad Sale
Publication:International Journal of Agriculture and Biology
Article Type:Report
Geographic Code:9PAKI
Date:Apr 30, 2016
Words:3008
Previous Article:Optimal Supply of Water and Nitrogen Improves Grain Yield, Water Use Efficiency and Crop Nitrogen Recovery in Wheat.
Next Article:Prediction of Nutrient Leaching from Culture of Containerized Buddhist Pine and Japanese Maple Seedlings Exposed to Extended Photoperiod.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters