Printer Friendly

Features of gene polymorphisms regulating lipid metabolism and ID polymorphism of ace gene in Uzbek patients with unstable angina with a family history of coronary heart disease.

Introduction

It is known that in the development of coronary heart disease (CHD), together with phenotypic factors of the environment (Kannel et al., 1976; Kotceva et al., 2009) the genetic predisposition to disease plays an important role. Conduction of simultaneous analysis of all candidate genes is currently intricate problem; therefore, it's important to release a group of genes with potentially the greatest contribution to the pathogenesis of disease. Polymorphism of genes regulating lipid transport and metabolism--apolipoprotein E, B and A--plays an important role in lipid metabolism and can directly influence the development of atherosclerosis. The proteins of apolipoproteins E, B, A are involved in creating, secretion, transport, and binding of macromolecular lipoprotein complexes (Fielding and Fielding, 1995; Gerdes et al., 2000; Van't Hooft et al., 1999). Angiotensin-converting enzyme (ACE) is a key enzyme of the renin-angiotensin system (RAS) plays an important role in the regulation of hemodynamics and blood pressure, control of water-salt metabolism and cell growth (Kurtz, 1992).

Objective

To study distribution of apolipoprotein E, B and A genes polymorphism, regulating lipid metabolism--and ID polymorphism of ACE gene in Uzbek patients with unstable angina, depending on the availability of family history of CHD.

Materials and methods

The study included patients receiving inpatient treatment in Republican Specialized Center of Cardiology. There were examined 125 Uzbek patients with unstable angina (class IIB), and hypercholesterolemia (low-density lipoprotein (LDL) cholesterol > 100 mg/dl). Control group consisted of 58 healthy Uzbek subjects without clinical and instrumental diagnostic signs of CHD (according to exercise test), comparable with the patients by age and sex, with no family history of CHD. There were excluded patients with myocardial infarction (MI), transferred in previous 3 months, patients with diabetes type 2 requiring insulin treatment, with II-III degree hypertension (BP>159/99 mmHg), hypotension (BP<100/60 mmHg), atrial fibrillation and life-threatening ventricular arrhythmias, chronic obstructive pulmonary disease, patients receiving long-term lipid-lowering drugs and angiotensin-converting enzyme inhibitors (ACEi), with chronic heart failure higher than I FC (NYHA), chronic renal and hepatic failure. For objective assessment of level of inflammation biomarkers, exclusion criteria also included: presence acute infectious disease or exacerbation of chronic infectious disease, inflammatory and autoimmune diseases in less than 1 month after complete clinical and laboratory remission. All patients gave informed consent to participate in the study.

Family history

Evaluation of family history conducted on basis of survey using a standard questionnaire by WHO, "Family History". We registered presence of death (in consequence of myocardial infarction or stroke) in 1st degree relatives (parents, siblings, and children), old myocardial infarction, and presence of hypertension. Family history considered burdened in the presence of a patient with 2 or more affected relatives. Initially, diagnosis of unstable angina was verified on basis of: complaints--a characteristic of the dynamics of pain on the background of the therapy; history--presence of angina or a history of myocardial infarction (not older than 3 months); dynamics of the ECG (transient ST-depression more than 1 mm, the lack of elevation ST), lack of troponin I increase, ECG Holter monitoring; echocardiography--revealing signs of disturbances of local contractility (hypokinesia, dyskinesia), evaluation of global left ventricular contractility.

Ultrasound examination of carotid arteries--determined thickness of the intima-media complex (IMC) of common carotid artery (CCA) by scanning B-mode color Doppler flow mapping in the ultrasound system "ALOKA--Multi View" (Japan) linear transducer with a frequency of 7 MHz [20m].

Echocardiography: performed on echocardiograph "ALOKA--Multi-View" by the standard method as recommended by the American Association of Echocardiography, there were measured: end-diastolic size, end-systolic size of LV, left ventricular posterior wall thickness (LVPWT) and interventricular septum (IVST) in diastole. All measurements were performed at least 5 cardiac cycles, and then results were averaged.

ECG Holter monitoring performed to verify the diagnosis in patients with unstable angina: according to standard method on the unit Cardiolab, (HAI, Ukraine).

Determination of lipid profile. In studying the lipid profile content were determined: total cholesterol, triglycerides, HDL cholesterol, LDL and VLDL cholesterol very low density, coefficient of atherogenicity. Blood sampling was carried out on the next day after admission to hospital, in the morning, after 12 hours of fasting, from the cubital vein, in the horizontal position of the patient. Determination of blood lipid levels--total cholesterol (TC), high density lipoprotein (HDL), triglycerides (TG)--performed by enzymatic method on biochemical analyzer "Daytona" (RANDOX, UK).

The concentration of LDL-C was determined by the Fridvald's formula:

LDL-C=TC-HDL-TG/5 (mg/dl);

Atherogenic ratio (AR) was determined by the formula:

AR=(Cholesterol--HDL cholesterol)/HDL-C (relative unit).

TC in blood serum <200 mg/dL, HDL-C>40 mg/dL, TG<150 mg/dl was considered as normal values.

Concentration of high sensitive C-reactive protein was determined by a highly sensitive particle-enhanced turbidimetric immunoassay method with latex amplification using "Daytona" (RANDOX, UK). The lower limit of determination was 0.20 mg / l. Blood for investigation of CRP was taken on an empty stomach. Content of apolipoproteins A-1, B determined on the biochemical autoanalyzer "Daytona" (RANDOX, UK), using particle-enhanced turbidimetric immunoassay, using a monospecific antibody to human apoB. Were calculated the apoB/apoA ratio. Value of the coefficient considered normal when ratio was <1.0.

Determination of the concentration of Lp (a) (mg/dl) in serum was performed by ELISA using a monospecific antibody to human Lp (a).

Level of lipoprotein (a) higher than 30 mg / dl considered as increased value.

By request of laboratory CHD RSCC MH RU were genotyped 183 samples of whole blood. There were selected 4 candidate-genes, polymorphic variants of these genes according to international databases associated with coronary artery disease.

Isolation of genomic DNA. Genomic DNA was isolated from peripheral blood lymphocytes by standard protocol using reagents Diatom TM DNA Prep 200 (production of LLC "Laboratory Isogen").

Polymerase chain reaction. Genotyping of RAAS genes by polymerase chain reaction (PCR) was performed in the laboratory of functional human genomics, at the Institute of Genetics and Plant Experimental Biology, Academy of Sciences of RU using PCR Systems 2700 thermal cycler ("Applied Biosystems", USA) and in the laboratory of Arterial Hypertension and MHI RSCC on the GeneAmp PCR Systems 9700 thermal cycler ("Applied Biosystems", USA).

For genotyping of polymorphic markers of RAAS genes by PCR used the following primer pairs: G-A polymorphism of APO A1 gene

5 '- AGG GAC AGA GCT GAT CCT TGA ACT CTT AAG -3' (direct primer) 5 '- TTA GGG GAC ACC TAG CCC TCA GGA AGA GCA -3' (reverse primer) -516C/T polymorphism of APO B used the following sequence of primers (Sposito, 2004):

5 '- GCT GGG GTT TCT TGA AGA CA--3' (direct primer) 5 '- CAA GCG TCT TCA GTG CTC TG--3' (reverse primer)

[epsilon]2/[epsilon]3/[epsilon]4 polymorphism of APO E gene Upstream primer = 5'TCCAAGGAGCTGCAGGCGGCGCA3 ' Downstream primer = 5'ACAGAATTCGCCCCGGCCTGGTACACTGCCA3 '. I/D-polymorphism of ACE gene: ACE1 5'- CTG GAG ACC ACT CCC ATC CTT TC 3'

ACE2 5'- GAT GTG GCC ATC ACA TTC GTC AGA T--3'

Statistical analysis

Statistical data analysis was performed using the software package Statistica 6.0, and were also used Microsoft Excel spreadsheets. Results are presented as arithmetic mean and standard deviation (M [+ or -] SD), statistical significance of the measurements by comparing the average values determined by Student's test (t) with the computation of error probability (P) for checking the normality of the distribution.

We used nonparametric analysis (T test Mann-Whitney test for two samples) if the distribution of the studied variables differed from normal. To find the difference between the qualitative variables used [chi square] method. For the statistically significant changes taken confidence level P <0.05 (95% significance level). To compare the frequency of favorable and unfavorable outcome in unrelated groups, calculated the odds ratio (odds ratio--OR) with determination of confidence interval (CI). Differences in the studied binary attributes considered statistically significant if CI for OR did not include one. Survivability was considered as probability of absence of an unfavorable outcome within 12 months after unstable angina.

Results

Among the 183 Uzbek persons in the basic group--125 patients with unstable (progressive) angina class II B, in the control group--58 healthy subjects (Table 1).

Of the 183 Uzbek subjects surveyed, 125 were included to basic group of patients with unstable (progressive) angina class II B, the remaining 58 healthy subjects included in the control group (Table 1).

Among the patients with unstable angina 63 (51.2%) patients (I group) had burdened familial history (Table 1). A comparative analysis of both groups of patients did not differ in baseline clinical and hemodynamic and biochemical parameters (Table 2, 3), but I group had higher values of IMC of the carotid arteries and the level of hsCRP.

In studying the distribution of damaging alleles of studied genes, in the whole of UA patients compared with healthy individuals has been found a higher prevalence of A allele carriers of the apolipoprotein A, and tendency to more frequent occurrence of Apo E e4 allele among the patients (Table 4). In the separate comparison of studied groups was found that in group II the distribution of "damaging" alleles did not differ significantly from healthy subjects, whereas in group I had significantly greater accumulation of alleles: "A" GA polymorphism of APO A1 gene, "e4" polymorphism of APO E gene, a marked predominance of allele "D" I/D-polymorphism of ACE gene. At the same time there was no difference in the frequency of carriage "T" alleles of-516C / T polymorphism of APO B gene.

Discussion

The peculiarity of our study was to compare the distribution of alleles of studied genes in patients, depending on family history of CHD. This allowed comparing the prevalence of genetic markers in people who may have been the predominant influence of the "phenotype" of environmental factors with a "tuning fork" of the group of patients with a crucial contribution of genetic factors. There was some unexpected predominance of allele "A" Apo A gene in Uzbek patients with unstable angina in comparison with healthy individuals. In some reports the accumulation of "A" allele was accompanied by increased levels of HDL-C and Apo AI with the expectation of reducing the risk of CHD (Jeenah et al., 1990; Pagani et al., 1990; Zou Yangchun et al.,2003), but in others it has not been confirmed (Barre et al., 1994; Civeira et al.,1993; Peacock et al., 1994; Wang et al.,1996), and even pointed to the feedback (Matsunaga et al., 1995). In women, carriers of the A allele was found the relationship between genotype and diet, depending on Apo AI GA polymorphism: increased intake of polyunsaturated fatty acids was associated with an increased concentration of HDL, whereas in women with G / G genotype was observed adverse effect (Ordovas, 1999).

In some studies it was found that carriers of the A allele (M1) in the promoter region of Apo AI gene is associated with a significant increase in the concentration of lipoprotein (a), regardless of gender and the presence of diabetes (Albahrani et al., 2007; Heng et al., 2001). Also, in some experimental studies have shown that the A allele is associated with reduced transcription of lipoprotein AI, which is known to have important antiatherogenic value (Matsunaga et al., 1999; Smith et al., 1992; Tuteja et al., 1992). In a study of Requero et al., 1998, indicated a significant increase in the frequency of the A allele (M1) in the promoter region of the gene Apo AI in patients with unstable angina (P <0.05), and especially with acute myocardial infarction (P=0.009), outside the context of other risk factors (Requero et al., 1998). The results of our study among patients with unstable angina confirm these data and suggest that the heterogeneity of published data may be associated with a different representation of patients with a family history of CHD in these studies. Among the candidate genes considered involved in the risk of coronary heart disease, an important place is occupied by a gene coding apolipoprotein E (Song et al., 2004). The role of the Apo E gene polymorphism in the occurrence and progression of CHD confirmed by studies that found an association of e4 allele with morbidity and mortality from CHD (De Andrade et al., 1995; Stengard et al., 1995). In substudy conducted as part of Scandinavian multicenter study 4S showed that e4-carriers met in 36.5%, while non-e4 carriers were 63.5% of surveyed patients after myocardial infarction (Davignon et al., 1999). At the same time, e4-carriers who taking a placebo, had almost twice higher risk of mortality relative to non-carriers (15.7% and 9%; RR 1,8, 95% CI: 1.1 - 3.1). Meanwhile a similar design study conducted within the framework of GISSI-Prevenzione in Italy, among patients with myocardial infarction, only 16.8% were e4carriers and 83.2% were not-e4 carriers. It was shown that e4-allele is a determinant of a positive response to therapy with pravastatin in relation to survival (Chiodini et al. 2007; Gerdes et al., 2000). Angiotensinogen and ACE are key elements of the renin-angiotensin system (RAS) and make a great contribution to the development of cardiovascular diseases. In REGRESS study, according to a two-year monitoring of 782 men with stable angina treated with pravastatin, the incidence of myocardial infarction was significantly higher among patients with DD genotype of ACE gene and in patients with both DD genotype of ACE gene and CC genotype of an angiotensin II receptor gene (Van Geel et al., 2001). Results of this study showed that among patients with unstable angina, marked accumulation of damaging lipid-protein alleles of transport and the renin-angiotensin systems, are more expressed in patients with a family history of coronary artery disease.

Conclusion

Presence of family history of CHD among Uzbeks with unstable angina is associated with the accumulation of alleles "A" (M1-) GA polymorphism of APO A1, "s4" APO E gene, and some prevalence of "D" allele, I/D-polymorphism of ACE gene. Meanwhile, there were no differences revealed in the frequency of carriage "T" alleles of-516C / T polymorphism of APO B gene.

References

Albahrani, A., Usher, J., Mohammed Alkindi et al., 2007. "ApolipoproteinA1-75 G/A (M1-) polymorphism and Lipoprotein(a) Anti- versus Pro-Atherogenic properties," Lipids in Health and Disease, Vol.6, pp.19

Barre, D., Guerra, R., Verstraete, R., Wang, Z., Grundy, S., Cohen, J., 1994. "Genetic analysis of a polymorphism in the human apolipoprotein A-I gene promoter: effect on plasma HDL-cholesterol levels," J Lipid Res., Vol.35(7), pp.1292-296

Chiodini, B., Franzosi, M., Barlera, S. et al. 2007. "Apolipoprotein E polymorphisms influence effect of pravastatin on survival after myocardial infarction in a Mediterranean population: the GISSI-Prevenzione study," Eur. Heart J, Vol.28, pp.1977-983

Civeira, F., Pocovi, M., Cenarro, A., Garces, C., Ordovas, J., 1993. "Adenine for guanine substitution-78 base pairs to the apolipoprotein (APO) A-I gene: relation with high-density lipoprotein cholesterol and apoA-I concentrations," Clin Genet., Vol.44(6), pp.307-12

Davignon, J., Cohn, J., Mabile, L., Bernier, L., 1999. "Apolipoprotein E and atherosclerosis: insight from animal and human studies," Clin. Chim. Acta., Vol.286(1-2), pp.115-43

De Andrade, M., Brown, S. et al., 1995. "Relationship of the apolipoprotein E polymorphism with carotid artery atherosclerosis," Am. J. Hum. Genet., Vol.56, pp.379-390

Fielding, C.J., Fielding, P.E., 1995. "Molecular physiology of reverse cholesterol transport," Journal of Lipid Research, Vol.36(2), pp.211-28

Gerdes, L., Gerdes, C., Kervinen, K. et al., 2000. "The apolipoprotein epsilon4 allele determines prognosis and the effect on prognosis of simvastatin in survivors of myocardial infarction: a substudy of the Scandinavian simvastatin survival study," Circulation. Vol.101, pp.1366-371

Gerdes, L., Jeune, B., Ranberg, K. et al., 2000. "Estimation of apolipoprotein E genotype specific relative mortality from the distribution of genotypes in centenarians and middle-aged men: Apolipoprotein E gene is a <<frailty gene>>, not a <<longevity gene,>> Genetic Epidemiol., Vol.19(3), pp. 202-10

Heng, Ck., Low, P., Saha, N., 2001. "Variations in the promoter region of the apolipoprotein A-1 gene influence plasma lipoprotein(a) levels in Asian Indian neonates from Singapore," Pediatr Res. Vol.49(4), pp.514-18

Jeenah, M., Kessling, A., Miller, N., Humphries, S., 1990. "G to A substitution in the promoter region of the apolipoprotein AI gene is associated with elevated serum apolipoprotein AI and high density lipoprotein cholesterol concentrations," Mol. Biol. Med. Vol.7(3), pp.233-241

Kannel, W., McGee, D., Gordon, T., 1976. "General cardiovascular risk profile: The Framingham Stud," Am J Cardiol., Vol.38, pp.46-51

Kotceva, K., Wood, D., De Backer, G. et al., 2009. "EUROASPIRE Study Group. Euroaspire III A survey on the lifestyle, risk factors and use of cardioprotective drug therapies in coronary patients from 22 European countries," Eur J Cardiovasc Prev. Rehabil., Vol.16(2), pp.121-137

Kurtz, T., 1992. "Genetic Approaches to Hypertension" Annals of Medicine," Vol.24. pp.81-83

Matsunaga, A., Sasaki, J., Han, H. et al., 1999. "Compound heterozygosity for an apolipoprotein A1 gene promoter mutation and a structural nonsense mutation with apolipoprotein A1 deficiency," Arterioscler Thromb Vasc. Biol., Vol.19, pp.348-55

Matsunaga, A., Sasaki, J., Mori, T. et al., 1995. "Apolipoprotein A-I gene promoter polymorphism in patients with coronary artery disease and healthy controls," Nutr. Metab. Cardiovasc. Dis., Vol.5, pp.269-75

Ordovas, J., 1999. "The genetics of serum lipid responsiveness to dietary interventions,", Proc. Nutr. Soc., Vol.58, pp.171-87

Pagani, F., Sidoli, A., Giudici, G., Barenghi, L., Vergani, C., Baralle, F., 1990. "Human apolipoprotein A-I gene promoter polymorphism: association with hyperalphalipoproteinemia," J Lipid Res., Vol.31, pp.1371-377

Peacock, R., Hamsten, A., Johansson, J., Nilsson-Ehle, P., 1994. "Humphries SE. Associations of genotypes at the apoliprotein AI-CIII-AIV, apolipoprotein B and lipoprotein lipase gene loci with coronary atherosclerosis and high-density lipoprotein subclasses," Clin. Genet., Vol.46(4), pp.273-82

Requero, J., Cubero, G., Batalla, A. et al., 1998. "Apolipoprotein AI gene polymorphisms and risk of early Coronary disease," Cardiology, Vol.90, pp.231-35

Smith, J., Brinton, E., Breslow, J., 1992. "Polymorphism in the human apolipoprotein A-I gene promoter region. Association of the minor allele with decreased production rate in vivo and promoter activity in vitro," J Clin. Invest., Vol.89, pp.1796-800

Song, Y., Stampfer, M., Liu, S., 2004. "Meta_analysis: Apolipoprotein E genotypes and risk for coronary heart disease," Ann. Int. Med., Vol.141(2), pp.137-47

Stengard, J., Zebra, K. et al. 1995. "Apolipoprotein E polymorphism effect atherosclerosis in young males," Circulation., Vol.91(2), pp.265-69

Tuteja, R., Tuteja, N., Melo, C., Casari, G., Baralle, F., 1992. "Transcription efficiency of human apolipoprotein A-I promoter varies with naturally occurring A to G transition," FEBS Lett., Vol. 304, pp.98-101

Van Geel, P., Van Geel, P.P., eto oshibka ? idiot povtor Pinto, Y., Zwinderman, A. et al. 2001. "Synergistic effects of angiotensin converting enzyme and angiotensin-II type 1 receptor gene polymorphisms on ischaemic events," XX Congress of the European society of Cardiology, Abstract. p.386

Van't Hooft, F., Jormsjo, S., Lundahl, B., Tornvall, P. et al., 1999. "A functional polymorphism in the apolipoprotein B promoter that influences the level of plasma low density lipoprotein," J. Lipid Res., Vol.40, pp.1686-694

Wang, X., Liu, S., McCredie, R., Wilcken, D., 1996. "Polymorphisms at the 5'-end of the apolipoprotein AI gene and severity of coronary artery disease," J Clin. Invest., Vol.98(2), pp.372-77

Zou Yangchun, Hu Dayi, Yang Xinchun et al., 2003. Kak pravilno familiii sdelat "Relationships among apolipoprotein A1 gene polymorphisms, lipid levels and coronary atherosclerosis disease," Chinese Medical Journal, Vol.116(5), pp.665-68

Feruza Bekmetova, Ravshanbek Kurbanov, Alexander Shek, Lilya Kan, Shavkat Hashimov

Republican Specialized Center of Cardiology, Uzbekistan
Table 1. Clinical and demographic characteristics examined
subjects (M[+ or -]SD, n %)

                          Patients with
                         unstable angina        Healthy subjects
Indices                      (n=125)                 (n=58)

Age                      54.8[+ or -]9.5       53.6 [+ or -] 11.3

Sex (male/female),     71/54 (56.8%/43.2%)     30/28 (51.7%/48.3%)
n (%)

Burdened familial          63 (51.2%)                   0
history, n (%)

Diabetes mellitus,         26 (20.8%)                   0
n (%)

Heart rate, beats    78.2 [+ or -] 12.6 ***     68.6 [+ or -] 5.9
per min.

SBP, mmHg            136.0 [+ or -] 21.4 ***   120.7 [+ or -] 8.1

DBP, mmHg            86.5 [+ or -] 11.7 ***     77.2 [+ or -] 5.2

Note: *,**,*** - P<0.05, P<0.01, P<0.001, significance of differences
relative to the group of healthy individual.

Table 2. Comparative evaluation of initial clinical and hemodynamic and
biochemical parameters in the studied groups of patients with unstable
angina according to family history (M[+ or -]SD, n (%))

                           Patients with a           Patients
                          burdened familial      without a family
Indices                   history (I group)     history (II group)

n                             63 (50.4%)            62 (49.6%)

Age                       53.1 [+ or -] 10.3     56.4 [+ or -] 8.4

Sex (male/female),       36/27 (57.1%/42.9%)    35/27 (56.5%/43.5%)
n (%)

Duration of CHD, years     5.6 [+ or -] 4.2      5.5 [+ or -] 4.5

Hypertensive disease          60 (95.2%)            55 (88.7%)
I stage

History of myocardial         23 (36.5%)            22 (35.5%)
infarction

Diabetes mellitus             14 (22.2%)            12 (19.4%)

History of stroke              5 (7.9%)              2 (3.2%)

Frequency of angina       29.1 [+ or -] 9.1      28.2 [+ or -] 7.5
attacks, for 1 week

Intake of                 20.3 [+ or -] 8.0      20,1 [+ or -] 5.2
nitroglycerin for
1 week

Heart rate,               78.1 [+ or -] 12.8    78.2 [+ or -] 12.4
beats / min

Systolic BP, mmHg        136.3 [+ or -] 19.5    135.9 [+ or -] 23.4

Diastolic BP, mmHg        86.4 [+ or -] 11.3    86.6 [+ or -] 12.2

LV EDV, ml               140.5 [+ or -] 30.9    149.4 [+ or -] 30.5

LV ESV, ml                53.2 [+ or -] 23.8    58.5 [+ or -] 21.8

LVEF, %                   62.7 [+ or -] 9.2      61.8 [+ or -] 8.3

IMC, right                1.02 [+ or -] 0.22    0.96 [+ or -] 0.20

IMC, left                1.02 [+ or -] 0.23 *   0.93 [+ or -] 0.22

Note: *,**,*** - p<0.05, P<0.01, P<0.001, significance of differences
relative to the group patients without a family history.

Table 3. Comparative evaluation of baseline parameters of lipid
metabolism, biomarkers of lipid metabolism and inflammation in studied
groups of patients with unstable angina according to family history
(M [+ or -] SD)

                           Patients with a            Patients
                           burdened familial      without a family
Indices                     history (n=63)         history (n=62)

Total cholesterol,        218.2 [+ or -] 49.1    217.4 [+ or -] 38.0
mg/dL

TG, mg/dL                 193.7 [+ or -] 79.8    196.5 [+ or -] 95.3

LDL cholesterol, mg/dL    141.0 [+ or -] 41.3    139.5 [+ or -] 36.2

HDL cholesterol, mg/dL     38.1 [+ or -] 9.0      38.9 [+ or -] 8.7

VLDL cholesterol, mg/dL   39.6 [+ or -] 16.8     42.2 [+ or -] 22.0

Atherogenic ratio,         4.9 [+ or -] 1.6       4.7 [+ or -] 1.3
relative unit

Apo A, mg/dL              131.1 [+ or -] 41.0    126.2 [+ or -] 26.1

Apo B, mg/dL              102.0 [+ or -] 28.4    99.5 [+ or -] 27.8

Apo A/Apo B, unit          0.8 [+ or -] 0.3       0.8 [+ or -] 0.3

Lipoprotein (a) mg/dL     35.6 [+ or -] 18.7     39.1 [+ or -] 14.2

hsCRP, g/L               12.3 [+ or -] 2.3 ***    7.9 [+ or -] 2.6

Note: *,**,*** - P<0.05, P<0.01, P<0.001, significance of differences
relative to the group patients without a family history.

Table 4. Distribution of polymorphisms of apolipoprotein E, B and A
genes regulating lipid METABOLISM--AND ID POLYMORPHISM OF ACE GENE IN
UZBEK PATIENTS WITH UNSTABLE ANGINA, DEPENDING ON FAMILY HISTORY

                                                  Family
         "Damaging"      Patients with           history,
Genes      allele         UA (n=125)              (n=63)

ApoE     [epsilon]           28/97                 18/45
         4-carriers   relative risk: 2.10   relative risk: 2.91
           vs no-           95% CI                95% CI
         [epsilon]4        0,86-5,2              1,12-7,62
                        not significant           P=0,044

ApoB     T-carriers          50/75                 25/38
           vs CC      relative risk: 0.88   relative risk: 0.87

ApoA1    A-carriers          50/75                 33/30
           vs GG      relative risk: 3.63   relative risk: 5.99
                            95% CI                95% CI
                           1,63-8,04            2,52-14,24
                            P=0.002               P=0.001

ID ACE   D-carriers          83/42                 49/14
           vs II      relative risk: 1.30   relative risk: 2.30
                            95% CI                95% CI
                           0,83-5,08             1,04-5,09
                        not significant           P=0.06

               Without
               family            Healthy
              history,         individuals
Genes          (n=62)            (n=58)

ApoE            10/52             7/51
         relative risk: 2.10
               95% CI
              0,50-3,97
           not significant

ApoB            25/37             25/33
         relative risk: 0.89

ApoA1           17/45             9/49
         relative risk: 2.06
               95% CI
              0,83-5,08
           not significant

ID ACE          34/28             35/23
         relative risk: 0.80
               95% CI
              0,39-1,65
           not significant
COPYRIGHT 2012 Prague Development Center
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2012 Gale, Cengage Learning. All rights reserved.

 
Article Details
Printer friendly Cite/link Email Feedback
Author:Bekmetova, Feruza; Kurbanov, Ravshanbek; Shek, Alexander; Kan, Lilya; Hashimov, Shavkat
Publication:Medical and Health Science Journal
Article Type:Report
Date:Apr 1, 2012
Words:4079
Previous Article:Blood clotting in oil and gas facility workmen diagnosed with cataract, glaucoma and dacryocystitis.
Next Article:Study of the role of environmental factors in development of Parkinson's disease.
Topics:

Terms of use | Privacy policy | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters