Printer Friendly

Fatty Acid Profiling of Lipid A Isolated from Indigenous Salmonella Typhi Strain by Gas Chromatography Mass Spectrometry.

Byline: Abdul Jabbar, Aamir Ali, Abdul Tawab, Abdul Haque and Mazhar Iqbal

Summary: Typhoid, caused by Salmonella enterica serovar Typhi (S. Typhi), is a major health problem worldwide especially in developing countries. Lipopolysaccharides are one of the main virulence factors of S. Typhi. Hydrophobic lipid A anchors the lipopolysaccharides into the bacterial outer membrane and also serves as the epicenter of endotoxicity, which is linked to the presence of several fatty acid chains. Fatty acid profiling is, therefore, very important to understand the endotoxicity of these pathogenic bacteria.

To profile lipid A with respect to its fatty acid constituents, a S. Typhi was isolated from blood culture of a typhoid patient from the Faisalabad region of Pakistan. After its complete identification using biochemical and molecular techniques, this bacterium was cultivated in a fermentor. The cell pellet obtained was subjected to hot phenol process to extract and purify lipopolysaccharides. Acid hydrolysis of the lipopolysaccharides yielded lipid A, which was subjected to analyses using GC-MS after derivatization into their fatty acid methyl esters.

The fatty acid methyl esters were identified on the basis of their retention times, compared with standards as well as characteristic mass fragmentation patterns of their respective mass spectra. This fatty acid profiling revealed the occurrence of dodecanoic acid (C12:0), tetradecanoic acid (C14:0), 3-hydroxy tetradecanoic acid (3-OH C14:0) and hexadecanoic acid (C16:0) in the lipid A component of S. Typhi strain with the relative percentage abundances 8.5%, 12.5%, 55.9% and 23.1%, respectively.

Keywords: Typhoid, S. Typhi, Lipopolysaccharides, Lipid A, Fatty acid methyl esters, GC-MS.

Introduction ] Typhoid, typically characterized by fever, headache, anorexia, malaise, splenomegaly and a relative bradycardia, is an acute and life-threatening febrile disease caused by Salmonella enterica serovar Typhi (S. Typhi) belonging to Enterobacteriaceae family. S. Typhi is a human restricted Gram-negative pathogen with no animal reservoir. S. Paratyphi A causes paratyphoid fever which is less common but clinically similar to enteric fever [1]. Typhoid caused by S. Typhi is recognized as highly life-threatening by the World Health Organization [2]. It is rare in industrialized countries, but is still a major public health problem worldwide occurring endemically throughout the developing world. Its annual global burden is more than 21 million people with nearly 200,000 deaths. More than 90% of these morbidities and mortalities occur in Asia [3].

Typhoid is highly prevalent in South Asia, Southeast Asia and the Indian subcontinent [2]. Unfortunately, it is the 4 th major cause of death in Pakistan [4]. A major problem is that local isolates of S. Typhi are increasingly developing resistance towards the first line antimicrobials [5, 6].

Like other Gram-negative bacteria, S. Typhi harbors lipopolysaccharides (LPS) in its outer membrane. LPS are vital for the structural, as well as, functional integrity of outer membrane of Gram- negative bacteria [7]. These are the main surface antigens (O-antigen) and important virulence factors for most of the pathogenic bacteria affecting humans and animals [8].

LPS are not only essential for the reproduction and growth of cells [9] but also provide protection against bacteriophages, certain antibiotics and the host defense systems during infection [10]. The detailed structure of LPS varies inter and intra species. These differences also affect the virulence [11]. The structure of LPS consists of a polysaccharide part (O-antigen or specific O-chain), oligosaccharide core and a carbohydrate lipid moiety termed lipid A [12]. The schematic representation of LPS structure is shown in Fig. 1.

Fig. 1: General architecture of lipopolysaccharides (LPS).

Structurally, lipid A is considered to be a relatively well conserved component of LPS but differences may exist in its structure among species and even strains which influence a variety of biological activities. These differences exist regarding the types of amino glycans, degree of substitution on the disaccharide core by phosphate, fatty acids, and/or ethanolamine, and may also be due to the type, quantity and distribution of these fatty acids [13].

Structure of Lipid A from Enterobacteriaceae family and many other Gram- negative bacteria has a common general architecture, consisting of a bisphosphorylated ss-(1-6)-linked glucosamine disaccharide substituted with fatty acids. These fatty acids are amide-linked at positions 2 and 2' while ester-linked at positions 3 and 3'. The most common fatty acids in lipid A contain 10-16 carbon atoms, although longer chains may also exist in some bacteria [14]. The lipid A fraction generally also contains several chains of 3-hydroxy fatty acids. These chains may serve as a marker for the detection of Gram-negative bacteria due to their absence in other cell-wall lipids [15].

Lipid A is not only the hydrophobic anchor of LPS but also the endotoxically active part of the molecule [16]. The over activation of the innate immune system, induced by lipid A, can cause the over production of cytokines, which can lead to massive inflammation, septic shock, organ failure and ultimately death to the host. Toxicity of the lipid A moiety is closely related to its precise chemical structure, i.e., the nature and number of the fatty acyl chains and the phosphorylation state of disaccharide backbone [17].

Hence, much work has been focused on the profiling of the fatty acyl chains attached with lipid A. The fatty acid chains vary considerably between species, in number, nature, length, order and degree of saturation [7]. Some bacteria can even change the lipid A structure by fatty acids substitution: a variation which occurs in response to environmental changes or according to the type of host (where multiple hosts are being used), to deal with different host immune responses [18-20].

It is worth mentioning that the endotoxicity of S. Typhimurium has been proved to be its main virulence factor. Structural variation in lipid A, induced by deletion-insertion of waaN gene (which encodes for completion of one of the two secondary acyl chains to complete lipid A biosynthesis) can have significant impact on the death or survival fate of the host [21]. Such work has not been reported on S. Typhi. Therefore, fatty acid profiling of lipid A is crucial for the understanding of the endotoxicity of the S. Typhi strain. The current study is the first report concerning the fatty acid profiling of lipid A from S. Typhi isolated from a human typhoid patient from the Faisalabad region of Pakistan.

Results and Discussion

S. Typhi strain (AS-1), isolated from blood culture of a typhoid patient from the Faisalabad region (Pakistan), was selected for fatty acid profiling of lipid A. The strain was revived in tryptic soy broth (TSB) medium. The culture was streaked on MacConkey agar plate to obtain isolated colonies. The inoculation on triple sugar iron (TSI) agar slant showed a characteristic S. Typhi reaction (alkaline slant, acidic butt with blackening due to H 2 S production).

After DNA extraction from the bacterial isolate, a highly specific 495 bp fragment of fliC-d gene (phase-1 flagellin gene for d antigen [H:d]) was successfully amplified in first round, regular PCR [Fig. 2] followed by the 363 bp amplification of gene fragment in nested PCR [Fig. 3]. No amplification was seen in case of negative controls. This method for molecular identification of S. Typhi by PCR is now well established for the diagnosis of typhoidal diseases and provides superior specificity and sensitivity as compared with conventional methods [22].

Fig. 2: Regular PCR for S. Typhi. (in Figure label of 495 is missing which should be 495 bp) Lane M: 100 bp DNA ladder (Fermentas) Lane 1: S. Typhi (fliC-d gene 495 bp) Lane 2: Positive control Lane 3: Negative control Fig. 3: Nested PCR for S. Typhi.

(495 bp should be removed here in this fig) Lane M: 100 bp DNA ladder (Fermentas) Lane 1: S. Typhi (fliC-d gene 363 bp) Lane 2: Negative control The fermentor growth of S. Typhi strain AS- 1 yielded 5 g/L of the harvested cell pellet. The extraction and purification of lipopolysaccharides by a modified hot phenol-water method [23] yielded 134 mg of purified LPS per 100 g of bacterial cell pellet.

The extracted LPS were further processed to yield lipid A by mild acid hydrolysis using 1% glacial acetic acid [23].

Fatty acids of extracted lipid A were derivatized into fatty acid methyl esters [9] and analyzed by a gas chromatograph (GC) coupled to an electron impact (EI) ionization mass spectrometer (MS). GC-MS is a powerful technique used not only for the analysis of bacterial and fungal [24] fatty acids but also for the study of fatty acids from plants seeds, leaves [25, 26] and deep fried foods [27] after their derivatization into fatty acid methyl esters (FAMEs). These FAMEs of lipid A in the sample were identified by comparing their retention times in the GC chromatogram to those of standards of FAMEs (Sigma, USA) and confirmed by characteristic fragmentation patterns of their respective mass spectra.

Total ion current (TIC) of fatty acid methyl esters derived from lipid A, extracted and purified from S. Typhi strain AS-1, are shown in Fig. 4. The results of fatty acid analyses indicating their retention times and relative percentage abundances are summarized in Table-1. Peaks at 7.75, 13.43 and 19.79 min were identified as dodecanoic acid (C12:0), tetradecanoic acid (C14:0) and hexadecanoic acid (C16:0) respectively.

The peak at 18.05 min was assigned to 3-hydroxy tetradecanoic acid (3-OH C14:0). Among these, the peak at 18.05 min bearing 3-hydroxy tetradecanoic acid (3-OH C14:0) was the most abundant. Dodecanoic acid (C12:0) contributed 8.5% whereas tetradecanoic acid (C14:0), 3-hydroxy tetradecanoic acid (3-OH C14:0) and hexadecanoic acid constituted 12.5%, 55.9% and 23.1% respectively. These fatty acids were confirmed by their characteristic fragmentation patterns in their respective mass spectra.

Table-1: Fatty acid methyl esters along with their retention times and relative abundances.

###Retention###Relative

###S.No.###Compounds

###Time(min)###Abundance (%)

###Dodecanoic acid

###Dodecanoic acid

###(C12:0)###methyl

###ester

###1

###7.75###Tetradecanoic###8.5

###2###13.43###(C14:0) methyl ester###12.5

###3

###3-OH

###18.05###Tetradecanoic###55.9

###acid

###4###19.79###(3-OHC14:0)###23.1

###methylester

###Hexadecanoic acid

###(C16:0)###methyl

###ester

Fig. 4: GC-MS chromatogram (total ion current) of fatty acid methyl esters of lipid A extracted from indigenous S. Typhi strain AS-1.

Mass spectrum of peak at retention time 7.75 min represented dodecanoic acid (C12:0). It showed molecular ion peak at m/z 214 while its daughter peak at m/z 183 corresponded to the loss of the -OCH 3 group from the parent molecule. The peaks at m/z 171, m/z 157 and the following peaks showed the repetitive difference of m/z 14 which is the characteristic mass of methylene group (-CH 2 -) present in fatty acids multiple times. Peaks at m/z 74 and m/z 87 were obtained by cleavage at specific point by electron transfer and neutral loss at C-2 and C-3 from acyl group thereby generating the stable fragments of base peak (m/z 74) and second abundant peak m/z 87, respectively [Fig. 5].

Peaks at m/z 74 and m/z 87 were intense because the stability was conferred from extended conjugation of free radical with the carbonyl cation and the resonance stability of cation in enolate system, respectively. These peaks have been proved to be EI-MS confirmatory fragments for straight chain saturated fatty acid methyl esters [23]. Similar fragmentation pattern of peaks were observed for retention times 13.43 [see Fig. 6] and 19.79 [see Fig. 8], indicating the straight chain saturated fatty acid methyl esters, which differed only in their molecular ion peaks at m/z 242 and m/z 270 respectively. These peaks were confirmed as tetradecanoic acid (C14:0) and hexadecanoic acid (C16:0) methyl esters. In contrast, the fragmentation pattern of peak at retention time 18.05 was completely different from the other three peaks as shown in Fig. 7. The base peak at m/z 103 is a characteristic peak for 3-hydroxy fatty acid methyl esters (C 4 H 7 O 3 ).

The peak at m/z 240 represented the removal of hydroxyl group from the parent molecule.

Thus retention time and fragmentation pattern in mass spectrum confirmed it as 3-hydroxy tetradecanoic acid (3-OH C14:0). A Beta-hydroxy group in a carbonyl system is fairly labile and can ultimately cause the loss of water to the molecular ion peak. The high stability of peak at m/z 103 might be due to the electronic contribution by the neighboring ester group to the proton (Fig. 7). Greater abundance of this peak in TIC at retention time 18.05 represents the presence of multiple numbers of 3-hydroxy tetradecanoic acid (3-OH C14:0) in lipid A molecule purified from S. Typhi strain. Since 3-hydroxy fatty acids are characteristic components of lipopolysaccharides from Gram- negative bacteriaand are not present in other cell-wall lipids, so they serve as a lipid A marker [15].

From previous studies on other serovars of Salmonella like S. Minnesota [28] and S. Typhimurium [29], it is known that their particular lipid A molecule is a heptaacylated bisphosphorylated diglucosamine and consists of a C12:0, C14:0, 3-OH C14:0 and C16:0 fatty acyl chain profile. On the basis of our results we can suggest that the types of fatty acyl chains present in lipid A purified from S. Typhi strain AS-1 are more or less the similar to other members of Salmonella species, which contain the heptaacylated lipid A structure as illustrated in Fig. 9. Notably, C16:0 fatty acid acyl chain is mainly present in heptaacylated lipid A species [30], indicating the highly pathogenic characteristics of S. Typhi.

It may be worth mentioning here that presence of six and seven fatty acid acyl chains in heterogeneous distribution on bisphosphorylated ss-(1-6)-linked glucosamine disaccharide constitute highly endotoxic hexaacylated and heptaacylated lipid A species, which can excessively activate the host immune system to cause high fever, massive inflammation, septic shocks and ultimately death to the host [31]. Since, the complete structural analysis of lipid A is a complicated task, so exact location of the specific fatty acyl chains and identification of any microheterogeneity needs further investigations.

Fig. 5: Mass spectrum and fragmentation pattern of dodecanoic acid methyl ester at 7.75 min derived from lipid A extracted from indigenous S. Typhi strain AS-1.

Fig. 6: Mass spectrum and fragmentation pattern of tetradecanoic acid methyl ester at 13.43 min derived from lipid A extracted from indigenous S. Typhi strain AS-1.

Fig. 7: Mass spectrum and fragmentation pattern of 3-hydroxy tetradecanoic acid methyl ester at 18.05 min derived from lipid A extracted from indigenous S. Typhi strain AS-1.

Fig. 8: Mass spectrum and fragmentation pattern of hexadecanoic acid methyl ester at 19.79 min derived from lipid A extracted from indigenous S. Typhi strain AS-1.

Fig. 9: General structure of lipid A from Salmonella species.

Experimental

Bacterial Isolate

The S. Typhi strain AS-1 was isolated from blood culture of a typhoid patient belonging to the Faisalabad region of Pakistan. The isolate was characterized and stocked at -20 oC in tryptic soy broth (TSB, Merck, Germany) containing 10% dimethyl sulfoxide [32]. It was revived by inoculating 20 ul in 3 ml of TSB and 24 h incubation at 37 oC. The bacterial growth was streaked on MacConkey agar (Merck, Germany) plate and incubated at 37 degC for 24 hours. Small (-2-3 mm), smooth, round, transparent, and moist bacterial colonies, typical of Salmonellae[33] were selected for biochemical and molecular identification.

Biochemical Identification of Bacterial Isolate Biochemical identification of the isolate was carried out in triple sugar iron (TSI, Merck, Germany) slant by stab and streak method followed by incubation at 37 degC for 24 hours. Triple sugar iron is the most commonly used agar medium for identification of Enterobacteriaceae family [34].

Molecular Identification of Bacterial Isolate by Polymerase Chain Reaction Polymerase chain reaction (PCR) has been successfully used for the detection and identification of pathogenic microorganisms from clinical and environmental samples. It has been used previously for the diagnosis of S. Typhi and proved superior to conventional methods [32].

The genomic DNA was extracted from an overnight culture of biochemically identified S. Typhi strain AS-1 by conventional phenol-chloroform method [35]. Primers targeting specific region of fliC-d gene (signature gene of S. Typhi) were used for regular and nested PCR [36]. Both sets of primers were supplied by Sigma (Dorset, United Kingdom); their sequences and sizes of amplified products are shown in Table-2.

PCR Conditions

Each 50 ul of reaction mixture for regular PCR contained 10 ul of template DNA, 1.5 mM MgCl 2 , 50 nmol each of four dNTPs, 40 pM of each forward and reverse primer and 5 U Taq polymerase (Fermentas, USA). The thermal cycler (MasterCycler; Eppendorf, Germany) was set for 30 cycles and the conditions were as follows: denaturation at 94 degC for 1 min, annealing at 48 degC for 1 min and extension at 72 degC for 1.5 min.

The amplified product of regular PCR was diluted 1/5 times and used as template for nested PCR. Each 50 ul reaction mixture for nested PCR contained 10 ul of template, 1.5 mM MgCl 2 , 50 nmol each of four dNTPs, 40 pM of each primer and 5 U of Taq polymerase (Fermentas, USA). The conditions for 30 cycles were as follows: denaturation at 94 degC for 1 min, annealing at 55 degC for 1 min and extension at 72 degC for 1.5 min. The amplified products of both regular and nested PCR were electrophoresed on 2% gels which were stained with ethidium bromide and photographed by UV transilluminator (Eagle Eye, Stratagene, CA, USA).

Growth of Bacteria and Extraction of Lipopolysaccharides After biochemical identification and molecular confirmation of S. Typhi strain AS-1, large scale cultivation was done in a fermentor (BiostatC, Sartorius AG, Goettingen, Germany) at 37 o C for 14 h with vigorous aeration using TSB as growth medium. The growth was subcultured on MacConkey agar and TSI agar slants and after confirming the purity, the cells were harvested through centrifugation at 7,000 x g at 4 o C for 1 h to obtain the cell pellet.

Table-2: Primers used for regular and nested PCR.

Target Gene###Predicted Amplification size (bp)###Primer###Sequence (5'-3')###Reference

###fliC-d###ST1###TATGCCGCTACATATGATGAT

###495###[36]

###regular###ST2###TTAACGCAGTAAAGAGAG

###fliC-d###ST3###ACTGCTAAAACCACTACT

###363###[36]

###nested###ST4###TGGAGACTTCGGTCGCGTAG

Lipopolysaccharide extraction was done from the cell pellet by a modified phenol-water method as described previously [23]. Briefly, about 100 g cell pellet was gently mixed in 1 L of distilled water overnight. Then 1 L aqueous phenol (90%) solution previously equilibrated at 68 o C was added to the cell suspension. The solution was stirred at 68 o C for 30 min and then cooled in an ice bath until the temperature dropped to 10 o C. The mixture was centrifuged at 7,300 x g at 10 o C for 1 h. The upper aqueous layer was withdrawn and the lower organic phase was re-extracted with an equal amount of distilled water as described above. Both aqueous layers were combined. To the combined aqueous layers, sodium acetate, calcium chloride and ethanol were added to adjust their overall concentrations 10 mM, 2 mM and 25%, respectively. After mixing the solution for 20 minutes, it was stored at 4 o C overnight.

The mixture was centrifuged at 7,300 x g at 10 o C for 1 h, and further ethanol was added to the supernatant to adjust its overall concentration to 75%. After thorough mixing, the solution was stored at 4 o C overnight.

After 24 hours, the suspension was centrifuged at 7,300 x g at 4 o C for 1 h to get the LPS pellet, which was then suspended in 20 ml of the buffer (2 mM MgSO 4 and 50 mM Tris at pH 7.6). The suspension was added to a dialysis bag and equilibrated against the same buffer (2 mM MgSO 4 - 50 mM Tris, pH 7.6) at 37 o C for 2 h. To remove contaminations of DNA and RNA, enzymes DNase (Promega, USA) and RNase (Roche, Germany ) were added (25 mg each) and solution was kept under gentle stirring for 6 h. Protein contamination was removed by the addition of 50 mg of Proteinase K (Promega, USA)and solution was kept at 37 o C for 24 h under continuous stirring. The solution was finally subjected to dialysis against distilled water at 4 o C for 2 days with four changes of water. The contents of solution were centrifuged at 5,000 x g at 10 o C for 30 min.

The supernatant was freeze-dried to get crude LPS. For further purification, the crude LPS were dissolved in distilled water at 40 mg/ml and ultracentrifuged at 64,000 x g at 10 o C for 5 h. The pellet was dissolved in distilled water and lyophilized to get pure LPS.

Extraction and Purification of Lipid A Mild acid hydrolysis of the purified LPS with 1% acetic acid (pH 3.1) at 100 degC for 1 h was used to cleave the ketosidic or 3-deoxy-D-manno-2- octulosonic acid (Kdo) linkage between lipid A and polysaccharide part, while keeping all other aldosidic linkages intact due to their higher acid stability. The insoluble lipid A was separated from the hydrolysis mixture by ultracentrifugation at 64,000 x g at 10 o C for 5 h as pellet and then lyophilized [23].

Fatty Acid Derivatization

Before starting the fatty acid analysis of lipid A on GC-MS, these fatty acids were derivatized into fatty acid methyl esters as described previously [9], the derivatization chemistry can be seen in Scheme-1. Briefly, purified lipid A (-10 mg) was dissolved in 0.5 ml of 4 M HCl and kept at 100 o C for 4 h. The sample was then partitioned between 3 ml water and an equal amount of chloroform (CHCl 3 ). The organic layer was removed while the aqueous layer was extracted twice with 3 ml of chloroform. After combining the organic layers, 200 mg of Na 2 SO 4 was added and mixture was stirred for 1 h at room temperature.

Sample was filtered and evaporated to dryness under a stream of N 2 to get free fatty acids. These free fatty acids were then esterified after mixing with 0.5 ml MeOH and 70 l acetyl chloride under ice cooling. The sample was kept for 16 h at 85 o C. After cooling, 1 ml NaCl solution (30 mg/ml) was added and extracted with 3 ml of chloroform. The chloroform layer was evaporated to dryness under a stream of N 2 . The sample was re- dissolved into ethyl acetate before its analysis using GC-MS. A mixture of fatty acid methyl esters standards were obtained from Sigma, USA for comparing retention times with the sample.

GC-MS Equipment and Conditions The derivatized sample was analyzed on GC-MS equipment Agilent 6890 Gas Chromatograph equipped with an autosampler using a DB-5 fused silica capillary column (30 m x 0.25 mm, 0.25 um i.d., Agilent Technologies, Palo Alto, CA, USA). 0.5 ul sample was injected. Injector temperature was set at 250 o C while the transfer line temperature was adjusted at 270 o C. The initial oven temperature was set at 130 o C for 1 min, followed by a ramping of 3 o C/min to 250 o C (held for 1 min) and from 250 o C to final temperature 325 o C (held for 5 min) at ramp temperature 20 o C/min. Full scan mode between m/z 50-400 was used to detect the fatty acid constituents and selective ion monitoring (SIM) was performed on the fragment ion m/z 103 for the detection of trace amounts of 3-hydoxy fatty acids [9].

The mass spectrometer was operated in the electron impact (EI) ionization mode. Chemstation software of Agilent Technologies was used for the data acquisition and analysis.

Scheme-1: Schematic derivatization of fatty acids to fatty acid methyl esters. (Its better to change its fonts and line width, its very prominent and bold in print)

Acknowledgement

We gratefully acknowledge the financial assistance of Higher Education Commission (HEC), Pakistan for this study. The authors would like to thank Dr. Brigitte Twelkmeyer at KarolinskaInstitutet, Sweden for her assistance during derivatization of fatty acids into fatty acid methyl esters and skillful technical support of mass spectrometry. We also gratefully acknowledge Prof. ElkeSchweda at KarolinskaInstitutet, Sweden for providing mass spectrometry facilities and her critical reading of the manuscript, valuable comments and criticisms.

References

1. P. Everest, J. Wain, M. Roberts, G. Rook and G. Dougan, Trends in Microbiology, 9, 316 (2001). ] 2. L. B. Martin, Current Opinion in Infectious Diseases, 25, 489 (2012).

3. J. A. Crump, S. P. Luby and E. D. Mintz, Bulletin of The World Health Organization, 82, 346 (2004).

4. World Health Organization, Ref. Type: Pamphlet (2006). ] 5. S. K. Gupta, F. Medalla, M. W. Omondi, J. M. Whichard, P. I. Fields, P. Gerner-Smidt, N. J. Patel, K. L. F. Cooper, T. M. Chiller and E. D. Mintz, Clinical Infectious Diseases, 46, 1656 (2008).

6. R. L. Ochiai, C. J. Acosta, M. Danovaro- Holliday, D. Baiqing, S. K. Bhattacharya, M. D. Agtini, Z. A. Bhutta, D. G. Canh, M. Ali and S. Shin, Bulletin of The World Health Organization, 86, 260 (2008).

7. C. Erridge, E. Bennett-Guerrero and I. R. Poxton, Microbes and Infection, 4, 837 (2002).

8. A. Ulmer, E. T. Rietschel, U. Zahringer and H. Heine, Trends in Glycoscience and Glycotechnology, 14, 53 (2002).

9. I. Mikhail, H. H. Yildirim, E. C. Lindahl and E. K. Schweda, Analytical Biochemistry, 340, 303 (2005).

10. E. T. Rietschel and H. Brade, Scientific American, 267, 54 (1992).

11. S. G. Wilkinson, Progress in Lipid Research, 35, 283 (1996).

12. J. H. Banoub, A. E. Aneed, A. M. Cohen and N. Joly, Mass Spectrometry Reviews, 29, 606 (2010).

13. J. Lodowska, D. Wolny, L. Weglarz and Z. Dzierzewicz, Postepy Higieny i Medycyny Doswiadczalnej, 61, 106 (2007).

14. M. Caroff and D. Karibian, Carbohydrate Research, 338, 2431 (2003).

15. Y. Li, S. Wu, L. Wang, F. Shi and X. Wang, Journal of the Science of Food and Agriculture, 90, 1380 (2010).

16. C. R. H. Raetz, C. M. Reynolds, M. S. Trent and R. E. Bishop, Annual Review of Biochemistry, 76, 295 (2007).

17. X. Wang and P. J. Quinn, Progress in Lipid Research, 49, 97 (2010). ] 18. M. Caroff, D. Karibian, J. M. Cavaillon and N. Haeffner-Cavaillon, Microbes and Infection, 4, 915 (2002).

19. D. W. Grogan and J. E. Cronan, Microbiology and Molecular Biology Reviews, 61, 429 (1997).

20. S. W. Montminy, N. Khan, S. McGrath, M. J. Walkowicz, F. Sharp, J. E. Conlon, K. Fukase, S. Kusumoto, C. Sweet and K. Miyake, Nature Immunology, 7, 1066 (2006).

21. S. A. Khan, P. Everest, S. Servos, N. Foxwell, U. Zahringer, H. Brade, E. T. Rietschel, G. Dougan, I. G. Charles and D. J. Maskell, Molecular Microbiology, 29, 571 (1998).

22. A. Haque, N. Ahmed, A. Peerzada, A. Raza, S. Bashir and G. Abbas, Japanese Journal of Infectious Diseases, 54, 237 (2001). 23. C. Chu, B. Liu, D. Watson, S. Szu, D. Bryla, J. Shiloach, R. Schneerson and J. Robbins, Infection and Immunity, 59, 4450 (1991).

24. L. F. Yousef, M. Wojno, W. A. Dick and R. P. Dick, Fungal Biology, 116, 613 (2012).

25. S. Azmat, R. Ifzal, M. Rasheed, F. V. Mohammad and V. U. Ahmad, Journal of the Chemical Society of Pakistan, 32, 672 (2010).

26. M. Imran, F. N. Talpur, Sirajuddin and R. Khan, Journal of the Chemical Society of Pakistan, 31, 492 (2009).

27. F. Anwar, M. Bhanger, S. Latif and M. Manzoor, Journal of the Chemical Society of Pakistan, 28, 374 (2006).

28. H. Janusch, L. Brecker, B. Lindner, C. Alexander, S. Gronow, H. Heine, A. J. Ulmer, E. T. Rietschel and U. Zahringer, Journal of Endotoxin Research, 8, 343 (2002).

29. A. X. Tran, M. E. Lester, C. M. Stead, C. R. H. Raetz, D. J. Maskell, S. C. McGrath, R. J. Cotter and M. S. Trent, Journal of Biological Chemistry, 280, 28186 (2005).

30. R. E. Bishop, Molecular Microbiology, 57, 900 (2005). ] 31. C. Alexander and E. T. Rietschel, Journal of Endotoxin Research, 7, 167 (2001).

32. A. Ali, A. Haque, Y. Sarwar, M. Mohsin, S. Bashir and A. Tariq, Epidemiology and Infection, 137, 102 (2009). ] 33. A. MacConkey, The Journal of Hygiene, 5, 333 (1905). ] 34. A. Hajna, Journal of Bacteriology, 49, 516 (1945). ] 35. J. Sambrook, E. Fritsch and T. Maniatis, Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York (1989). ] 36. J. H. Song, H. Cho, M. Y. Park, D. S. Na, H. B. Moon and C. H. Pai, Journal of Clinical Microbiology, 31, 1439 (1993).

Abdul Jabbar, Aamir Ali, Abdul Tawab, Abdul Haque and Mazhar Iqbal Health Biotechnology Division, National Institute for Biotechnology and Genetic Engineering (NIBGE),

P.O. Box 577, Jhang Road, Faisalabad, Pakistan. ] hamzamgondal@yahoo.com, hamzamgondal@yahoo.com
COPYRIGHT 2014 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2014 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Jabbar, Abdul; Ali, Aamir; Tawab, Abdul; Haque, Abdul; Iqbal, Mazhar
Publication:Journal of the Chemical Society of Pakistan
Article Type:Report
Date:Feb 28, 2014
Words:4844
Previous Article:Equilibrium Modeling of Removal of Drimarine Yellow HF-3GL Dye from Aqueous Solutions by Low Cost Agricultural Waste.
Next Article:Extraction of Holocellulose from Bagasse using Delignifying Agents: A Comparative Study.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |