Printer Friendly

FISH labeling reveals a horizontally transferred algal (Vaucheria litorea) Nuclear Gene on a Sea Slug (Elysia chlorotica) Chromosome.

Introduction

Kleptoplasty, the process of phagocytosis, sequestration, and utilization of algal chloroplasts by certain digestive cells in some species of herbivorous sea slugs (Sacoglossa), is a well-known phenomenon that has been studied by many investigators for 50 years or more (reviewed by Pierce and Curtis, 2012). The symbiotic plastids, kleptoplasts, can photosynthesize inside the slug cell for varying periods, from hours to months, depending upon the slug species, providing at least some source of energy for the animal. The longer-lived associations between the captured plastids and the slug involve various behavioral, morphological, and biochemical adaptations to maintain the chloroplasts in the absence of the mechanisms of organelle renewal that are present in the algal cell (Pierce and Curtis, 2012).

Of particular interest is the growing evidence that Elysia chlorotica (Gould 1870), a slug species with one of the longest (9 mon or more) maintained associations with chloroplasts from its algal food, Vaucheria litorea (C. Agardh 1823), has somehow acquired functional algal nuclear genes. The products of these transferred genes help with the long-term maintenance of plastid function within the slug cell. Chloroplast reproduction has never been found in E. chlorotica (or any other sacoglossan) (Pierce and Curtis, 2012), and the larval stages feed on unicellular algae (West et al., 1984). So, once metamorphosis to the adult form occurs, each generation of adult slugs must take up chloroplasts anew. Inside the adult E. chlorotica digestive cells, chloroplast proteins are synthesized for months after plastid uptake (Mujer et al., 1996; Pierce et al., 1996; Green et al., 2000), and many of those are nuclear-encoded in the slug cell (Hanten and Pierce, 2001; Rumpho et al., 2009). Evidence for the presence of algal nuclear genes coding for chloroplast proteins in DNA from both E. chlorotica adults and larvae has been reported from polymerase chain reaction (PCR) experiments (Pierce et al., 2007; Rumpho et al., 2008, 2009; Schwartz et al., 2010) as well as real time PCR (qRT-PCR) and transcriptome sequencing of RNA from E. chlorotica adults (Soule and Rumpho, 2009; Pierce et al., 2012). Therefore, all of these data agree that several dozen algal nuclear genes have been transferred from the alga to slug cells, have been integrated into the slug cell biology, are transmitted to the next generation of slugs, and then are actively transcribed and translated in the animals. However, genome sequencing of E. chlorotica "egg ribbons," which are actually unhatched larvae, failed to find any algal sequences (Bhattacharya et al., 2013). This negative result was used to dismiss all of the previous positive results, including those with larvae, that demonstrated horizontal gene transfer between V. litorea and E. chlorotica, although Bhattacharya et al. (2013) "stress[ed]" that their results did not "prove" the absence of algal genes in the slug genome. Instead, alternative hypotheses were proposed to explain the mechanism of long-term chloroplast maintenance in E. chlorotica without a gene transfer event incorporated into the germ line, including the possibility of extrachromosomal DNA fragments taken up during feeding and missed in the adult sequencing efforts (Bhattacharya et al., 2013). However, the unhatched embryos do not have chloroplasts and have not fed, so the source of the PCR-identified algal sequences in the larval DNA found in earlier studies cannot be from feeding. Furthermore, if extrachromosomal DNA were the source of the transferred algal genes in the adults, it would require the uptake of the correct DNA fragments by every cell in every slug in every generation.

Since a negative result from genomic data will always be subject at least to "not enough data" and "not in the database" criticisms, we have used a different approach to test the E. chlorotica genome for the presence of algal genes. Instead of just more genome sequencing, we used fluorescence in situ hybridization (FISH) and fluorescent microscopy to test chromosomes from pre-hatched E. chlorotica larvae (which have never been exposed to any algae) for the presence of algal sequences. We found that a gene probe made with the coding sequence of a V. litorea nuclear gene, prk. bound to one of the chromosomes in the unhatched larva of E. chlorotica, confirming the positive gene transfer results found by most of the previous studies.

Materials and Methods

Sources and culture of slugs and algae

Specimens of Elysia chlorotica were collected from a salt marsh near Menemsha on Martha's Vineyard, Massachusetts, and shipped overnight to our laboratory in Tampa, Florida. The sea slugs were kept at 10[degrees]C in aerated aquaria containing sterilized, 1000 rnosm, artificial seawater (ASW; Instant Ocean) on a 14:10-h light/dark cycle. The slugs were starved for at least one month before use under these conditions. Sterile laboratory cultures of Vaucheria litorea were maintained in 250 mosm ASW containing a modified F/2 medium (Bidwell and Spotte, 1985) and transferred into fresh medium bi-monthly. The algal culture was grown in an incubator at 20[degrees]C on a 14:10-h light/dark cycle.

Localization of transferred algal nuclear genes on Elysia chlorotica chromosomes

Metaphase chromosomes in cells of developing E. chlorotica embryos were examined for the presence of algal genes by using FISH labeling and microscopy. Gastrulastage embryos were tested since many more dividing cells are present in them than in later developmental stages or adults. The slugs were induced to produce egg masses by moving them into aquaria at room temperature (RT), still under the 14:10 light/dark cycle (Harrigan and Alkon, 1978). The aquaria were monitored daily for egg masses, which were collected, rinsed with ASW, and placed into small culture dishes containing ASW. After the embryos had developed to the gastrula stage at RT, the egg masses were gently passed through a 22-ga needle several times to remove the jelly coat and free the egg capsules. The capsule suspension was centrifuged at 1500 X g for 5 min at RT, the supernatant was decanted, and the dissociated jelly coat layer was removed from the top of the pellet using a pipet tip. The egg capsules were transferred to ASW containing 1.0 mmol r1 colchicine (Sigma-Aldrich, St. Louis, MO) and incubated for 1 h at RT in the dark, with slight agitation, to arrest all cell division at metaphase. The suspension was then centrifuged at 1500 X g for 5 min and the supernatant was decanted. The egg capsules were resuspended in 250 mosm ASW and incubated for 20 min at RT to swell the chromosomes, then centrifuged again at 1500 X g; the pellet containing the egg capsules was fixed with methanol/acetic acid (3:1) (fixation solution) and incubated for 20 min at RT. This fixation step was repeated two additional times. Finally, the fixed gastrulae were stored in the fixation solution overnight at -20[degrees]C prior to microscope slide preparation (modified from Ronne, 1989).

Chromosome preparation for karyotype analysis and FISH labeling

The microscope slide preparations of chromosomes used for karyotyping or FISH analysis required about 100-150 fixed gastrulae per slide to obtain at least 10 isolated metaphase chromosome spreads for analysis. The gastrula-containing E. chlorotica egg capsules described above were resuspended in fresh fixation solution, incubated at RT for 5 min, and then centrifuged at 12,000 X g for 5 min at RT. The egg capsules were broken open, releasing the metaphase chromosomes, by resuspending them in acetic acid/ water (1:1), incubated for 5 min at RT, then, using a pipet tip that was angled --45[degrees] to the slide surface, the suspension was spread onto pre-warmed (42[degrees]C) glass microscope slides and dried for 1 h at 42[degrees]C. Slides were brought to RT and used immediately for karyotyping or aged for 24 h prior to their use for FISH analysis.

Karyotype analysis: Elysia chlorotica

Elysia chlorotica chromosome number and morphology were determined using fluorescence microscopy. The chromosomes were visualized by staining their DNA with 4',6diamidino-2-phenylindole (DAPI) antifade mounting buffer (Invitrogen, Carlsbad, CA) and viewed using an inverted fluorescent microscope (Axiovert 200, Zeiss, Oberkochen, Germany) equipped with a DAPI optical filter and an 100X/ 1.40 Plan-Apochromat oil objective. Chromosomes were counted, classified, and paired, based on their size and morphology, from about 50 well-isolated, metaphase chromosome spreads acquired from images of five different chromosome preparations captured using a digital camera (Hamamatsu IEEE 1394 Orca-Era) and Velocity 6.1.1 software. Images shown in the Results section were cropped and sharpened using Photoshop Elements (ver. 9).

FISH localization of transferred algal genes

Elysia chlorotica metaphase chromosomes were tested with FISH labeling utilizing a gene probe designed to label the V. litorea nuclear gene prk, which encodes the Calvin cycle enzyme phosphoribulokinase. Prk was chosen from among the variety of possible genes because several previous studies have found evidence for its horizontal transfer between V. litorea and E. chlorotica using both polymerase chain reaction (PCR) experiments in adult and larval slug DNA (Rumpho etal., 2009; Schwartz et al., 2010) and adult slug transcriptome sequence data analysis (Pierce et al., 2012). Also, prk encodes a protein used exclusively in the Calvin cycle and has no known homolog in non-photosynthetic organisms.

A 1218-bp, V. litorea prk-targeting probe was synthesized using native sequence (GENBANK accession #AF3366986) (Schwartz et al., 2010) and labeled with the hapten digoxigenin (DIG) so that it could be detected with, and amplified by, FISH labeling and fluorescent microscopy. Genomic DNA (gDNA) and RNA were purified from V. litorea, and cDNA was synthesized using previously described techniques (Schwartz et al., 2010). Amplicons of prk (1.2 kb using V. litorea cDNA) were obtained by using PCR, which used a reaction mixture containg 100 ng of gDNA or cDNA, 12.5 pmol of primer, 200 [micro]mol [l.sup.-1] dNTP mix (Roche Applied Science, Indianapolis, IN), and 1.25 units of IDProof DNA polymerase (ID Labs, London, Ontario, Canada). The reactions were initially denatured for 2 min at 94[degrees]C, then underwent 35 cycles of 30-s denaturation at 94[degrees]C, 30-s annealing at a temperature 5[degrees]C below the melting temperature of the primers, and then a 1-min extension at 72[degrees]C. The reaction products were electrophoresed on a 1% agarose gel; the amplicons were extracted from the gel and then purified (QIAquick Gel Extraction Kit, Qiagen, Valencia, CA). The purified amplicons were cloned (TOPO TA cloning kit, Invitrogen, Grand Island, NY) as per manufacturer's instructions. Individual clones were sequenced (Eurofins MWG Operon, Huntsville, AL) to verify sequence integrity. The bacterial colonies were grown at 37[degrees]C overnight in LB media containing 50 [micro]g/ml kanamycin. The insert-containing plasmid vectors were pu rifled (Wizard Plus SV Minipreps DNA Purification Kit, Promega, Madison, WI) and used as the templates for FISH probe synthesis. FISH probes were synthesized and simultaneously labeled with digoxigenin (DIG) (PCR DIG Probe Synthesis Kit, Roche Applied Science, Indianapolis, IN) as per manufacturer's instructions.

prk primers:

Forward: 5'ATGCTCGTACATAGTCTAATTC 3'

Reverse: 5'TTATGCAGCCTCGGCTTGG 3'

Hybridization of prk probe with slug chromosomes

The chromosome spreads described above were pre-treated to increase assay sensitivity and specificity using methods modified from Henegariu et al. (2001) and Vitturi et al. (2000), determined in preliminary experiments. The dried chromosomes on the microscope slides were rehydrated in phosphate-buffered saline (PBS) (pH 7.4) for 30 min at 37[degrees]C. Then the slides were incubated for 7 min in 0.005% pepsin/0.01N HCl (pH 2.0) that was pre-warmed to 37[degrees]C to digest any cytoplasmic proteins that could cause non-specific probe binding. The pepsin digestion was stopped by immediately raising the pH back to 7.4 by immersing the samples in PBS and incubating them for 5 min at RT. The slides were incubated for 10 min in PBS/50 mmol [l.sup.-1] [MgCl.sub.2] at RT, then post-fixed in PBS containing 50 mmol [l.sup.-1] [MgCl.sub.2] and 1% formaldehyde to maintain chromosome morphology. They were then washed in PBS for 5 min with gentle agitation, dehydrated through an ethanol series (70%, 95%, 100%, 5 min each concentration), then dried for 15 min at RT. The DNA in the chromosomes was denatured by incubation with 200 [micro]l of 2X saline-sodium citrate buffer (300 mmol [l.sup.-1] NaCl and 30 mmol [l.sup.-1] [Na.sub.3][C.sub.6][H.sub.5][O.sub.7], pH 7.0; 2X SSC) containing 70% deionized formamide for 5 min at 70[degrees]C. The slides were briefly rinsed in 2X SSC and then dehydrated through an ethanol series.

The DIG-labeled prk probe was then bound to the chromosomes and viewed with a fluorescent microscope. A hybridization solution containing the prk probe was prepared (2X SSC, 45% deionized formamide, 5% dextran sulfate, 1.75 [micro]g of mouse cot-1 DNA [Invitrogen, Grand Island, NY] and 1.7X Denhardt's solution containing ~20ng of DIG-labeled prk probe), denatured for 7 min at 76[degrees]C in a thermocycler, then snap-cooled in an ice bath for 2 min. Then a 15-[micro]l drop was pipetted onto the denatured chromosomes on the microscope slide, covered by a 20 mm X 20 mm cover slip, and the edges sealed with rubber cement (modified from Vitturi et al., 2000). Probe hybridization with the chromosomes was achieved by incubation in a humidified chamber for 17-20 h at 35[degrees]C. This temperature was chosen as the result of preliminary experiments performed to determine an incubation temperature that minimized non-specific probe binding. Then the coverslips were removed and unbound prk probe was removed from the slides by washing for 5 min with agitation: once in 2X SSC (37[degrees]C), three times in 2X SCC containing 45% formamide (37[degrees]C) and then two times in 0.5X SCC (65[degrees]C). All wash steps in the series were performed in a Coplin jar containing 40 ml of each washing solution.

The chromosomes were prepared for probe detection by a series of RT equilibration washes performed once each in the following: 2X SSC, PBS, and finally in PBS/0.1% Tween 20. DNA-free areas on the slide preparation were blocked in blocking solution (Roche Applied Science, Indianapolis, IN) for 1 h at 37[degrees]C, then rinsed in PBS/0.1% Tween 20. Finally, the prk probe was labeled for fluorescence detection by first incubating the chromosomes with blocking solution containing 250 ng/ml mouse monoclonal anti-DIG (Roche Applied Science, Indianapolis, IN) for 1 h at 37[degrees]C, then washing three times for 5 min at RT in PBS/0.1% Tween 20 with agitation. Next, the slides were incubated with blocking solution containing 2.5 [micro]g/ml antimouse AlexaFluor488 or AlexaFluor594 (Invitrogen, Grand Island, NY) for 45 min at 37[degrees]C and washed three times in a foil-wrapped Coplin jar for 5 min at RT in PBS/0.1% Tween 20 with agitation. The slides were dehydrated through an ethanol series and allowed to dry for 20 min in the dark. DAPI antifade mounting buffer (Invitrogen, Grand Island, NY) was pipetted onto each slide to counterstain the chromosomes (blue) and provide contrast to the probe (green or red) and covered with a 30 mm X 30 mm coverslip. The chromosomes were then viewed with a confocal microscope (UltraVIEW ERS Spinning Disk, PerkinElmer, Waltham, MA) or an inverted fluorescent microscope equipped with standard optical DAPI, FITC, and rhodamine filters, using a 100X/1.40 Plan-Apochromat oil objective. Once the labeled probe was detected, the chromosomes were viewed using gas lasers (Krypton 561 and/or Argon 488/515) using the following parameters: DAPI--excitation 405-nm, laser emission 485 nm (W60), 705 nm filter (W90); Alexa Fluor488--excitation 488 nm, laser emission 527 nm filter (W55); and Alexa Fluor594--excitation 640 nm, laser emission 485 nm (W60), 705 nm filter (W90). Images were acquired, analyzed, and processed using the same camera and software used for E. chlorotica karyotype analysis described above. This procedure was repeated on preparations from 13 different groups of larvae from different egg masses (See Table 1).

Controls to verify prk chromosome labeling specificity

Several control procedures were performed to confirm reagent and chromosome quality as well as the specificity of prk labeling of the E. chlorotica chromosome.

Reagent and chromosome quality in the various chromosome slide preparations was verified by using the FISH procedures described above and substituting a 960-bp probe designed to target the actin gene. The actin probe was synthesized from E. chlorotica gDNA, as described above for the prk probe, using the following primers: actin primers:

Forward: 5'AGGGTGTCATGGTTGGTA 3'

Reverse: 5'GATCCACATCTGCTGGAA 3'

Actin was chosen because of its ubiquity, sequence conservation, and presence in multiple, similar isoforms in most species (Zappula et al., 2005).

Prk binding specificity was tested in several ways. First, the FISH procedure was performed on chromosome slide preparations with all components except the prk probe to ensure that the antibody labeling system was not nonspecifically binding to the chromosomes. Second, a gene probe for an algal sequence that should not bind to the slug DNA was tested. The gene for the large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCo) was used for this experiment as it is a chloroplast-encoded gene in V. litorea (Curtis et al., 2006, 2007). A 631-bp rbcL probe was synthesized from V. litorea gDNA, using the methods described above and the following primers, and substituted for the prk probe in the FISH procedure described above. Both of these controls were tested a minimum of seven times on seven different metaphase chromosome preparations and along with each prk labeling run (See Table 1).

rbcL primers: Forward: 5'AATGGATAAATTTGGACG 3'

Reverse: 5'ACGTAATGCTGCCCAATCC 3'

Prk binding specificity for E. chlorotica chromosomes was also tested using chromosomes from Aplysia californica (Cooper 1863), a non-kleptoplastic, herbivorous slug, relatively phylogenetically close to Elysia. Although the chromosome number has been reported as n = 17 for several aplysiidaean species including Aplysia benedicti (Elliot 1899) (= Aplysia dactylomela Rang 1828) (Patterson, 1969), we were unable to locate a karyotype for A. californica in the literature, so to be sure all chromosomes were accounted for in our experiments, a karyotype analysis was done before the prk binding tests.

Karyotype: Aplysia

Aplysia californica egg strands were kindly provided by Thomas Capo from the National Aplysia Resource Facility at the Rosenstiel School of Marine and Atmospheric Science, University of Miami, Miami, Florida. Freshly deposited egg strands were shipped to Tampa overnight and. upon arrival, were rinsed in 1000 mosm ASW; embryos were allowed to develop to the gastrula phase. The egg strands were transferred to 1000 mosm ASW containing 1.0 mmol [l.sup.-1] colchicine and incubated for 6 h at RT in the dark with slight agitation. After the incubation, gastrulae were liberated from the jelly coat and egg capsules by finely mincing the egg strands with a razor blade. The liberated gastrulae were centrifuged at 1500 X g for 5 min at RT. Chromosomes were swelled by resuspending the gastrulae in 500 mosm ASW and incubating them at RT for 20 min. The A. californica gastrulae were collected by centrifugation, then fixed, stored, and karyotyped using the same procedures described above for the E. chlorotica preparations. Once the karyotype was established, the chromosomes were tested for prk binding as described below.

Nuclear prk binding: Vaucheria

A final control experiment was to ensure that the prk probe would label V. litorea DNA. There is almost no information in the literature about Vaucheria chromosomes in general, and V. litorea in particular. The filaments of V. litorea are coenocytic with nuclei scattered along the length, but nuclear division occurs at the growing tip, usually in the dark. The nuclei are small, and the chromosomes are tiny and may not condense during nuclear division. The older literature indicates possibly 5 chromosomes in some of the freshwater Vaucheria species, but other chromosome numbers have been reported also (Gross, 1937). Electron microscopy of nuclear division in V. litorea found spindles but no recognizable chromosomes (Ott and Brown, 1972). As a result, we tested prk labeling using V. litorea nuclei as described below.

Preparation of Vaucheria litorea nuclei

Vaucheria litorea filaments were rinsed in algal culture medium and blotted to remove excess liquid. The filaments were placed in cold (4 [degrees]C) homogenization buffer (250 mosm ASW containing 250 mmol l-1 sucrose, 10 mmol [l.sup.-1] Mg[Cl.sub.2] and l mmol [l.sup.-1] DTT), minced with a razor blade, then homogenized in a glass homogenizer. The algal suspension was filtered through six layers of cheesecloth to remove large clumps, then the filtrate was centrifuged at 500 X g for 5 min at RT to pellet the nuclei but leave other cellular components in the supernatant. The supernatant was discarded and the pellet was resuspended in 250 mmol [l.sup.-1] sucrose containing 10 mmol [l.sup.-1] Mg[Cl.sub.2]. The suspension was applied to a two-step sucrose gradient (equal volumes of 1 mol [l.sup.-1] and 0.5 mol [l.sup.-1] sucrose) and centrifuged at 1000 X g for 5 min at RT to concentrate the nuclei (modified from Luthe and Quatrano, 1980). The upper, slightly green layer at the top of the 0.5 mol [l.sup.-1] sucrose gradient step was collected, washed two times in 250 mosm ASW, then resuspended in fixation solution and incubated for 20 min at RT. This fixation step was repeated two additional times and the nuclei stored in the fixation solution overnight at -20[degrees]C prior to slide preparation.

Prk binding on Vaucheria litorea nuclei and Aplysia californica metaphase chromosomes

One hundred V. litorea nuclei or 100-150 fixed A. californica gastrulae per slide were needed to obtain at least 10 single nuclei not associated with any cellular debris or at least 10 well-spaced metaphase chromosome spreads. V. litorea nuclei and liberated A. californica gastrulae were resuspended in fresh fixation solution and incubated at RT for 5 min. The suspensions were transferred to microfuge tubes and centrifuged at 12,000 X g for 5 min at RT. The pellets were resuspended in fixation solution and dropped onto a RT glass microscope slide by using a pi pet tip; the fixation solution was allowed to evaporate. The A. californica chromosomes were spread by adding 20 [micro]l of 1:1 acetic acid/water. Then both the nuclei and chromosome slides were transferred to a 42[degrees]C incubator and dried for 1 h. They were brought to RT and aged for 24 h prior to their use for FISH analysis.

The A. californica chromosome pre-treatment, in situ hybridization, detection, and microscopy experiments were performed using the same procedures as described above, except that an actin probe synthesized using A. californica gDNA was substituted for the E. chlorotica actin probe to verify chromosome and reagent quality.

Results

An ideal result from these experiments would be for the various gene probes to bind at a similar location on each sister chromatid of two morphologically similar--therefore, homologous--chromosomes in the middle of a well-isolated chromosome spread that accounted for all of the diploid number of chromosomes, all of which were easily photographed. In practice, that almost never happened in a single preparation, as the result of degree of chromosome coiling, physical position of the chromosome, intermingling of chromosomes from neighboring nuclei, loss of chromosomes, length of probe sequence, working distance, and field of view, among other reasons. Many preliminary experiments were performed to maximize the encounters with the fluorescent signal, but an ideal result was rare. Instead, the results described below are a compilation of hundreds of examinations of many dozens of preparations from many egg masses on multiple occasions (Table 1).

Although there are a few large, easily recognized chromosomes in the E. chlorotica cell nucleus, more than half of them are quite small (less than 2 or 3 p.m), metacentric, and have arms of very similar length (Fig. 1). These smaller chromosomes are very difficult to distinguish from each other. The chromosomes in Figure 1 were assembled showing potential homologous pairs, but possibly members of the smaller pairs should be interchanged. Nevertheless, counts of chromosome numbers from 50 isolated metaphase smears on slides from 10 different preparations routinely produced a haploid number of 15 (2n = 30). In comparison, among a variety of opisthobranch species, chromosome numbers range from 13 to 17 (Burch and Natarajan, 1967; Thiriot-Quievreux, 2003). Two other species of Elysia (E. amakusana [Inaba, 1959] and E. viridis [Mancino and Sordi, 1964]) each had n = 17.

The FISH actin probe was always localized on the arms of two, probably homologous, intermediate-sized E. chlorotica chromosomes in the metaphase spreads (Fig. 2). It was unusual for all probe binding sites on the chromosomes to be labeled in every preparation (Fig. 2), but the actin label was not found anywhere else among the chromosomes. In all our experiments, the prk probe labeled only the arms of two of the tiny E. chlorotica chromosomes in the metaphase spreads (Table 1, Fig. 3). Because there are so many of these tiny chromosomes that are not distinguishable from each other with the techniques used here, we cannot say for sure that the same chromosome was labeled in every preparation, but the label never appeared on more than two chromosomes in each nuclear group. So, importantly, a FISH probe for an algal nuclear gene binds to a slug chromosome.

The reagent control experiments were always negative in preparations from all species (Table 1). No chromosome in any preparation was ever labeled without a gene probe present. Similarly, the rbcL probe was never observed bound to an E. chlorotica chromosome (Table 1). So neither the reagents nor the probes caused non-specific signals under the conditions we used.

The A. californica karyotype analysis consistently found 17 chromosomes (2n = 34) in metaphase smears from seven different egg masses (Fig. 4). As was the case with E. chlorotica, several of the larger chromosomes were easily distinguished by size and centromere position, but some of the smaller chromosomes are quite similar in morphology and require more than DAPI staining to distinguish them adequately. The actin probe routinely bound only to two, likely homologous, intermediate-sized A. californica chromosomes in the metaphase spreads (Fig. 5). As with the E. chlorotica results, it was unusual for all the actin sites to be labeled in every A. californica preparation, but no more than two chromosomes were ever labeled. These control experiments ensure that we were looking at all the chromosomes present in A. californica, and that the chromosomal DNA was capable of binding the FISH probes. Binding of the prk probe was never observed in any of the A. californica preparations.

Finally, as expected, the V. litorea nuclei were small, 3-4 jam in diameter, with a prominent nucleolus (Fig. 6a). Although we failed to visualize V. litorea chromosomes, the prk probe labeled the algal nuclei (Fig 6b), sometimes showing two probe-binding sites per nucleus.

Discussion

The FISH labeling presented in the results clearly demonstrates that one of the Elysia chlorotica chromosomes has a site that binds a probe made up of the nucleotide sequence for the Vaucheria litorea nuclear gene, prk. This is the third line of evidence that genes from the slug's algal food species have not only been transferred into the slug cell but have been incorporated into the chromosomes and are now vertically transmitted in the slug germ line. This result is supported by earlier work that located prk, and other V. litorea nuclear genes as well, in the genomic DNA of both E. chlorotica larvae and adults using PCR (Pierce et al, 2007; Rumpho et al, 2009), in RNA from adult slugs by qRT-PCR (Soule and Rumpho, 2009), as well as in the E. chlorotica adult transcriptome (Pierce et al, 2012). Two other sequencing efforts failed to find algal sequences in the E. chlorotica transcriptome (Pelletreau et al., 2011) or the larval ("egg") genome (Battacharya et al, 2013). However, those sequencing studies either did not produce a complete genome and used an incomplete V. litorea genomic data set (Battacharya et al, 2013), or used no V. litorea data at all (Pelletreau et al, 2011) for sequence matching purposes. Further, the larval sequencing study (Battacharya et al, 2013) pooled DNA from hundreds of individuals, which could have produced assembly issues resulting from heterozygocity, and analyzed only the unassembled raw reads. Clearly, the FISH technique and the control experiments have produced unambiguous evidence of a transferred algal sequence in the E. chlorotica genome.

The mechanism of gene transfer is of interest, but unknown. The phagosomal-based feeding mechanism utilized by gastropods (Owen, 1966) could take up nuclei and other algal cell inclusions, as well as the chloroplasts (Taylor, 1968; Martin et al., 2013). Transcriptome sequencing suggests that several dozen algal nuclear genes are expressed in the E. chlorotica cell, perhaps indicating that relatively large pieces of algal DNA rather than individual genes were transferred. However, the E. chlorotica transcriptome annotation found genes only in the slug RNA associated with photosynthesis proteins and their processing (Pierce et al., 2012). A wider variety of algal proteins might be expected to be present if large pieces of algal DNA were involved. Furthermore, although protistan kleptoplasty often involves the presence of algal nuclei or nuclear remnants in addition to the chloroplast within the host cell (Gast et al., 2007; Johnson et al., 2007; Nowack et al., 2011), all attempts to locate algal nuclei or their remnants with molecular or microscopical experiments in several species of Elysia have been negative (reviewed in Pierce and Curtis, 2012). So the results so far suggest that pieces of DNA rather than entire chromosomes or individual genes may constitute the transferome. It will require a great deal more FISH testing to learn the chromosomal positions of other algal genes.

The location of algal nuclear genes on the host cell chromosomes further demonstrates the high amount of integration of the chloroplast and the photosynthesis maintenance mechanisms into the E. chlorotica cell biology. Although chloroplast reproduction has never been reported in any species of kleptoplastic sacoglossan, a wide array of adaptations for maintaining the chloroplasts are present in the various species, ranging from essentially nothing--chloroplasts are taken up into phagosomes and rapidly digested--to the high level of integration in E. chlorotica (reviewed in Pierce and Curtis, 2012). Not only do the V. litorea chloroplasts persist for 7-8 mon or longer in starved E. chlorotica, but they continue to photosynthesize, fix carbon, produce oxygen, synthesize chlorophyll, and be translationally active. Both chloroplast- and nuclear-encoded chloroplast proteins are synthesized, nuclear-encoded transcripts for chloroplast genes are present in the slug cell RNA, and the genes for some of them have been located in genomic DNA of both larvae and adults by PCR (reviewed by Pierce and Curtis, 2012). In addition, while many other species of sacoglossans--including some that are able to keep the chloroplasts for several months, such as E. timida (Risso 1818)--are rarely found away from the algal chloroplast source and continually turn over the algal organelles, individual E. chlorotica are often found in our field site during seasons-long absences of V. litorea. Unlike E. chlorotica, E. timida seems to have little capacity to sustain photosynthesis for more than a few weeks (Casalduero and Muniain, 2008) although the chloroplasts are present for 2-3 mon, and it also may not have any cellular biochemical support for them. Indeed, transcriptome sequencing of E. timida did not find any algal transcripts, although the data set was small and donor algal (Acetabularia) genome sequences were only partially available (Wagele et al., 2011), so matches might have easily been missed. Other sacoglossan species with similar lengths of plastid function longevity as E. timida (2-4 mon; namely E. viridis, E. clarki) show a variety of specific adaptations in their cell biology to sustain the function of the algal organelle. In some cases, such as E. clarki, plastid maintenance mechanisms are sufficient to enable enough photosynthesis to occur for long enough to permit some independence from a food source (Middlebrooks et al., 2011, 2012, 2014). Although a few recent accounts based on E. timida have discounted the importance of photosynthetic function as well as the longevity and integration of symbiotic plastid function among the sacoglossans as a group (Wagele et al., 2011; Christa et al., 2013), it is clear that the broad differences in the adaptations among species makes generalizations based on one slug species unwarranted.

All of the research on gene transfer in E. chlorotica so far has been descriptive, and another aspect of major significance, about which nothing is presently known, is the underlying cell biology that permits the phenomenon. The transfer of genes between species has been demonstrated in groups other than sea slugs (for example, International Aphid Genomics Consortium, 2010; Nowack et al., 2011; Kent et al., 2011), and the integration of foreign organelles into host cells and subsequent gene transfer is the basis of the endosymbiotic theory of the origin of eukaryotic cells. However, the underlying adaptations that permit long-term survival of a foreign organelle and the integration of a functional gene and gene product, as well as its transmission to future generations, are mostly unknown. The foreign gene must not only get to the host nucleus and find its way into the expression process, but the gene product must be appropriately synthesized, folded, transported, targeted, inserted, and unfolded, all in a cytoplasm that should not be biochemically equipped to do all that. Still, those kinds of biochemical adaptations have occurred many times before, most obviously in the cases of the integrations of mitochondria and chloroplasts into the eukaryotic cell complex. The transcriptome analysis of E. chlorotica found not only the presence of transcripts for proteins that must be turned over for photosynthesis to persist, but also transcripts for algal cellular enzymes that are involved in targeting and trafficking chloroplast proteins (Pierce et al., 2012). In addition, the chloroplast genome is translationally active in E. chlorotica (Hanten and Pierce, 2001; Pierce et al., 2012) and E. clarki (Pierce et al., 2003). Possibly, at least some of the chloroplast protein synthesis, trafficking, and modification could be done by hijacking host cell native proteins, but some presence of algal-specific, protein-trafficking molecules would seem to be necessary, and indeed, some of them are present in the E. chlorotica transcriptome. A FISH search for these kinds of genes using V. litorea gene sequences might be informative.

Acknowledgments

We thank Tom Capo for kindly providing us with A. californica egg masses. We are also grateful to a private donor, who wishes to remain anonymous, for providing funds to SKP to support this research. The experimental work was done by JAS as part of the requirements for the Ph.D degree.

Literature Cited

Bhattacharya, D., K. N. Pelletreau, D. C. Price, K. E. Sarver, and M. E. Rumpho. 2013. Genome analysis of Elysia chlorotica egg DNA provides no evidence for horizontal gene transfer into the germ line of this kieptoplastic mollusc. Mol. Biol. Evol. 30: 1843-1853.

Bidwell, J. P., and S. Spotte. 1985. Artificial Seawaters: Formulas and Methods. Jones and Bartlett, Boston.

Burch, J. B., and R. Natarajan. 1967. Chromosomes of some opisthobranchiate mollusks from Eniwetok Atoll, Western Pacific. Pac. Sci. 21: 252-259.

Casalduero, F. G., and C. Muniain. 2008. The role of kleptoplasts in the survival rates of Elysia timida (Risso, 1818) (Sacoglossa: Opisthobranchia) during periods of food shortage. J. Exp. Mar. Biol. Ecol. 357: 181-197.

Christa, G., V. Zimorski, C. Woehle, A. G. M. Tielens, H. Wagele, W. F. Martin, and S. V. Gould. 2013. Plastid-bearing sea slugs fix C02 in the light but do not require photosynthesis to survive. Proc. R. Soc. Lond. B 281: 20132493. doi:10.1098/rspb.2013.2493.

Curtis, N. E., S. E. Massey, and S. K. Pierce. 2006. The symbiotic chloroplasts in the sacoglossan Elysia clarki are from several algal species. J. Invertebr. Biol. 125: 336-345.

Curtis, N. E., S. K. Pierce, S. E. Massey, J. A. Schwartz, and T. K. Maugel. 2007. The intracellular, functional chloroplasts in adult sea slugs (Elysia clarki) come from several algal species, and are also different from those in juvenile slugs. Mar. Biol. 150: 797-806.

Gast, R. J., D. M. Moran, M. R. Dennett, and D. A. Caron. 2007. Kleptoplasty in an Antarctic dinoflagellate: caught in evolutionary transition. Environ. Microbiol. 9: 39-45.

Green, B. J., W-Y. Li, J. R. Manhart, T. C. Fox, E. J. Summer, R. A. Kennedy, S. K. Pierce, and M. E. Rumpho. 2000. Molluscchloroplast endosymbiosis. Photosynthesis, thylakoid protein maintenance and chloroplast gene expression continue for many months in the absence of the algal nucleus. Plant Physiol. 124: 331-342.

Gross, C. 1937. The cytology of Vaucheria. Bull. Torrey Bot. Club 64: 1-15.

Hanten, J. J., and S. K. Pierce. 2001. Synthesis of several light-harvesting complex I polypeptides is blocked by cycloheximide in symbiotic chloroplasts in the sea slug, Elysia chlorotica (Gould): a case for horizontal gene transfer between alga and animal? Biol. Bull. 201: 34-44.

Harrigan, J. F., and D. L. Alkon. 1978. Laboratory cultivation of Haminoea solitaria (Say, 1822) and Elysia chlorotica (Gould, 1870). Veliger 12: 299-302.

Henegariu, O., P. Bray-Ward, S. Artan, G. H. Vance, M. Qumsyieh, and D. C. Ward. 2001. Small marker chromosome identification in metaphase and interphase using centromeric multiplex FISH (CMFISH). Lab. Invest. 81: 475-481.

Inaba, A. 1959. Cytological studies in molluscs. III. A chromosome survey in the opisthobranchiate Gastropoda. Annot. Zool. Jpn. 32: 81-88.

International Aphid Genomics Consortium. 2010. Genome sequence of the Pea Aphid Acyrthosiphon pisum. PLoS Biol, doi: 10.1371/ journal.pbio. 1000313.

Johnson, M. D., D. Oldach, C. Delwiche, and D. K. Stoecker. 2007. Retention of transcriptionally active cryptophyte nuclei by the ciliate Myrionecta rubra. Nature 445: 426-428.

Kent, B. N., L. Salichos, J. G. Gibbons, A. Rokas, I. L. G. Newton, M. E. Clark, and S. R. Bordenstein. 2011. Complete bacteriophage transfer in a bacterial endosymbiont (Wolbachia) determined by targeted genome capture. Genome Biol. Evol. 3: 209-218.

Luthe, D. S., and R. S. Quatrano. 1980. Transcription in isolated wheat nuclei. I. Isolation of nuclei and elimination of endogenous ribonuclease activity. Plant Physiol. 65: 305-308.

Mancino, G., and M. Sordi. 1964. II corredo cromosomico di alcuni Opisthobranchi Sacoglossi del mar Tirreno. Atti Soc. Toscana Sci. Nat. Mem. Ser. B 71: 1-12.

Martin, R., P. Walther, and K.-H. Tomaschko. 2013. Phagocytosis of algal chloroplasts by digestive gland cells in the photosynthesis-capa ble slug Elysia timida (Mollusca, Opisthobranchia, Sacoglossa). Zoomorphology 132: 253-259.

Middlebrooks, M. L., S. K. Pierce, and S. S. Bell. 2011. Foraging behavior under starvation conditions is altered via photosynthesis by the marine gastropod. Elysia clarki. PLoS One 6: e22162.

Middlebrooks, M. L., S. S. Bell, and S. K. Pierce. 2012. The kleptoplastic sea slug Elysia clarki prolongs photosynthesis by synthesizing chlorophyll a and b. Symbiosis 57: 127-132.

Middlebrooks, M. L., S. S. Bell, N. E. Curtis, and S. K. Pierce. 2014. Atypical plant-herbivore association of algal food and a kleptoplastic sea slug (Elysia clarki) revealed by DNA barcoding and field surveys. Mar. Biol. 161: 1429-1440. 10.1007/s00227-0142431-9.

Mujer, C. V., D. L. Andrews, J. R. Manhart, S. K. Pierce, and M. E. Rumpho. 1996. Chloroplast genes are expressed during intracellular symbiotic association of Vaucheria litorea plastids with the sea slug Elysia chlorotica. Proc. Natl. Acad. Sci. USA 93: 12333-- 12338.

Nowack, E. C. M., H. Vogel, M. Groth, E. R. Grossman, M. Melkonian, and G. Glockner. 2011. Endosymbiotic gene transfer and transcriptome regulation of transferred genes in Paulinella chromatophora. Mol. Biol. Evol. 28: 407-422.

Ott, D. W., and R. M. Brown. 1972. Light and electron microscopical observations on mitosis on Vaucheria litorea Hofman ex C. Agardh. Br. Phycol. J. 7: 361-374.

Owen, G. 1966. Digestion. Pp. 53-96 in Physiology of Mollusca, Vol. 2, K. M. Wilbur and C. M. Yonge, eds. Academic Press, New York.

Patterson, C. M. 1969. Chromosomes of the molluscs. Pp. 635-686 in Proceedings of the Symposium on the Mollusca, Part II, K. Virabhadra Rao, ed. Marine Biological Association of India, Fisheries P. O., Mandapam Camp, India.

Pelletreau, K. M., D. Bhattacharya, D. C. Price, J. M. Worful, A. Moustafa, and M. E. Rumpho. 2011. Sea slug kleptoplasty and plastid maintenance in a metazoan. Plant Physiol. 155: 1561-1565.

Pierce, S. K., and N. E. Curtis. 2012. The cell biology of the chloroplast symbiosis in sacoglossan sea slugs. Int. Rev. Cell Mol. Biol. 293: 123-148.

Pierce, S. K., R. W. Biron, and M. E. Rumpho. 1996. Endosymbiotic chloroplasts in molluscan cells contain proteins synthesized after plastid capture. J. Exp. Biol. 199: 2323-2330.

Pierce, S. K., S. E. Massey, J. J. Hanten, and N. E. Curtis. 2003. Horizontal transfer of functional nuclear genes between multicellular organisms. Biol. Bull. 204: 237-240.

Pierce, S. K., N. E. Curtis, J. J. Hanten, S. L. Boerner, and J. A. Schwartz. 2007. Transfer, integration and expression of functional nuclear genes between multicellular species. Symbiosis 43: 57-64.

Pierce, S. K., X. Fang, J. A. Schwartz, X. Jiang, W. Zhao, N. E. Curtis, K. Kocot, B. Yang, and J. Wang. 2012. Transcriptomic evidence for the expression of horizontally transferred algal nuclear genes in the photosynthetic sea slug, Elysia chlorotica. Mol. Biol. Evol. 29: 1549-1556.

Rpnne, M. 1989. Chromosome preparation and high resolution R- and G-banding techniques. Pp. 11-10 in Cytogenetics of Animals, C. Hainan, ed., C.A.B. International.

Rumpho, M. E., J. M. Worful, J. Lee, K. Kannan, M. S. Tyler, D. Bhattacharya, A. Moustafa, and J. R. Manhart. 2008. Horizontal gene transfer of the algal nuclear gene psbO to the photosynthetic sea slug Elysia chlorotica. Proc. Natl. Acad. Sci. USA 105: 17867-17871.

Rumpho, M. E., S. Pochareddy, J. M. Worful, E. J. Summer, D. Bhattacharya, K. N. Pelletreau, M. S. Tyler, J. Lee, J. M. Manhart, and K. M. Soule. 2009. Molecular characterization of the Calvin cycle enzyme phosphoribulokinase in the stramenopile alga Vaucheria litorea and the plastid hosting mollusc, Elysia chlorotica. Mol. Plant 2: 1384-1396.

Schwartz, J. A., N. E. Curtis, and S. K. Pierce. 2010. Using algal transcriptome sequences to identify transferred genes in the sea slug, Elysia chlorotica. Evol. Biol. 37: 29-37.

Soule, K. M., and M. E. Rumpho. 2009. Light-regulated photosynthetic gene expression and phosphoribulokinase enzyme activity in the heterokont alga Vaucheria litorea (xanthophyceae) and its symbiotic molluskan partner Elysia chlorotica (Gastropoda). J. Phycol. 48: 373-383.

Taylor, D. L. 1968. Chloroplasts as symbiotic organelles in the digestive gland of Elysia viridis (Gastropoda: Opisthobranchia). J. Mar. Biol. Assoc. UK 48: 1-15.

Thiriot-Quievreux, C. 2003. Advances in chromosomal studies of gastropod molluscs. J. Molluscan Stud. 69: 187-201.

Vitturi, R., P. Gianguzza, M. S. Colomba, and S. Riggio. 2000. Cytogenetic characterization of Brachidontes pharaonis (Fisher P.,1870): karyotype, banding and fluorescent in situ hybridization (FISH) (Mollusca: Bivalvia: Mytilidae). Ophelia 52: 213-220.

Wagele, H., O. Deusch, K. Handeler, R. Martin, V. Schmitt, G. Christa, B. Pinzger, S. B. Gould, T. Dagan, A. Klussman-Kolb, and W. Martin. 2011. Transcriptome evidence that longevity of acquired plastids in the photosynthetic slugs Elysia timida and Plakobranchus ocellatus does not entail lateral transfer of algal nuclear genes. Mol. Biol. Evol. 28: 699-706.

West, H. H., J. Harrigan, and S. K. Pierce. 1984. Hybridization of two populations of a marine opisthobranch with different developmental patterns. Veliger 26: 199-206.

Zappulla, J. P., A. Angers, D. Barbas, V. F. Castellucci, and L. DesGroseillers. 2005. A novel actin isoform is expressed in the ovotestis of Aplysia californica. Comp. Biochem. Physiol. B 140: 403-409.

JULIE A. SCHWARTZ (1), NICHOLAS E. CURTIS (2), AND SIDNEY K. PIERCE (1,3)

(1) Department of Integrative Biology, University of South Florida, Tampa, Florida 33620;

(2) Department of Biology and Chemistry, Ave Maria University, Ave Maria, Florida 34142; and 3Department of Biology, University of Maryland, College Park, Maryland 20742

* To whom correspondence should be addressed. E-mail: pierce@usf.edu Received 21 April 2014; accepted 21 October 2014.

Table 1
Summary of the results of prk FISH labeling
of Elysia chlorotica chromosome preparations

  Date                  Negative       Positive
 of egg    Reagent      Control        Control
mass (1)   Control     rbcL probe    actin probe        prk Probe

5/14/13    Negative   Negative (2)   Positive (2)   Positive, 100% (2)
5/25/13    Negative     Negative       Positive     Positive (3), 100%
5/18/13    Negative     Negative       Positive       Positive, 100%
4/7/13     Negative     Negative       Positive       Positive, 100%
5/30/13    Negative     Negative       Positive       Positive, 100%
6/11/13    Negative     Negative       Positive       Positive, 100%
6/12/13    Negative     Negative       Positive       Positive, 100%
3/4/13     Negative     Negative       Positive       Positive, 100%
6/13/13    Negative     Negative       Positive       Positive, 100%
2/16/13    Negative     Negative       Negative        Negative (4)
2/16/13    Negative     Negative       Negative        Negative (4)
3/8/13     Negative     Negative       Positive     Positive (5), 100%
3/4/13     Negative     Negative       Positive       Positive, 100%

(1) Each egg mass was treated separately on a different microscope
slide.

(2) Result (positive labeling/negative), % of labeled chromosomes
that were the same morphology.

(3) Fig. 3A.

(4) The positive control (actin column) failed in these experiments
also, indicating a protocol issue. These were not included in the
results.

(5) Fig. 3B.
COPYRIGHT 2014 University of Chicago Press
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2014 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Schwartz, Julie A.; Curtis, Nicholas E.; Pierce, Sidney K.
Publication:The Biological Bulletin
Article Type:Report
Date:Dec 1, 2014
Words:7471
Previous Article:Functional characterization of neuroendocrine regulation of branchial carbonic anhydrase induction in the euryhaline crab Callinectes sapidus.
Next Article:Influence of natural inshore and offshore thermal regimes on egg development and time of hatch in American lobsters, Homarus americanus.
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |