Printer Friendly

Expression profile of two HSP70 chaperone proteins in response to extreme thermal acclimation in Xestia c-nigrum (Lepidoptera: Noctuidae).

Cellular stress response is involved in protecting organisms from damage caused by exposure to a variety of stressors, including temperature, heavy metals, and other xenobiotics. The stress response entails the rapid synthesis of heat shock proteins (HSPs) to protect cellular proteins against denaturation (Feder & Hofmann 1999; Boutet et al. 2003; Rinehart et al. 2007). In normal conditions, heat shock proteins primarily act as molecular chaperones involved in protein metabolism, cell cycle regulation, and apoptosis (Welch 1993; Ming et al. 2010). On the basis of molecular weight and sequence similarity, HSPs can be divided into several families, including HSP90, HSP70, HSP60, HSP40, and small heat shock proteins (molecular weights ranging from 12 to 43 kDa) (Sorensen et al. 2003; Huang et al. 2008; Shen et al. 2014). Among the HSPs, HSP70s are the most conserved and important protein families and have been studied extensively. The HSP70 family is encoded by 2 different genes, constitutive type HSC70 (heat shock cognate 70) and inducible type HSP70 (Boutet et al. 2003; Deane & Woo 2005; Franzellitti & Fabbri 2005). In normal conditions, HSC70 is constitutively expressed in all cells, whereas HSP70 is not expressed or is expressed only at a low level. Under stress conditions, HSC70 expression remains unchanged or is slightly up-regulated, whereas HSP70 expression is highly induced (Lindquist & Craig 1988; Franzellitti & Fabbri 2005). These 2 heat shock proteins play key roles in the cell as molecular chaperones. However, HSC70 is mainly involved in physiological processes, such as cell division, multiplication, and development (Park et al. 2001; Kregel 2002).

In insects, it is well known that HSP70s increase heat tolerance and provide protection against thermal injury and death. Many types of HSP70 genes are up-regulated in response to heat or cold stress in various insects, such as Diptera (Huang & Kang 2007; Huang et al. 2009; Gray 2013), Lepidoptera (Jiang et al. 2012; Choi et al. 2014; Shen et al. 2014), and Coleoptera (Mahroof et al. 2005). Because of the important roles of HSP70s in thermal stress, it is important to investigate the function and expression characteristics of HSP70 genes under temperature stress. In Drosophila melanogaster Meigen (Diptera: Drosophilidae), thermotolerance was found to be significantly improved in a strain with extra copies of HSP70s (Bettencourt et al. 2008; Jensen et al. 2014). The suppression of HSP70 mRNA levels by RNAi decreased the heat and cold tolerance in Pyrrhocoris apterus (L.) (Heteroptera: Pyrrhocoridae) and Spodoptera exigua Hubner (Lepidoptera: Noctuidae) (Kostal & Tollarova-Borovanska 2009; Choi et al. 2014). In addition, HSP70s may be involved in the developmental processes of some insects and in fecundity (Jensen et al. 2014), longevity (Zhang et al. 2010; Choi et al. 2014), diapause (Rinehart et al. 2007), development (Huang et al. 2009), and metamorphosis (Zheng et al. 2010). These studies have provided direct evidence of the roles of HSP70s in cellular activity and development and have elucidated important biological functions.

Xestiac-nigrum L. (Lepidoptera: Noctuidae) is an important polyphagous pest of vegetables, cotton, wheat, maize, soybean, and ornamental plants. It is a worldwide pest that occurs in tropical, subtropical, and temperate regions (Mukawa & Goto 2011). In South China, including Guangdong, and Taiwan, X. c-nigrum is adapted to high temperatures that occur throughout the year. Severe crop damage occurs when the temperature is high in the summer and autumn, indicating that X. c-nigrum has a significantly positive response to high temperature (Zheng & Wang 2010; Zhang et al. 2013). In addition to heat tolerance, X. c-nigrum exhibits cold resistance, overwintering as larvae and pupae in temperate zones without entering diapause. The pupae have an average supercooling point of approximately -17[degrees]C with a low of -21[degrees]C in some individuals (Mukawa & Goto 2010; Landolt et al. 2011). In the southern region of North America and in Central and East Asia, overwintering pupae have been observed in fields (Xi et al. 2002). In China, the infesting population reaches northward to Heilongjiang Province in Northeast China. Notably, this species undertakes a long-distance migration between or within tropical, subtropical, and temperate regions, which significantly increases the geographic range over which infestations occur (Jiang et al. 2012). Furthermore, X. c-nigrum is known for its rapid development of resistance to many chemical pesticides and its lack of susceptibility to transgenic Bt crops (Landolt et al. 2011; Liu et al. 2011). Therefore, it can be presumed that X. c-nigrum has a high potential to tolerate or acquire tolerance to various environmental stresses. However, the biochemical and molecular mechanisms of such tolerance are unknown, and no information is available regarding stress-induced HSP70 expression in X. c-nigrum; therefore, the mechanisms underlying this species' ecological adaptability and stress tolerance remain unclear.

This study examined basal gene expression and thermal responses among different developmental stages, such as the larvae and pupae of X. c-nigrum, using expression profiling of Xc-HSC70 and Xc-HSP70. Furthermore, we evaluated Xc-HSP70 expression at the mRNA level under heat or cold stress in larvae and pupae. We explored the functions of these genes in the context of thermotolerance and development and provided information needed to explore the mechanism of environmental tolerance and ecological adaptation in X. c-nigrum.

Materials and Methods

INSECTS

Adult X. c-nigrum specimens were collected from Xiangfang Farm of Harbin, Heilongjiang Province, China. After oviposition, the eggs were incubated at 25 [+ or -] 1[degrees]C with a 12:12 h L:D photoperiod for hatching. Newly hatched larvae were reared at 25 [+ or -] 1[degrees]C and 70% relative humidity (RH) under a photoperiod of 14:10 h L:D in a climatic cabinet (RXZ-308B, Jiangsu, China), and cabbage leaf was used to feed the different instars. For diapause induction, 6th instars were placed in an 18 [+ or -] 1[degrees]C controlled-temperature room with an 8:16 h L:D photoperiod, and the diapause status of the pupae was ascertained as previously described (Liu et al. 2011).

TEMPERATURE EXPOSURE

Based on previous studies of thermotolerance in insects (Jiang et al. 2012; Lyytinen et al. 2012; Franke et al. 2014), developing larvae from the 2nd to 6th instar were chosen for heat and cold shock treatments. For each treatment, 5 individuals were placed into a cryogenic tube and shocked at high temperatures of 28, 31, 34, 37, 40, 43, 45, and 47[degrees]C for 2 h, then allowed to recover at 25[degrees]C for 1 h. Similarly, larvae from the 2nd to 6th instar and 4-d-old pupae were shocked at low temperatures of 5, 0, -4, and -7[degrees]C for 2 h, then transferred to 25 [degrees]C for 1 h of recovery. Corresponding untreated larvae and pupae were used as controls. The larvae did not survive at above 47[degrees]C and below -7[degrees]C, and therefore the mRNA was not analyzed. Each treatment was replicated 3 times. To detect the developmental regulation of the HSC70 and HSP70 genes, 2-, 4-, and 6-d-old pupae were reared at 25 [degrees]C, with 3 replications. All of the samples were frozen quickly in liquid nitrogen and stored at -80[degrees]C. Temperature control was achieved using environmental chambers (Sanyo, Tokyo, Japan).

CLONING OF THE FULL-LENGTH CDNAS OF XC-HSC70 AND XC-HSP70

Total RNA isolation and first-strand cDNA synthesis: RNA was isolated using an RNA isolation kit (Omega Bio-Tek, Norcross, Georgia, USA) according to the manufacturer's instructions. The concentration and quality of the RNA were verified by spectrophotometry and electrophoresis on a 1.0% agarose gel. The cDNA was synthesized using a cDNA kit (TaKaRa, Dalian, China) according to the manufacturer's instructions.

Primer design: The HSC70 and HSP70 genes of other insects were aligned in GenBank to identify the conserved region of the gene family. Primer Premier 5.0 (Premier, Canada) was used to design the primers, and the sequences of the primers are listed in Table 1. The PCR protocol was as follows: 3 min at 94[degrees]C and 35 cycles of 30 s at 94[degrees]C, 30 s at 57.8[degrees]C for Xc-HSC70 or 30 s at 58.0[degrees]C for Xc-HSP70, and 1 min at 72[degrees]C, followed by a 10 min extension at 72[degrees]C. Then, the amplified fragment was isolated using a 1.0% agarose gel and ligated into the pMD18-T vector (TaKaRa, Dalian, China) for sequencing. RACE amplification was performed based on the sequenced fragment of Xc-HSC70 and XcHSP70 using the 3'Full and 5'Full RACE kit (TaKaRa, Dalian, China). We designed the 5'RACE and 3'RACE primers 5'HSC70GSP1, 5'HSC70GSP2, 5' HSP70GSP1, 5 'HSP70GSP2, 3 'HSC70GSP1, 3'HSC70GSP2, 3 'HSP70GSP1, and 3' HSP70GSP2 (Table 1) and combined the 3 single fragments of Xc-HSC70 and Xc-HSP70 to design the full-length primer pairs P5, P6 and P7, P8, respectively.

CLONING OF THE XC-HSC70 AND XC-HSP70 GENES FROM GENOMIC DNA

Genomic DNA was isolated from 5th instars using the Universal Genomic DNA Extraction kit (Takara, Dalian, China) according to the manufacturer's instructions. The concentration and quality of the DNA were verified by spectrophotometry and electrophoresis on a 1.0% agarose gel.

To determine whether the Xc-HSC70 and Xc-HSP70 genes contained introns in their coding regions, the genomic DNA fragments for Xc-HSC70 and Xc-HSP70 were amplified from genomic DNA (100 ng) as a template, and their nucleotide sequences were analyzed. For Xc-HSC70 intron analysis, the amplification was performed using a pair of specific primers (P5, P6; Table 1), and the amplification conditions were 94[degrees]C for 3 min, followed by 35 cycles of 94[degrees]C for 30 s, 58[degrees]C for 45 s, and 72[degrees]C for 4 min, with a final elongation step at 72[degrees]C for 10 min. For Xc-HSP70 intron analysis, the genomic DNA fragment was amplified using a pair of specific primers (P7, P8; Table 1), and the amplification conditions were as described above. The DNA fragments were then cloned and sequenced.

SEQUENCE ANALYSIS

The bioinformatic software DNAStar (DNAStar, USA) was used to split joint the full-length sequences of Xc-HSC70 and Xc-HSP70. BLAST software was used to analyze the homology of the sequences (http://www.ncbi.nlm.nih.gov/blast/). Biology WorkBench (http:// workbench.sdsc.edu/) was used to identify the open reading frames (ORFs). ProtParam (http:// http://web.expasy.org/protparam/), ScanProsite (http://prosite.expasy.org/scanprosite/), and SWISS-MODEL (http://www.swissmodel.expasy.org/SWISS-MODEL.html) were used to analyze the protein sequence characteristics. PSORT II (http://psort. hgc.jp/form2.html) was used to calculate the nuclear localization signal fragment. CLUSTALW and MEGA 4.0 were used to draw the cladogram. Spidey (http://www.ncbi.nlm.nih.gov/spidey/) was used to analyze the genomic introns.

QUANTITATIVE ANALYSIS OF XC-HSC70 AND XC-HSP70 MRNA EXPRESSION

Total RNA isolation and first-strand cDNA synthesis were isolated as above. Real-time quantitative PCR (qRT-PCR) primers were designed using the Xc-HSC70 (HSC70 F, HSC70 R) and Xc-HSP70 (HSP70 F, HSP70 R) sequences, and the resulting products had lengths of 145 bp and 141 bp, respectively. The reference gene [beta]-actin was used as an endogenous control to quantify the expression of the target genes. This gene is an appropriate control for studies on HSP70s in insects during this wide developmental window as determined in our previous studies (Jiang et al. 2012; Yu et al. 2012), with a resulting product of 156 bp. Xc-HSC70, Xc-HSP70, and [beta]-actin sequences were amplified from each of the instars under each treatment condition using specific primers, Thunderbird[R] Sybr qPCR Mix (ToYoBo, http://www.toyobo-global. com, Japan), and a Chromo4[TM] Real-Time PCR instrument (Bio-Rad, Hercules, California, USA). All of the amplifications were performed in triplicate. The final volume of each qRT-PCR reaction was 20 [micro]l, which contained 10 [micro]l of 2 x SYBR Mix (ToYoBo, http://www.toyobo-global. com, Japan), 1 [micro]l of diluted cDNA template, 7.8 [micro]l of PCR-grade water, and 0.6 [micro]l of each primer at 10 [micro]M. PCR conditions were as follows: 95 [degrees]C for 30 s and 40 cycles of 95[degrees]C for 10 s and 60[degrees]C for 30 s.

Xc-HSC70 and Xc-HSP70 expression levels were calculated using the [2.sup.-[DELTA][DELTA]Ct] comparative threshold cycle (CT) method (Livak & Schmittgen 2001). The mean and standard deviation were calculated from experiments performed in triplicate and presented as n-fold differences in expression. Differences in the transcriptional features of Xc-HSC70 and Xc-HSP70 in different developmental stages were analyzed using SPSS 16.0. Statistical significance was determined using one-way analysis of variance (ANOVA) and post-hoc Duncan multiple range tests. Significance was defined as P < 0.05.

Results

NUCLEOTIDE ANALYSIS AND DEDUCED AMINO ACID SEQUENCES OF XC-HSC70 AND XC-HSP70

Total RNAs of Xc-HSC70 and Xc-HSP70 were isolated from larvae of X. c-nigrum which reared at room temperature and treated at 37[degrees]C respectively. Full-length cDNAs of Xc-HSC70 and Xc-HSP70 were 2,152 bp (published in Wang et al. 2014) and 2,213 bp (published in Wang et al. 2015), respectively. The sequence of Xc-HSC70 contains a 5'-terminal untranslated region (UTR) of 101 bp, a 3'-terminal UTR of 86 bp, and an ORF of 1,965 bp that encoded a protein of 654 amino acids with a calculated molecular weight of 71.59 kDa (Fig. 1). The sequence of Xc-HSP70 also contains a 5'-terminal UTR of 147 bp, a 3'-terminal UTR of 86 bp, and an ORF of 1,965 bp that encoded a protein of 654 amino acids with a calculated molecular weight of 71.62 kDa (Fig. 2). Amino acid sequence analysis indicated that Xc-HSC70 and Xc-HSP70 contained the cytoplasmic characteristic motif EEVD (Boutet et al. 2003) and 3 signature sequences of the HSP70 family (Figs. 1 and 2). At the carboxyl terminal region, Xc-HSC70 contained 3 consecutive repeats of the tetrapeptide motif GGMP (617 to 628 amino acids), whereas Xc-HSP70 contained 2 tetrapeptides of GGMP (617 to 620 amino acids, 625 to 628 amino acids). Putative bipartite nuclear localization signals (NLS) were also observed in the two HSP70s using the online software PSORT II (Figs. 1 and 2).

ANALYSIS OF THE GENOMIC DNA STRUCTURE OF XC-HSC70 AND XC-HSP70

For Xc-HSC70 intron analysis, a genomic DNA fragment of 3,710 bp was isolated by specific primers (P5, P6; Table 1). Comparison of the sequence isolated from genomic DNA with the cDNA sequence of Xc-HSC70 revealed 9 exons and 8 introns in the Xc-HSC70 fragment. The coding region of the Xc-HSC70 gene contained 8 exons and 7 introns (Fig. 3). The first intron (561 bp) was located in the 5' non-coding region, whereas the other introns were in the coding region, and their lengths were as follows: 157, 213, 87, 86, 135, 101, and 218 bp. All of the donor and acceptor sites of these introns were GT and AG, respectively, following the GT/AG rule as described by Breathnach & Chambon (1981) and Ming et al. (2010). For Xc-HSP70 intron analysis, a 2,043 bp genomic DNA fragment was isolated by specific primers (P7, P8; Table 1), with a sequence identical to that of the Xc-HSP70 cDNA, indicating that there was no intron in the coding region of the Xc-HSP70 gene. Otherwise, compared with the cDNA and gDNA sequences of the cloned Xc-HSC70 gene, the Xc-HSC70 gene contained 8 introns (Fig. 3), wherein the longest intron lay in the 5' UTR, which also contained an heat shock element (HSE)-like core sequence (gaatatgCaGAAtgTTCcaGaa) and other introns (with different lengths from 86 to 218 bp). This is the first report on the specific amount and sites of introns in HSC70 of X. c-nigrum.

SIMILARITY ANALYSIS AND PHYLOGENETIC TREE CONSTRUCTION

Homology analysis revealed that 2 Xc-HSP70s were highly conserved in insects. The deduced amino acid sequences were highly similar to those of other known HSP70s. Xc-HSC70 had higher than 88.1% similarity with other insect HSC70 genes, 97.8% similarity with HSC70 of Mamestra brassicae L. (Lepidoptera: Noctuidae) and 75% similarity with HSC70 of vertebrates. Through the similarity analysis, we found that the Xc-HSP70 genes had higher than 76.1% similarity with other insect HSP70 genes, e.g., 88.8% identity with HSP70 of M. brassicae and 86.3% identity with HSP70 of Helicoverpa zea Boddie (Lepidoptera: Noctuidae), and 71.5% similarity with HSP70 of vertebrates. The similarity between Xc-HSC70 and Xc-HSP70 was 83.5%. We also found that the sequences of Xc-HSC70 and Xc-HSP70 were more closely related to those of other HSC70 and HSP70 genes, respectively, in insects than to each other.

Phylogenetic tree construction showed that the HSP gene family could be divided into 2 main clusters: HSC70 and HSP70. This classification was supported by a high degree of confidence, as shown in the evolutionary tree cluster (Fig. 4). Xc-HSC70 belonged to the HSC70 cluster, which also contained all 11 other Xc-HSC70 genes. Xc-HSP70 belonged to the HSP70 cluster, which only contained all of the other HSP70 genes. Therefore, this finding supports that Xc-HSC70 is a constitutively expressed gene and that Xc-HSP70 is an inducible gene, with a bootstrap value of 100% in 1,000 replicates. The relationships displayed in the phylogenic tree were in general agreement with traditional taxonomy.

EXPRESSION OF XC-HSC70 AND XC-HSP70 RNA IN RELATION TO THERMAL STRESS DURING DEVELOPMENT

The relative mRNA expression levels of Xc-HSC70 induced by low and high temperatures during development were quantified by qRT-PCR (Fig. 5). Xc-HSC70 expression was significantly up-regulated at temperatures of [less than or equal to] -4 or [greater than or equal to] 40[degrees]C in all developmental stages (P < 0.05), and the Xc-HSC70 expression level induced by a temperature of 37[degrees]C in 5th instars was significantly different from that in the controls (P < 0.05). Therefore, the onset temperatures at which the expression level of Xc-HSC70 was significantly higher than that of the controls during cold and heat shock in most developmental stages were -4 and 40[degrees]C, respectively. The intensity of the temperature response of Xc-HSC70 varied among the developmental stages. Higher increases of 2.69 and 4.61 fold appeared in 2nd instars and pupae at -4 and -7[degrees]C, respectively, under cold shock, whereas the greatest increases were observed in 2nd instars under heat shock, with a maximum increase of 3.52 fold (Fig. 5).

No significant increase in relative mRNA expression levels of Xc-HSP70 were observed when larvae and pupae were stressed by temperatures of [greater than or equal to] 5[degrees]C or when larvae were stressed by temperatures of [less than or equal to] 34[degrees]C (Fig. 6, P > 0.05). However, Xc-HSP70 was significantly up-regulated at temperatures of [less than or equal to] 0[degrees]C or [greater than or equal to] 37[degrees]C (P < 0.05). Therefore, the onset temperatures for Xc-HSP70 up-regulation during cold and heat shock in all of the tested developmental stages were 0 and 37[degrees]C, respectively. Higher increases of 6.54 and 12.47 fold appeared in 5th instars at -4[degrees]C and pupae at -7[degrees]C, respectively, under cold shock, whereas the greatest increases were observed in 5th instars under heat shock, with a maximum increase of 8.98 fold (Fig. 6). The intensity of the temperature response of Xc-HSP70 varied among developmental stages, showing expression profiles similar to those of Xc-HSC70 during development. Xc-HSC70 was significantly up-regulated at temperatures of [less than or equal to] -4[degrees]C or [greater than or equal to] 40[degrees]C (P < 0.05). And the onset temperatures for Xc-HSC70 up-regulation during cold and heat shock in all of the tested developmental stages were -4 and 40[degrees]C, respectively. Higher increases of 2.7 and 4.6 fold appeared in 2th instars at -4[degrees]C and pupae at -7[degrees]C, respectively, under cold shock, whereas the greatest increases were observed in 5th instars under heat shock, with a maximum increase of 3.5 fold (Fig. 5).

Comparative mRNA expression profiles of Xc-HSC70 and Xc-HSP70 induced by cold and heat during development indicated 3 obvious characteristics (Figs. 5 and 6). First, the onset temperature varied between Xc-HSC70 and Xc-HSP70, depending on development stage in the case of heat shock but not cold shock, with a value of 40[degrees]C for Xc-HSC70 in most developmental stages and 37[degrees]C for Xc-HSP70 in all tested stages. Second, the temperature responses of Xc-HSP70 at any given temperature or developmental stage were more intense than those of Xc-HSC70.

The expression levels of the 2 X. c-nigrum heat shock protein genes in different developmental stages at 25[degrees]C were determined relative to the expression levels in 2nd instars. Xc-HSC70 and Xc-HSP70 expression decreased with the development of the larva and pupa without thermal stress (Fig. 7). Expression decreased substantially with larval age, and the lowest expression level was observed in 4th instars and then increased in 5th instars and 6th instars again. Expression of Xc-HSC70 and Xc-HSP70 did not change significantly in 4d and 6d-old pupa.

Discussion

Cluster analysis supported the finding that Xc-HSC70 and Xc-HSP70 belong to 2 different branches of HSP70 and HSC70, respectively. Some studies have found that expression of HSP70 increased significantly after the induction of environmental stress, but HSC70 expression was lower than HSP70 expression (Deane & Woo 2005). It has been suggested that the lack of introns in inducible HSP70 genes could help to circumvent blocks in RNA splicing and enable preferential expression of heat shock proteins during periods of stress (Huang et al. 1999), thus protecting cells against harmful insults. In this study, genomic DNA sequence analysis revealed 8 introns in the coding region of the Xc-HSC70 gene, representative of constitutive features, whereas the Xc-HSP70 gene did not contain any introns, representative of inducible features. All of the intron borders of the Xc-HSC70 gene start and end with the consensus GT and AG splicing signals (Breathnach & Chambon 1981). Xc-HSP70 was significantly different from Xc-HSC70 with regard to expression amount and expression time, and it displayed an increased rate of expression. The qRT-PCR results suggested that Xc-HSC70 was constitutively expressed and that Xc-HSP70 was induced, possibly because the Xc-HSP70 gene had no introns and Xc-HSC70 had introns, which affect the splicing and joining of mRNA (Yost & Lindquist 1991; Chuang et al. 2007).

The heat shock response is characterized by the induction of numerous HSPs (Balch et al. 2008) and is mostly regulated at the transcription level by heat shock transcription factors (HSFs), which can specifically bind to heat shock elements (HSEs) in the promoters of heat shock genes (Morimoto 1998). HSEs are composed of at least 3 inverted repeats of the consensus sequence nGAAn (Fernandes et al. 1994). The longest intron of Xc-HSC70 lies in the 5' UTR, which also contains an HSE-like core sequence (aGAAtatgcaGAAtgttccaGAAa). The HSFs bind to the HSEs and initiate the transcription of the HSP70s (Morimoto 1993). Although we did not measure the HSC70 or HSP70 protein level in this experiment, the precondition of higher levels of HSC70 or HSP70 is the higher abundance of HSC70 or HSP70 mRNA, respectively, because the synthesis of HSP70s is primarily regulated at the transcriptional level (Molina et al. 2000). To sustain a proper level of HSP mRNA, the transcription of HSPgenes can be controlled by negative regulation of HSPs. When HSPs reach high levels, HSFs bind to the HSPs, which blocks DNA binding to HSE genes (Morimoto 1993). The difference in mRNA expression between the Xc-HSC70 and Xc-HSP70 genes may be related to unique structures (Ali et al. 2003), functions, and regulatory characteristics (Park et al. 2001; Kregel 2002).

Although heat shock was the first stress shown to elicit synthesis of HSPs, it is now evident that various environmental, physiological, and genetic factors (Sorensen et al. 2003), even cold shock (Goto & Kimura 1998), can regulate the expression of these same proteins. Therefore, the regulation of inducible HSP70 genes plays an important role in cellular responses. The function of HSP genes in thermotolerance has been confirmed in various organisms (Sonna et al. 2002; Huang & Kang 2007). In X. c-nigrum, Xc-HSC70 and Xc-HSP70 were positively induced during development when the insect was stressed, regardless of heat or cold, suggesting that up-regulation of these genes is essential for thermotolerance in X. c-nigrum.

The level of Xc-HSP70 expression and transcription was increased after thermal stress treatments in different developmental stages, which suggests that Xc-HSP70s are closely associated with insect resistance to thermal stress (Sonoda et al. 2006; Zhang & Denlinger 2010). The intensity of the temperature responses also varies among HSP70 genes in different insects. Heat induction resulted in an expression increase of approximately 6 fold for the Xc-HSP70 gene (Figs. 5 and 6). This finding is peculiar because in many other insects, including some Lepidoptera species, heat up-regulates HSP70 expression by more than 100 fold. Regarding the 6-fold induction, we consider that the experimental materials, which were taken from the northernmost province of China in Heilongjiang Province (Habin, 130[degrees]10'N, 46[degrees]40'E), may be an important factor. Some studies have shown that production of HSP70 in response to temperature shock is less intense in organisms that are more frequently exposed to unfavorable temperatures in their habitat than in organisms in benign conditions (Sorensen et al. 2001; Lyytinen et al. 2012). As the synthesis of HSP70s requires considerable energy and may thus occur at the cost of the synthesis of other proteins (Krebs & Loeschcke 1994), northern populations might have evolved a less costly way to resist cold stress (Lansing et al. 2000; Sprensen et al. 2003). HSP70s may not be the only proteins involved in heat and cold resistance; other proteins such as HSP20, HSP60, and HSP90 may also be involved in heat resistance (Zhang & Denlinger 2010; Wang et al. 2012) or in the accumulation of low-molecular-weight cryoprotectants (Crowe et al. 1988), synthesis of antifreeze proteins (Duman 2001), and remodeling of the structure of the cell membrane (Tomcala et al. 2006). Some studies have found HSP70 to be up-regulated 2-5 fold in insects (Colinet et al. 2010; Morales et al. 2011; Shu et al. 2011; Wang et al. 2012; Yu et al. 2012; Luo et al. 2014).

The onset temperature at which HSP70 gene expression is upregulated, whether low or high, varies among organisms (Garbuz et al. 2003). Tomanek & Somero (1999) suggested that the threshold temperature may be a useful way to identify temperature tolerance limits and that a higher onset temperature is associated with high heat tolerance, and vice versa. Findings in Drosophila (Garbuz et al. 2003) and leaf miner species (Huang & Kang 2007) support this idea. In X. c-nigrum, the relatively high onset temperature of 40 and 37[degrees]C for Xc-HSC70 and Xc-HSP70, respectively, in response to heat shock may represent an indicator of heat tolerance. In contrast, the values of -4 and 0 [degrees]C for Xc-HSC70 and Xc-HSP70, respectively, under cold shock may suggest only weak cold tolerance for this species. Furthermore, the difference in onset temperature between the 2 genes under heat shock, i.e., 40[degrees]C in most developmental stages for Xc-HSC70 and 37[degrees]C in all of the tested developmental stages for Xc-HSP70, may reflect different functions. That is, inducible expression of HSP70 but not HSC70 at "normal" temperatures in organisms may play a negative role in cell growth and division. Expression of Xc-HSP70 was not significantly different across a wide temperature range from 26 to 40[degrees]C, which is consistent with the negative effect of HSP70 overexpression on growth, survival, and fecundity observed in other insects (Krebs & Loeschcke 1994).

Finally, the basal HSP70 gene expression profiles varied with developmental stage, suggesting that these genes may be involved in development (Huang et al. 2009). Interestingly, the relative accumulated amounts of mRNA from large HSP70s, including HSC70 and HSP70, may increase or decrease as larval and pupal development progress, depending on the species (Sonoda et al. 2006). In X. c-nigrum, the relative transcript levels of Xc-HSC70 and Xc-HSP70 decreased with the developmental progress of the pupa. These results are consistent with research conducted on Pteromaluspuparum (L.) (Hymenoptera: Pteromalidae) and the pyrrhocorid P apterus (Kostal & Tollarova-Borovanska 2009; Wang et al. 2012). Furthermore, gene expression profiles for induced HSP70s also varied after heat or cold shock during development. Mahroof et al. (2005) suggested that increased mRNA abundance induced under thermal stress during different developmental stages may contribute to the increased thermotolerance in those stages. Increased thermotolerance in young larvae of Tribolium castaneum (Herbst) (Coleoptera: Tenebrionidae) was suggested to result from increased expression of HSP70s (Mahroof et al. 2005). In X. c-nigrum, higher Xc-HSC70 and Xc-HSP70 expression were observed in heat and cold shocked young larvae and pupae, consistent with high heat resistance in larvae and stronger cold tolerance in young larvae and pupae. Therefore, our findings that correspond to thermal acclimation for X. c-nigrum during development based on HSP70 gene expression levels are consistent with temperature tolerances observed in field populations.

Acknowledgments

This work was supported by the Special Fund for Modern Agroindustry Technology Research System: Soybean Technology Research System (CARS-04) and the Fund of Common Wealth Industry (Agriculture) Special Research (201103002).

References Cited

Ali KS, Dorgai L, Abraham M, Hermesz E. 2003. Tissue- and stressor-specific differential expression of two hsc70 genes in carp. Biochemical and Biophysical Research Communications 307: 503-509.

Balch WE, Morimoto RI, Dillin A, Kelly JW. 2008. Adapting proteostasis for disease intervention. Science 319: 916-919.

Bettencourt BR, Hogan CC, Nimali M, Drohan BW. 2008. Inducible and constitutive heat shock gene expression responds to modification of Hsp70 copy number in Drosophila melanogaster but does not compensate for loss of thermotolerance in Hsp70 null flies. BMC Biology 6: 5.

Boutet I, Tanguy A, Rousseau S, Auffret M, Moraga D. 2003. Molecular identification and expression of heat shock cognate 70 (hsc70) and heat shock protein 70 (hsp70) genes in the Pacific oyster Crassostrea gigas. Cell Stress Chaperones 8: 76-85.

Breathnach R, Chambon P. 1981. Organization and expression of eukaryotic split genes coding for proteins. Annual Review of Biochemistry 50: 349-383.

Choi BG, Hepat R, Kim Y 2014. RNA interference of a heat shock protein, Hsp70, loses its protection role in indirect chilling injury to the beet armyworm, Spodoptera exigua. Comparative Biochemistry and Physiology Part A: Molecular and Integrative Physiology 168: 90-95.

Chuang K, Ho S, Song Y. 2007. Cloning and expression analysis of heat shock cognate 70 gene promoter in tiger shrimp (Penaeus monodon). Gene 405: 10-18.

Colinet H, Lee SF, Hoffmann A. 2010. Temporal expression of heat shock genes during cold stress and recovery from chill coma in adult Drosophila melanogaster. FEBS Journal 277: 174-185.

Crowe JH, Crowe LM, Carpenter JF, Rudolph AS, Wistrom CA, Spargo BJ, Anchordoguy TJ. 1988. Interactions of sugars with membranes. Biochimica et Biophysica Acta 947: 367-384.

Deane EE, Woo NYS. 2005. Cloning and characterization of the hsp70 multigene family from silver sea bream: modulated gene expression between warm and cold temperature acclimation. Biochemical and Biophysical Research Communications 330: 776-783.

Duman JG. 2001. Antifreeze and ice nucleator proteins in terrestrial arthropods. Annual Review of Physiology 63: 327-357.

Feder ME, Hofmann GE. 1999. Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annual Review of Physiology 61: 243-282.

Fernandes M, Xiao H, Lis JT. 1994. Fine structure analysis of the Drosophila and Saccharomyces heat shock factor-heat shock element interactions. Nucleic Acids Research 22: 167-173.

Franke K, Heitmann N, Tobner A, Fischer K. 2014. Fitness costs associated with different frequencies and magnitudes of temperature change in the butterfly Bicyclus anynana. Journal of Thermal Biology 41: 88-94.

Franzellitti S, Fabbri E. 2005. Differential HSP70 gene expression in the Mediterranean mussel exposed to various stressors. Biochemical and Biophysical Research Communications 336: 1157-1163.

Garbuz D, Evgenev MB, Feder ME, Zatsepina OG. 2003. Evolution of the thermotolerance and heat-shock response: evidence from inter/intraspecific comparison and interspecific hybridization in the virilis species group of Drosophila. I. Thermal phenotype. The Journal of Experimental Biology 206: 2392-2408.

Goto SG, Kimura MT. 1998. Heat- and cold-shock responses and temperature adaptations in subtropical and temperate species of Drosophila. Journal of Insect Physiology 44: 1233-1239.

Gray EM. 2013. Thermal acclimation in a complex life cycle: the effects of larval and adult thermal conditions on metabolic rate and heat resistance in Culexpipiens (Diptera: Culicidae). Journal of Insect Physiology 59: 1001-1007.

Huang LH, Kang L. 2007. Cloning and interspecific altered expression of heat shock protein genes in two leafminer species in response to thermal stress. Insect Molecular Biology 16: 491-500.

Huang LH, Wang HS, Kang L. 2008. Different evolutionary lineages of large and small heat shock proteins in eukaryotes. Cell Research 18: 1074-1076.

Huang LH, Wang CZ, Kang L. 2009. Cloning and expression of five heat shock protein genes in relation to cold hardening and development in the leafminer, Liriomyza sativa. Journal of Insect Physiology 55: 279-285.

Huang Y, Wimler KM, Carmichael GG. 1999. Intronless mRNA transport elements may affect multiple steps of pre-mRNA processing. EMBO Journal 18: 1642-1652.

Jensen P, Overgaard J, Loeschcke V, Schou MF, Malte H, Kristensen TN. 2014. Inbreeding effects on standard metabolic rate investigated at cold, benign and hot temperatures in Drosophila melanogaster. Journal of Insect Physiology 62: 11-20.

Jiang XF, Zhai HF, Wang L, Luo LZ, Thomas WS, Zhang L. 2012. Cloning of the heat shock protein 90 and 70 genes from the beet armyworm, Spodoptera exigua, and expression characteristics in relation to thermal stress and development. Cell Stress Chaperones 17: 67-80.

Kostal V, Tollarova-Borovanska M. 2009. The 70 kDa heat shock protein assists during the repair of chilling injury in the insect Pyrrhocoris apterus. PLOS ONE 4: e4546.

Krebs RA, Loeschcke V. 1994. Costs and benefits of activation of the heat-shock response in Drosophila melanogaster. Functional Ecology 8: 730-737.

Kregel KC. 2002. Heat shock proteins: modifying factors in physiological stress responses and acquired thermotolerance. Journal of Applied Physiology 92: 2177-2186.

Landolt PJ, Guedot C, Zack RS. 2011. Spotted cutworm, Xestia c-nigrum (L.) (Lepidoptera: Noctuidae) responses to sex pheromone and blacklight. Journal of Applied Entomology 135: 593-600.

Lansing E, Justesen J, Loeschcke V. 2000. Variation in the expression of Hsp70, the major heat-shock protein, and thermotolerance in larval and adult selection lines of Drosophila melanogaster. Journal of Thermal Biology 25: 443-450.

Lindquist S, Craig EA. 1988. The heat-shock proteins. Annual Review of Genetics 22: 631-677.

Liu XY, Ma XH, Lei CF, Xiao YZ, Zhang ZX, Sun XL. 2011. Synergistic effects of Cydia pomonella granulovirus GP37 on the infectivity of nucleopolyhedro-viruses and the lethality of Bacillus thuringiensis. Archives of Virology 156: 1707-1715.

Livak KJ, Schmittgen TD. 2001. Analysis of temporal gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C (T)) Method. Methods 25: 402-408.

Luo SQ, Wong SC, Xu CR, Hanski I, Wang JR, Lehtonen R. 2014. Phenotypic plasticity in thermal tolerance in the Glanville fritillary butterfly. Journal of Thermal Biology 42: 33-39.

Lyytinen A, Mappes J, Lindstrom L. 2012. Variation in Hsp70 levels after cold shock: signs of evolutionary responses to thermal selection among Leptinotarsa decemlineata populations. PLOS ONE 7: e31446.

Mahroof R, Zhu KY, Subramanyam B. 2005. Changes in expression of heat shock proteins in Tribolium castaneum (Coleoptera: Tenebrionidae) in relation to developmental stage, exposure time, and temperature. Annals of the Entomological Society of America 98: 100-107.

Ming JH, Xie J, Xu P, Liu WB, Ge XP, Liu B, He YJ, Cheng YF, Zhou QL, Pan LK. 2010. Molecular cloning and expression of two HSP70 genes in the Wuchang bream (Megalobrama amblycephala Yih). Fish and Shellfish Immunology 28: 407-418.

Molina A, Biemar F, Muller F, Iyengar A, Prunet P, Maclean N, Martial JA, Muller M. 2000. Cloning and expression analysis of an inducible HSP70 gene from tilapia fish. FEBS Letters 474: 5-10.

Morales M, Planello R, Martmez-Paz P, Herrero O, Cortes E, Martmez-Guitarte JL, Morcillo G. 2011. Characterization of Hsp70 gene in Chironomus riparius: expression in response to endocrine disrupting pollutants as a marker of ecotoxicological stress. Comparative Biochemistry and Physiology Part C: Toxicology and Pharmacology 153: 150-158.

Morimoto RI. 1993. Cell in stress: transcriptional activation of heat shock genes. Science 259: 1409-1410.

Morimoto RI. 1998. Regulation of the heat shock transcriptional response: cross talk between a family of heat shock factors, molecular chaperones, and negative regulators. Genes and Development 12: 3788-3796.

Mukawa S, Goto C. 2010. Mamestra brassicae nucleopolyhedrovirus infection and enhancing effect of proteins derived from Xestia c-nigrum granulovirus in larvae of Mamestra brassicae and Helicoverpa armigera (Lepidoptera: Noctuidae) on cabbage. Journal of Economic Entomology 103: 257-264.

Mukawa S, Goto C. 2011. Enhancing effect of proteins derived from Xestia c-nigrum granulovirus on Mamestra brassicae nucleopolyhedrovirus infection in larvae of Autographa nigrisigna (Lepidoptera: Noctuidae) on cabbage. Applied Entomology and Zoology 46: 55-63.

Park JH, Lee JJ, Yoon S, Lee JS, Choe SY, Choe J, Park EH, Kim CG. 2001. Genomic cloning of the Hsc71 gene in the hermaphroditic teleost Rivulus marmoratus and analysis of its expression in skeletal muscle: identification of a novel muscle-preferred regulatory element. Nucleic Acids Research 29: 3041-3050.

Rinehart JP, Li A, Yocum GD, Robich RM, Hayward SAL, Denlinger DL. 2007. Up-regulation of heat shock proteins is essential for cold survival during insect diapause. Proceedings of the National Academy of Sciences of the USA 104: 11130-11137.

Shen Y, Gong YJ, Gu J, Huang LH, Feng QL. 2014. Physiological effect of mild thermal stress and its induction of gene expression in the common cutworm, Spodoptera litura. Journal of Insect Physiology 61: 34-41.

Shu YH, Du Y, Wang JW. 2011. Molecular characterization and expression patterns of Spodoptera litura heat shock protein 70/90, and their response to zinc stress. Comparative Biochemistry and Physiology Part A: Molecular and Integrative Physiology 158: 102-110.

Sonna LA, Fujita J, Gaffin SL, Lilly CM. 2002. Invited review: effects of heat and cold stress on mammalian gene expression. Journal of Applied Physiology 92: 1725-1742.

Sonoda S, Fukumoto K, Izumi Y, Yoshida H, Tsumuki H. 2006. Cloning of heat shock protein genes (hsp90 and hsc70) and their expression during larval diapause and cold tolerance acquisition in the rice stem borer, Chilo suppressalis Walker. Archives of Insect Biochemistry and Physiology 63: 36-47.

Sorensen JG, Dahlgraad J, Loeschcke V. 2001. Genetic variation in thermal tolerance among natural populations of Drosophila buzzatii: down regulation of Hsp70 expression and variation in heat stress resistance traits. Functional Ecology 15: 289-296.

Sorensen JG, Kristensen TN, Loeschcke V. 2003. The evolutionary and ecological role of heat shock proteins. Ecology Letters 6: 1025-1037.

Tomanek L, Somero GN. 1999. Evolutionary and acclimation-induced variation in the heat-shock responses of congeneric marine snails (genus Tegula) from different thermal habitats: implications for limits of thermotolerance and biogeography. The Journal of Experimental Biology 202: 2925-2936.

Tomcala A, Tollarova M, Overgaard J, Simek P, Kostal V. 2006. Seasonal acquisition of chill tolerance and restructuring of membrane glycerophospholipids in an overwintering insect: triggering by low temperature, desiccation and diapause progression. The Journal of Experimental Biology 209: 4102-4114.

Wang H, Li K, Zhu JY, Fang Q, Ye GY, Wang H, Li K, Zhu JY 2012. Cloning and expression pattern of heat shock protein genes from the endoparasitoid wasp, Pteromalus puparum in response to environmental stresses. Archives of Insect Biochemistry and Physiology 79: 247-263.

Wang L, Yang S, Zhu MH, Xu ZX, Zhao KJ, Han LL. 2014, Analysis of transcription differences of the heat shock cognate 70 gene in different tissues in response to heat stress in Xestia c-nigrum Linnaeus (Lepidoptera: Noctuidae). Chinese Journal of Applied Entomology 51: 1014-1025. (In Chinese)

Wang L, Yang S, Zhao KJ, Han LL. 2015, Expression Profiles of the Heat Shock Protein 70 Gene in Response to Heat Stress in Agrotis c-nigrum (Lepidoptera: Noctuidae). Journal of Insect Science DOI: 10.1093/jisesa/ieu169.

Welch WJ. 1993. How cells respond to stress. Scientific American 268(5): 56-64.

Xi JH, Pan HY, Chen YJ, Guo YL. 2002. Influence of four food plants on development and fecundity of the spotted cutworm, Agrotis c-nigrum. Chinese Journal of Applied Entomology 39: 428-429. (In Chinese)

Yost HJ, Lindquist S. 1991. Heat shock proteins affect RNA processing during the heat shock response of Saccharomyces cerevisiae. Molecular and Cellular Biology 11: 1062-1068.

Yu H, Wan FH, Guo JY. 2012. cDNA cloning of heat shock protein genes and their expression in an indigenous cryptic species of the whitefly Bemisia tabaci complex from China. Journal of Integrated Agriculture 11: 293-302.

Zhang Q, Denlinger DL. 2010. Molecular characterization of heat shock protein 90, 70 and 70 cognate cDNAs and their expression patterns during thermal stress and pupal diapause in the corn earworm. Journal of Insect Physiology 56: 138-150.

Zhang SJ, Qian XJ, Li CJ, Pan FJ, Xu YL. 2013. Pathogenicity of entomopathogenic nematode on Xestia c-nigrum in soybean field. Soybean Science 32: 63-67. (In Chinese)

Zheng WW, Yang DT, Wang JX, Song QS, Gilbert LI, Zhao XF. 2010. Hsc70 binds to ultraspiracle resulting in the upregulation of 20-hydroxyecdsone-responsive genes in Helicoverpa armigera. Molecular and Cellular Endocrinology 315: 282-291.

Zheng YR, Wang WS. 2010. Biological characteristics were observed of Agrotis c-nigrum in the north Chinese. JI LIN Agricultural 12: 109. (In Chinese)

Ling Wang (1), Shuai Yang (1,2), Lanlan Han (1), Kuijun Zhao (1), *, and Lefu Ye (1)

(1) Northeast Agricultural University, College of Agriculture, Heilongjiang Province, Harbin 150030, China

(2) Virus-Free Seedling Research Institute, Heilongjiang Academy of Agricultural Sciences, Heilongjiang Province, Harbin, 150086, China

* Corresponding author; E-mail: kjzhao@163.com

Caption: Fig. 1. Nucleotide and deduced amino acid sequences of Xc-HSC70. The signature sequences of the HSP70 family are shown in boxes, the nuclear localization signal sequence is underlined, the consensus sequence EEVD at the C-terminus is indicated in italics, and the start and stop codons are in bold. The nucleotides and amino acids are numbered along the left and right margins. The sequence encoding Xc-HSC70 has been deposited in GenBank under accession no. KC844151.

Caption: Fig. 2. Nucleotide and deduced amino acid sequences of the Xc-HSP70 gene. The signature sequences of the HSP70 family are shown in boxes, the nuclear localization signal sequence is underlined, the consensus sequence EEVD at the C-terminus is indicated in italics, and the start and stop codons are in bold. The nucleotides and amino acids are numbered along the left and right margins. The sequence encoding Xc-HSP70 has been deposited in GenBank under accession no. HQ698836.

Caption: Fig. 3. Schematic structure of the Xc-HSC70 gene. Exons are shown as boxes in which white boxes represent untranslated regions, whereas the black boxes are the protein-coding exons; introns are indicated as lines between the boxes. The numbers above and below the drawing represent the sizes (base pairs) of each exon and intron, respectively. The start codon (ATG) and stop codon (TAA) are also indicated. The genomic DNA sequence of Xc-HSC70 has been deposited in GenBank under accession no. KF731994.

Caption: Fig. 4. Phylogenetic tree of Xc-HSC70 and Xc-HSP70 amino acid sequences from different species. A 3-letter code has been included to indicate the order name of the corresponding insect and vertebrate orders (COL = Coleoptera, LEP = Lepidoptera, DIP = Diptera, HYM = Hymenoptera, and VER =Vertebrata). The values indicated on the branches correspond to bootstrap percentages (BP).

Caption: Fig. 5. Xc-HSC70 mRNA expression profiles induced by cold (-7 to 5[degrees]C) and heat (37 to 47[degrees]C) in 2nd, 3rd, 4th, 5th, and 6th instars and pupae of Xestia c-nigrum. The relative quantities indicate the levels of the HSC70 gene transcript normalized against transcript levels of [beta]-actin as an internal standard and compared with the transcript levels of the untreated control at 25[degrees]C. An asterisk indicates a significant difference between the control and heat shock conditions (significant, * P < 0.05). The data are denoted as the mean [+ or -] SEM (error bar).

Caption: Fig. 6. Xc-HSP70 mRNA expression profiles induced by cold (-7 to 5[degrees]C) and heat (37 to 47[degrees]C) in 2nd, 3rd, 4th, 5th, and 6th instars and pupae of Xestia cnigrum. The relative quantities indicate the levels of the HSP70 gene transcript normalized against transcript levels of [beta]-actin as an internal standard and compared with the transcript levels of the untreated control at 25[degrees]C. An asterisk indicates a significant difference between the control and heat shock conditions (significant, * P < 0.05). The data are denoted as the mean [+ or -] SEM (error bar).

Caption: Fig. 7. Expression levels of 2 HSP70s at different developmental stages relative to expression levels in 2nd instars at 25[degrees]C. The data are denoted as the mean [+ or -] SEM (error bar), and the different lowercase or uppercase letters indicate a significant differenwce in the means as assessed using multi-comparison tests (P < 0.05).

Table 1. Primers for the experiment in this study.

Primer type      Sequence(5' to 3')                 Use of primers

P1               GAGGGMRTCGACTTCTAYACBTCCATCAC      PCR for Xc-HSC70
P2               CTTGTACTTCTCTGCNTCYTGBACCAT
P3               AACGARCCBACYGCYGCYGC               PCR for Xc-HSP70
P4               GCGTCSATSTCRAADGTGAC
P5               CGTGAAAAGAAGCCGTCAATCG             For full-length
                                                      and gDNA
                                                      sequence of
                                                      Xc-HSC70
P6               GAGTTTCAATCATTTATTGGAGAGACTGTAC
P7               CACCTTTGCTGAGTTACTCTACGAGTT        For full-length
                   AAGCTGAAG                          and gDNA
                                                      sequence of
                                                      Xc-HSP70
P8               CAATATCAGTAAAAGCTTGCTGTAATGTTG
5'HSC70GSP1      CGTTACGTTCTCCACTCCCCTTCTTGTCA      5' RACE for
                   AGGCCG                             Xc-HSC70
5'HSC70GSP2      GTTGGAAGCGAGGTCCTTCTTG
5'HSP70GSP1      ATCAACCCCGACGAGGCCGTAGCTTA         5' RACE for
                                                      Xc-HSP70
5'HSP70GSP2      AGGTACAGGATCTGCTGCTGCTCGA
3'HSC70GSP1      GAACGCTCTGGAATCTTACTGCTTCAACATG    3' RACE for
                                                      Xc-HSC70
3'HSC70GSP2      GAAGTCTACCAACAAGGAGAACAAG
3'HSP70GSP1      GTCGGTGGTTCTACCCGTATTCC            3' RACE for
                                                      Xc-HSP70
3'HSP70GSP2      TACCGTCGTTCCACTAGTGATTT
HSC70F           CTTGCACGGTGACAAGTCTGAG             RT-qPCR for
                                                      Xc-HSC70
HSC70 R          GAATGTCTGGGTTTGCTTGGTG
HSP70 F          GTGACGCGAAGATGGACAAGTC             RT-qPCR for
                                                      Xc-HSP70
HSP70 R          CACCGTAAGCTACAGCCTCGTC
[beta]-actin F   CGCGACCTCACAGACTACCTG              RT-qPCR for
                                                      [beta]-actin
[beta]-actin R   CGTAGGACTTCTCCAGGGAGC

Note: All primers were synthesized at Shanghai Generay
Biotech Co., Ltd. (Shanghai, China).


----------

Please note: Some tables or figures were omitted from this article.
COPYRIGHT 2015 Florida Entomological Society
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Wang, Ling; Yang, Shuai; Han, Lanlan; Zhao, Kuijun; Ye, Lefu
Publication:Florida Entomologist
Article Type:Report
Date:Jun 1, 2015
Words:7519
Previous Article:Pollination activity of Elaeidobius kamerunicus (Coleoptera: Curculionoidea) on oil palm on Hainan island.
Next Article:Characterization of stridulatory structures and sounds of the larger Mexican pine beetle, Dendroctonus approximatus (Coleoptera: Curculionidae:...
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |