Printer Friendly

Expression patterns of germ cell-specific phosducin-like 2 during testicular and ovarian development in chickens.

INTRODUCTION

Phosducin (PDC) is a photoreceptor cell-specific protein that is phosphorylated by cyclic nucleotide-dependent protein kinase. PDC is a known G-protein regulator. Specifically, PDC modulates visual phototransduction by binding with the [beta]- and [gamma]-subunits of the heterotrimeric G-protein (G[beta][gamma]) transducin (Kuo et al., 1989; Bauer et al., 1992). PDC and PDC-like proteins (PDCL, PDCL2, and PDCL3) are members of a conserved family of small thioredoxin-like proteins. PDC family members share an N-terminal helical domain, a central thioredoxin-like fold, and a charged C-terminal extension (Stirling et al., 2007). PDC family members have been identified in many different species, including humans, chimpanzees, cattle, rats, mice, chickens, zebrafish, Drosophila, and yeast. PDCL and PDC share extensive amino acid sequence homology, and both inhibit G[beta][gamma] (Thibault et al., 1999). PDCL2 and PDCL3 also share amino acid sequence homology with PDC, but their binding efficiencies with G-protein are lower (Lopez et al., 2003; Wilkinson et al., 2004; Stirling et al., 2006). In mammals, Pdc expression is not limited to the retina and pineal gland; it is ubiquitously expressed in a series of adult tissues (Bauer et al., 1992). Pdcl and Pdcl3 also show ubiquitous expression (Thibault et al., 1999; Wilkinson et al., 2004). In contrast, Pdcl2 expression is restricted to male and female germ cells (Lopez et al., 2003).

In the present study, we investigated the germ cell-specific protein Pdcl2 in chickens. We used the CLUSTAL X program to perform a comparative analysis of predicted chicken PDCL2 (hereafter, cPDCL2) protein sequences with known PDCL2 protein sequences found in humans, chimpanzees, cattle, dogs, rats, and mice. Expression patterns of cPdcl2 during testicular and ovarian development in chickens were examined by quantitative real-time PCR (qRT-PCR), Northern blot hybridization, and in situ hybridization. Our data describe the expression patterns of the germ cell-specific gene cPdcl2 during testicular and ovarian development in chickens.

MATERIALS AND METHODS

Animals

White Leghorn chickens were used in the present study. Animal management, reproduction, and experimental procedures were performed in accordance with standard protocols of the Division of Animal Genetic Engineering, Seoul National University. All experimental data reported here were from at least three independent experiments.

Tissues and cDNA synthesis

In total, 23 tissues were collected during sexual development in male and female chickens as follows: male and female gonads on embryonic days E6.0, E8.0, and E12.0; testis and ovary at 1 day (hatch), 5 weeks, 8 weeks, 10 weeks, 12 weeks, and 24 weeks; and brain, liver, muscle, spleen, and kidney at 24 weeks. Sex was determined on E4.0 by PCR using W chromosome-specific primers (5'CTATGCCTACCACATTCCTATTTGC and 5'-AGCTGG ACTTCAGACCATCTTCT; Ogawa et al., 1997). Total RNA was extracted using Trizol reagent (Invitrogen), and approximately 0.5 [micro]g total RNA was reverse-transcribed using the Superscript III First-Strand Synthesis System (Invitrogen) according to the manufacturer's protocol.

Multiple sequence alignment and phylogenetic tree analysis

Predicted mRNA sequences (XM_420702) and protein sequences (XP_420702) of cPdcl2 were obtained from a BLAT search of the Chicken Genome Database at the University of California, Santa Cruz (Karolchik et al., 2008), and National Center for Biotechnology Information (NCBI; Benson et al., 2004). PDCL2 protein sequences from chickens, humans (NP_689614), chimpanzees (XP_526622), cattle (NP_001035641), dogs (XP_532378), rats (XP_573585), and mice (NP_075997) were compared using the CLUSTAL X program and edited with the BioEdit program (Lee et al., 2008). The conserved functional domains and potential phosphorylation sites of the cPDCL2 protein were searched in Pfam-A family matrices and the MOTIF search program, respectively (Finn et al., 2006; Zhang et al., 2007). The percent identity between PDCL2 proteins from chickens, humans, cattle, and mice was determined using the NCBI blastp engine (Tatusova and Madden, 1999).

A phylogenetic tree of PDC family members was constructed using the MEGA program via the neighbor joining method (Lee et al., 2008). PDC, PDCL, and PDCL3 protein sequences from humans (NP_002588, NP_005379, and NP_076970), chimpanzees (XP_524997, XP_528422, and XP_001161637), cattle (XP_615567, XP_001250725, and NP_001069113), dogs (NP_001003076, XP_852231, and XP_531782), rats (NP_037004, NP_071583, and NP_001020880), mice (NP_001153202, NP_080452, and NP_081126), and chickens (XP_426634, XP_001234493, and NP_001025983) were obtained from NCBI to construct the phylogenetic tree.

qRT-PCR

qRT-PCR was performed using an iCycler PCR detection system (Bio-Rad Laboratories) to examine the expression patterns of cPdcl2 during testicular and ovarian development. The PCR reaction mixture contained 2 [micro]l PCR buffer, 1.6 [micro]l 2.5 mM dNTP mixture, 10 pmol each of the forward and reverse primers of cPdc12 or cGapdh (Table 1), 2 [micro]l cDNA, 1 [micro]l EvaGreen (Biotium), and 1 U Taq DNA polymerase in a final volume of 20 [micro] PCR was performed using an initial incubation at 50[degrees]C for 2 min and 95[degrees]C for 10 min, followed by 40 cycles at 95[degrees]C for 15 s, 58[degrees]C for 30 s, and 72[degrees]C for 30 s. PCR was terminated by a final incubation at the dissociation temperatures of 95[degrees]C for 15 s, 60[degrees]C for 30 s, and 95[degrees]C for 15 s. Threshold cycles of cPdcl2 were normalized with cGapdh. Relative cPdcl2 expression levels were quantified using the 2-[[DELTA][DELTA]Ct] method (Livak and Schmittgen, 2001).

Hybridization probes

Testis cDNA from 24-week-old chickens was amplified using cPdcl2- and cGapdh-specific primers (Table 1). The amplified fragments were separated by gel electrophoresis and cloned into a pGEM-T Easy vector (Promega), respectively. After sequence linearization, recombinant plasmids containing cPdcl2 and cGapdh were amplified with T7- and SP6-specific primers, respectively (Rengaraj et al., 2008a). The recombinant DNA was labeled with a digoxigenin RNA labeling kit (Roche) to prepare sense and antisense cRNA probes for Northern blotting and in situ hybridization.

Northern blot hybridization

Tissue-specific cPdcl2 expression was examined in the brain, liver, muscle, spleen, kidney, testis, and ovary of 24-week-old chickens by Northern blot using a digoxigenin Northern Starter Kit (Roche; Holtke et al., 1995). Total RNA was electrophoresed on a 1% formaldehyde agarose gel, capillary-blotted onto a Hybond membrane (Amersham), and UV cross-linked. Blots were hybridized with cPdcl2 and cGapdh antisense cRNA probes. The membrane was then rinsed three times with 2xSSC and 0.2% SDS at room temperature, and rinsed twice with 0.1xSSC and 0.2% SDS at 68[degrees]C. After nonspecific binding was blocked, the membrane was incubated with antidigoxigenin antibody conjugated to alkaline phosphatase (Roche) for 1 h at room temperature. The signal was developed with nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Sigma) in a buffer containing 0.1 M NaCl, 0.05 M Mg[Cl.sub.2], and 0.1 M Tris-HCl (pH 9.5) for 5 h in the dark.

In situ hybridization

Localization of cPdcl2 mRNA was examined during testicular and ovarian development in 1-day-, 5-week-, 10-week- and 24-week-old chickens using in situ hybridization as described previously (Rengaraj et al., 2008b). Briefly, frozen sections mounted on slides treated with 3-aminopropyltriethoxysilane (Sigma) were dried at 50[degrees]C and fixed in 4% paraformaldehyde for 1 h at room temperature. The sections were incubated with a hybridization mixture containing 50% formamide, 5x SSC (pH 7.0), 10% dextron sulphate sodium, 0.02% BSA, 250 [micro]g tRNA, and sense or antisense cRNA probes of cPdcl2 at 55[degrees]C for 18 h. After nonspecific binding was blocked with 1% blocking reagent, the sections were incubated overnight with a sheep antidigoxigenin antibody conjugated to alkaline phosphatase (Roche). The mRNA signal was visualized using nitroblue tetrazolium, 5-bromo-4-chloro-3-indolyl phosphate, and levamisole. The sections were counterstained with 1% methyl green (Sigma), and photographs were taken under an Axiophot light microscope (Carl Zeiss).

RESULTS

Multiple sequence alignment and phylogenetic tree analysis

Predicted gene sequences of cPdcl2 were obtained from a University of California, Santa Cruz, BLAT search of NCBI GenBank sequences from the chicken genome. cPdcl2 was mapped to chromosome 4 in the chicken genome database and was found to encode a 244-amino acid protein. Searches for conserved domains of cPDCL2 in Pfam-A with the E-value cut-off level set at 0.05 had a specific hit with a PDC domain consisting of 232 amino acids (E-value: 1.4e-06; Figure 1).

Structurally, the cPDCL2 protein consisted of three potential phosphorylation sites for casein kinase II (S/T-X-X-D/E, where X represents a variable amino acid; Pinna, 1990), one potential phosphorylation site for tyrosine kinase (R/K-X-X-D/E-X-X-X-Y, where X represents a variable amino acid; Cooper et al., 1984), one potential phosphorylation site for N-glycosylation (N-X-S/T-X, where X represents a variable amino acid but not Proline; Pless and Lennarz, 1977; Bause, 1983), and two potential phosphorylation sites for N-myristoylation (G-X-X-X S/T/A/G/C/N-X, where charged residues (EDRKHPFYW) at position 2 and Proline at position 6 are not allowed; Towler et al., 1988). Of these, two phosphorylation sites for casein kinase II, two phosphorylation sites for N-myristoylation, and one phosphorylation site for N-glycosylation were highly conserved in most of the species (Figure 1).

Percent identity calculations of cPDCL2 with mammalian PDCL2 proteins over the entire alignment indicated extensive similarities: 76% to human and chimpanzee; 75% to cattle; and 72% to dog, rat, and mouse. A phylogenetic tree was constructed using full-length protein sequences of PDC family members (i.e., human, chimpanzee, cattle, dog, rat, mouse, and chicken) by the neighbor-joining method. In the phylogenetic tree, PDC family proteins were grouped into two major clusters. PDC and PDCL proteins showed high similarity and formed one major cluster. PDCL2 and PDCL3 proteins also showed high similarity and formed another major cluster. PDC, PDCL, PDCL2, and PDCL3 proteins of different species were grouped into four minor clusters, respectively. All chicken PDC family members showed high similarity and grouped with the clusters of their mammalian homologues (Figure 2).

Tissue- and duration-specific cPdcl2 expression

qRT-PCR was used to examine expression levels of cPdcl2 during testicular and ovarian development in E6.0, E8.0, E12.0, 1-day- (hatch), 5-week-, 8-week-, 10week-, 12-week-, and 24-week-old chickens. cPdcl2 expression was differentially detected during testicular and ovarian development. In females, cPdcl2 expression was detected at a low level during all stages of ovarian development. In males, cPdcl2 expression was detected at low levels until hatching. After hatching, cPdcl2 expression increased slightly until 8 weeks of age and then maintained a constant level until 12 weeks. The relative expression of cPdcl2 was developmentally upregulated after 12 weeks and peaked at 24 weeks (Figure 3). Because the relative expression levels of cPdcl2 were high in the testis of 24-weeks-old chickens, we further examined the specificity of cPdcl2 in several tissues of 24-week-old chickens using Northern blot. cPdcl2 mRNA expression was detected only in the testis. No detectable cPdcl2 mRNA expression was observed in the brain, liver, muscle, spleen, kidney, or ovary of 24-week-old chickens (Figure 4).

[FIGURE 1 OMITTED]

[FIGURE 2 OMITTED]

mRNA localization of cPdcl2 during testicular and ovarian development

Localization of cPdcl2 mRNA during testicular and ovarian development in 1-day-, 5-week-, 10-week- and 24-week-old chickens was performed using in situ hybridization. cPdcl2 expression was not detected in the ovary during sexual development between hatching and 24 weeks (Figure 5). In the testis, cPdcl2 expression was not detected between hatching and 5 weeks. From 10 weeks of age, cPdcl2 mRNA expression was detected within the adluminal compartment. Specifically, primary spermatocytes and secondary spermatocytes strongly expressed cPdcl2 mRNA at 10 weeks. At 24 weeks, high levels of cPdcl2 mRNA were detected in primary spermatocytes, secondary spermatocytes, and round spermatids. cPdcl2 expression was not detected in Sertoli cells or spermatogonia in the basal compartment or in the basement membrane and interstitial tissues of Leydig cells at either 10 weeks or 24 weeks (Figure 5).

[FIGURE 3 OMITTED]

[FIGURE 4 OMITTED]

[FIGURE 5 OMITTED]

DISCUSSION

In mammals, the PDC family consists of four isoforms: PDC, PDCL, PDCL2, and PDCL3. PDC family members are modulators of visual phototransduction, which occurs via binding with the G-protein [beta][gamma]y-subunits. PDC family members also have other important functions. Recent findings suggest that all PDC family members act as cochaperones with the cytosolic chaperonin complex to assist in the folding of a variety of proteins, including actins, tubulins, and regulators of the cell cycle (Stirling et al., 2007; Willardson and Howlett, 2007). The PDCL2 protein is the least characterized isoform; however, it is necessary for gametocyte transition into the haploid state. In the present study, we investigated the predicted Pdcl2 gene/protein of the chicken homologue. This is the first study to characterize at least one member of the PDC isoform in chickens.

To better understand the functional similarities, one must characterize the structural features of cPDCL2 and analyze its conservation with mammalian homologues. Searches for conserved domains in the Pfam database have revealed that up to 95% of cPDCL2 protein sequences consist of a PDC domain. PDC is a G[beta][gamma]-binding protein that is ubiquitously expressed in several tissues. Furthermore, it is involved in the regulation of the light-dependent movement of the photoreceptor G-protein transducin (Schulz, 2001; Lukov et al., 2004). PDCL2 proteins from chickens, humans, chimpanzees, cattle, dogs, rats, and mice share several potential functional sites-including a casein kinase II phosphorylation site, an Nglycosylation phosphorylation site, and an N-myristoylation phosphorylation site-that may play a role in G-protein signaling. For example, the G[alpha]-subunit can be myristoylated at the N-terminus end for proper plasma membrane localization of G[alpha], and functional sites can regulate the interactions of G[alpha] with G[beta][gamma], effectors, and G-protein regulators (Lukov et al., 2004). Casein kinase II is a constitutively active and ubiquitously expressed serinethreonine kinase (Humrich et al., 2003). Casein kinase II phosphorylation sites have been identified in other members of the PDC family; casein kinase II phosphorylation is required for normal G[gamma] translation and G[beta][gamma] dimer assembly (Humrich et al., 2003; Lukov et al., 2006). Similarities in structural features between PDCL2 proteins from chickens and mammals suggest that these proteins may have close functional relationships. Moreover, the genetic distances of PDC family proteins in the phylogenetic tree suggest that all PDC family proteins originated from the same ancestral protein.

Mammalian Pdc, Pdcl, and Pdcl3 expression was detected in several tissues. The widespread distribution of these proteins is reminiscent of other proteins involved in G-protein-mediated signaling (Bauer et al., 1992; Thibault et al., 1999; Wilkinson et al., 2004). Pdcl2 expression differs from the expression of other members of the Pdc family; mammalian Pdcl2 expression was detected at high levels in the testis and at a low level in the ovary. In a previous study, mammalian Pdcl2 was strongly detected in pachytene spermatocytes to early post-meiotic spermatids in the testis (Lopez et al., 2003). In the present study, we found similar expression patterns of cPdcl2 in the testis and ovary of chickens using qRT-PCR and in situ hybridization analysis. However, Northern blot and in situ hybridization failed to detect cPdcl2 transcripts in the ovary. The number of gametocytes that undergo meiosis is more limited in the ovary than the testis. This may be a reason why Pdcl2 expression was not detected in the ovary. In male chickens, the onset of meiosis occurs after the completion of Sertoli cell proliferation (Kirby and Froman, 2000). Using qRTPCR, we found that cPdcl2 expression increased from 8 weeks, which suggests that cPdcl2 may be active after the completion of the first meiotic division. Pdcl2, which is not necessary for growth, is important for the establishment of the haploid state (Lopez et al., 2003).

In conclusion, we investigated the expression patterns of cPdcl2, which is highly conserved with mammalian Pdcl2. Pdcl2 expression was identified in the testis and ovary by qRT-PCR; however, expression levels were much lower in the ovary at all stages of development. In the testis, cPdcl2 expression was elevated after the completion of the first meiotic division and was detected in spermatocytes and early spermatids.

REFERENCES

Bauer, P. H., S. Milller, M. Puzicha, S. Pippig, B. Obermaier, E. J. Helmreich and M. J. Lohse. 1992. Phosducin is a protein kinase A-regulated G-protein regulator. Nature 358:73-76.

Bause, E. 1983. Structural requirements of N-glycosylation of proteins. Studies with proline peptides as conformational probes. Biochem. J. 209:331-336.

Benson, D. A., I. Karsch-Mizrachi, D. J. Lipman, J. Ostell and D. L. Wheeler. 2004. GenBank: update. Nucleic Acids Res. 32:D23-D26.

Cooper, J. A., F. S. Esch, S. S. Taylor and T. Hunter. 1984. Phosphorylation sites in enolase and lactate dehydrogenase utilized by tyrosine protein kinases in vivo and in vitro. J. Biol. Chem. 259:7835-7841.

Finn, R. D., J. Mistry, B. Schuster-Bockler, S. Griffiths-Jones, V. Hollich, T. Lassmann, S. Moxon, M. Marshall, A. Khanna, R. Durbin, S. R. Eddy, E. L. Sonnhammer and A. Bateman. 2006. Pfam: clans, web tools and services. Nucleic Acids Res. 34:D247-251.

Holtke, H. J., W. Ankenbauer, K. Muhlegger, R. Rein, G. Sagner, R. Seibl and T. Walter. 1995. The digoxigenin (DIG) system for non-radioactive labelling and detection of nucleic acids--an overview. Cell Mol. Biol. 41:883-905.

Humrich, J., C. Bermel, T. Grubel, U. Quitterer and M. J. Lohse. 2003. Regulation of phosducin-like protein by casein kinase 2 and N-terminal splicing. J. Biol. Chem. 278:4474-4481.

Karolchik, D., R. M. Kuhn, R. Baertsch, G. P. Barber, H. Clawson, M. Diekhans, B. Giardine, R. A. Harte, A. S. Hinrichs, F. Hsu, K. M. Kober, W. Miller, J. S. Pedersen, A. Pohl, B. J. Raney, B. Rhead, K. R. Rosenbloom, K. E. Smith, M. Stanke, A. Thakkapallayil, H. Trumbower, T. Wang, A. S. Zweig, D. Haussler and W. J. Kent. 2008. The UCSC Genome Browser Database: 2008 update. Nucleic Acids Res. 36:D773-D779.

Kirby, J. D. and D. P. Froman. 2000. Reproduction in male birds. In Avian Physiology 5th edn. (Ed. G. C. Whittow). San Diego: Academic Press. pp. 597-615.

Kuo, C. H., H. Taniura, Y. Watanabe, Y. Fukada, T. Yoshizawa and N. Miki. 1989. Identification of a retina-specific MEKA protein as a 33 K protein. Biochem. Biophys. Res. Commun. 162:1063-1068.

Lee, J. Y., J. M. Lim, D. K. Kim, Y. H. Zheng, S. Moon, B. K. Han, K. D. Song, H. Kim and J. Y. Han. 2008. Identification and gene expression profiling of the Pum1 and Pum2 members of the Pumilio family in the chicken. Mol. Reprod. Dev. 75:184-190.

Livak, K. J. and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-408.

Lopez, P., R. Yaman, L. A. Lopez-Fernandez, F. Vidal, D. Puel, P. Clertant, F. Cuzin and M. Rassoulzadegan. 2003. A novel germ line-specific gene of the phosducin-like protein (PhLP) family. A meiotic function conserved from yeast to mice. J. Biol. Chem. 278:1751-1757.

Lukov, G. L., C. M. Baker, P. J. Ludtke, T. Hu, M. D. Carter, R. A.

Hackett, C. D. Thulin and Willardson, B. M. 2006. Mechanism of assembly of G protein [beta][gamma] subunits by protein kinase CK2-phosphorylated phosducin-like protein and the cytosolic chaperonin complex. J. Biol. Chem. 281:22261-22274.

Lukov, G. L., C. S. Myung, W. E. McIntire, J. Shao, S. S. Zimmerman, J. C. Garrison and B. M. Willardson. 2004. Role of the isoprenyl pocket of the G protein beta gamma subunit complex in the binding of phosducin and phosducin-like protein. Biochemistry 43:5651-5660.

Ogawa, A., I. Solovei, N. Hutchison, Y. Saitoh, J. E. Ikeda, H. Macgregor and S. Mizuno. 1997. Molecular characterization and cytological mapping of a non-repetitive DNA sequence region from the W chromosome of chicken and its use as a universal probe for sexing Carinatae birds. Chromosome Res. 5:93-101.

Pinna, L. A. 1990. Casein kinase 2: an 'eminence grise' in cellular regulation? Biochim. Biophys. Acta. 1054:267-284.

Pless, D. D. and W. J. Lennarz. 1977. Enzymatic conversion of proteins to glycoproteins. Proc. Natl. Acad. Sci. USA. 74:134-138.

Rengaraj, D., D. K. Kim, Y. H. Zheng, S. I. Lee, H. Kim and J. Y.

Han. 2008a. Testis-specific novel transcripts in chicken: in situ localization and expression pattern profiling during sexual development. Biol. Reprod. 79:413-420.

Rengaraj, D., X. H. Liang, F. Gao, W. B. Deng, N. Mills and Z. M. Yang. 2008b. Differential expression and regulation of integral membrane protein 2b in rat male reproductive tissues. Asian J. Androl. 10:503-511.

Schulz, R. 2001. The pharmacology of phosducin. Pharmacol. Res. 43:1-10.

Stirling, P. C., J. Cuellar, G. A. Alfaro, F. El Khadali, C. T. Beh, J. M. Valpuesta, R. Melki and M. R. Leroux. 2006. PhLP3 modulates CCT-mediated actin and tubulin folding via ternary complexes with substrates. J. Biol. Chem. 281:7012-7021.

Stirling, P. C., M. Srayko, K. S. Takhar, A. Pozniakovsky, A. A. Hyman and M. R. Leroux. 2007. Functional interaction between phosducin-like protein 2 and cytosolic chaperonin is essential for cytoskeletal protein function and cell cycle progression. Mol. Biol. Cell 18:2336-2345.

Tatusova, T. A. and T. L. Madden. 1999. BLAST 2 sequences, a new tool for comparing protein and nucleotide sequences. FEMS Microbiol. Lett. 174:247-250.

Thibault, C., J. Feng Wang, R. Charnas, D. Mirel, S. Barhite and M. F. Miles. 1999. Cloning and characterization of the rat and human phosducin-like protein genes: structure, expression and chromosomal localization. Biochim. Biophys. Acta. 1444:346-354.

Towler, D. A., J. I. Gordon, S. P. Adams and L. Glaser. 1988. The biology and enzymology of eukaryotic protein acylation. Annu. Rev. Biochem. 57:69-99.

Wilkinson, J. C., B. W. Richter, A. S. Wilkinson, E. Burstein, J. M. Rumble, B. Balliu and C. S. Duckett. 2004. VIAF, a conserved inhibitor of apoptosis (IAP)-interacting factor that modulates caspase activation. J. Biol. Chem. 279:51091-51099.

Willardson, B. M. and A. C. Howlett. 2007. Function of phosducin-like proteins in G protein signaling and chaperone-assisted protein folding. Cell Signal. 19:2417-2427.

Zhang, S., H. Shi and H. Li. 2007. Cloning and tissue expression characterization of the chicken APOB gene. Anim. Biotechnol. 18:243-250.

Ying Hui Zheng, Deivendran Rengaraj, Kyung Je Park, Sang In Lee and Jae Yong Han**

WCU Biomodulation Major, Department of Agricultural Biotechnology and Research Institute for Agriculture and Life Sciences, Seoul National University, Seoul, 151 921, Korea

* This work was supported by a grant from the BioGreen 21 Programme (No. 20070401034010), Rural Development Administration and World Class University Programme (R312008-000-10056-0) of the Ministry of Education, Science and Technology, Korea.

** Corresponding Author: Jae Yong Han. Tel: 2-880-4810, Fax: 2-874-4811, E-mail: jaehan@snu.ac.kr

Received October 5, 2009; Accepted November 16, 2009
Table 1. Primers used for cPdcl2 and cGapdh examined by qRT-PCR,
Northern hybridization and in situ hybridization in chickens

Gene       Accession No.        Primer sequences (a)         Size

cPdcl2     XM_420702         F: 5'-GAGGAGGCAAAAGTATGGGG     160 bps
                             R: 5'-CCTGGCTAAGTGGCTGAGGT
                             F: 5'-ATGCTCCTGAGGATGTTTGG     404 bps
                             R: 5'-TTTCAGCACGTCACTGCTTT

cGapdh     NM_204305         F: 5'-ACACAGAAGACGGTGGATGG     193 bps
                             R: 5'-GGCAGGTCAGGTCAACAACA
                             F: 5'-CACAGCCACACAGAAGACGG     443 bps
                             R: 5'-CCATCAAGTCCACAACACGG

(a) First primer pairs were used for qRT-PCR, and second primer
pairs were used for the synthesis of hybridization probes.
COPYRIGHT 2010 Asian - Australasian Association of Animal Production Societies
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2010 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Zheng, Ying Hui; Rengaraj, Deivendran; Park, Kyung Je; Lee, Sang In; Han, Jae Yong
Publication:Asian - Australasian Journal of Animal Sciences
Article Type:Report
Geographic Code:9SOUT
Date:Jul 15, 2010
Words:3817
Previous Article:PCR-SSCP of serum lysozyme gene (exon-III) in riverine buffalo and its association with lysozyme activity and somatic cell count.
Next Article:Microbial flora of normal and abnormal cervical mucous discharge associated with reproductive performance of cows and heifers in estrus.
Topics:

Terms of use | Copyright © 2017 Farlex, Inc. | Feedback | For webmasters